A KASP molecular marker associated with the width of fresh soybean pods, its primers, and applications
By developing KASP molecular markers related to the pod width of fresh soybeans, and using GWAS analysis and quantitative PCR with specific primer combinations, the problems of complex operation and high cost in existing technologies have been solved, achieving efficient pod width identification and improving breeding efficiency, and cultivating high-yielding and high-quality fresh soybean varieties.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-04
- Publication Date
- 2026-04-03
AI Technical Summary
Existing molecular marker technologies related to the pod width of fresh soybeans are complex to operate, costly, and difficult to efficiently assist in breeding, resulting in low breeding efficiency.
We developed KASP molecular markers associated with the pod width of fresh soybeans, used GWAS analysis to identify significantly associated QTL sites, designed specific primer combinations for quantitative real-time PCR amplification, and determined the genotype by fluorescence signal, thus achieving a simple and low-cost identification of pod width.
It enables simple and low-cost pod width identification, improves breeding efficiency, shortens the breeding cycle, and can cultivate high-yield and high-quality fresh soybean varieties.
Smart Images

Figure CN119162362B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular genetic breeding technology, and in particular to a KASP molecular marker associated with the width of fresh soybean pods and its application. Background Technology
[0002] The pod width of fresh soybeans is an important agronomic trait affecting soybean yield and appearance quality. In recent years, with consumers' increasing demands for the taste and nutritional value of food, the market demand for fresh soybeans has gradually increased. Research on the pod width of fresh soybeans can provide important theoretical basis for fresh soybean breeding, enabling the cultivation of new varieties that are both high-yielding and of high quality to meet market demand.
[0003] KASP (Kompetitive Allele Specific PCR) markers offer advantages over traditional molecular marker techniques such as SSR, RFLP, and AFLP, including ease of operation, accurate results, and low cost, and have been widely applied in plant genetics and breeding, genomics research, and other fields. GWAS (Genome-wide Association Study) analysis was used to identify QTL loci significantly associated with the pod width of fresh soybean, and KASP markers were developed based on their sequences. Currently, the utilization rate of soybean resources is low, and there are few dedicated fresh soybean varieties. Using KASP molecular markers related to the pod width of fresh soybean for genotyping and marker-assisted breeding of fresh soybean materials from different sources can consistently improve breeding efficiency. Summary of the Invention
[0004] In view of this, the object of the present invention is to provide a KASP molecular marker related to the width of fresh soybean pods and its application. To achieve the above object, the present invention provides the following solution:
[0005] A KASP molecular marker associated with the width of fresh soybean pods, the nucleotide sequence of which is shown in SEQ ID NO.1, has a T / A base mutation at position 151 of the sequence shown in SEQ ID NO.1, where the genotype for wide pods is A and the genotype for narrow pods is T.
[0006] SEQ ID NO.1:
[0007] CCCCTGCATAATCGTTGTCAGTGTAAGCAAGAAGCTCTTTGTTTCCTCCCTTTTTGTAGAAAATTCCAAA
[0008] CTCAGTTGTTCCCTTTAAATATCTCAGCACCCTTTTGGCTGCTAGTAAATGCAGCTCAGTAGGATTCTCC
[0009] ATGTACCTGCWAATTAAGTTCACCACAAACATCATATCGGGCCGAGTAGATGTTAGATACATAAGACTTC
[0010] CCACAATTTGTTTATAGTAAGTCTTATCCACCTTTACACCAGTGTCGTCCTTTGTGAGTTTAACACCAGGAACAATTGGAGTTTGCACCGA, where W = T or A.
[0011] The application of the KASP molecular marker or the reagent for detecting the KASP molecular marker in any of the following: A. Application in the identification of the width of fresh soybean pods;
[0012] Application of B in improving fresh soybean germplasm resources;
[0013] Application of C in the cultivation of high-yield fresh soybeans.
[0014] As a preferred embodiment of the present invention, the reagent for detecting the KASP molecular marker is a primer combination for detecting the KASP molecular marker.
[0015] As a further preferred embodiment of the present invention, the primer combination consists of the following primers:
[0016] Forward primer F1-FAM: SEQ ID NO.2;
[0017] Forward primer F2-HEX: SEQ ID NO.3;
[0018] Reverse primer R: SEQ ID NO.4.
[0019] A primer combination for amplifying the KASP molecular marker, the primer combination consisting of the following primers:
[0020] Forward primer F1-FAM: SEQ ID NO.2;
[0021] Forward primer F2-HEX: SEQ ID NO.3;
[0022] Reverse primer R: SEQ ID NO.4.
[0023] A method for identifying the width of fresh soybean pods includes the following steps: using the genomic DNA of the soybean sample to be tested as a template, performing quantitative real-time PCR amplification using the primer combination, and performing genotyping based on the fluorescence detection results of the amplified products. If the PCR product of the sample only detects the fluorescence signal corresponding to F1-FAM, the genotype of the detection site is T, and it is determined to be a narrow-pod wide single plant; if the PCR product of the sample only detects the fluorescence signal corresponding to F2-HEX, the genotype of the detection site is A, and it is determined to be a wide-pod wide single plant.
[0024] As a preferred embodiment of the present invention, the fluorescence quantitative PCR reaction system is as follows:
[0025]
[0026] The primer mixture is the primer combination mixture described in claim 5.
[0027] As a preferred embodiment of the present invention, the PCR amplification procedure is as follows:
[0028] First round of cycles
[0029]
[0030] The beneficial effects of this invention are as follows: This invention develops a KASP molecular marker that is significantly correlated with the pod width of fresh soybeans, which can be used to determine the pod width of soybeans. It is characterized by its simplicity and low cost. This is beneficial for breeding high-yield and high-quality fresh soybean varieties, assisting in molecular breeding of fresh soybeans, improving breeding efficiency, shortening the breeding cycle, and has broad application prospects. Attached Figure Description
[0031] Figure 1 This is a Manhattan plot of the genome-wide association study of fresh soybean pod width in this invention;
[0032] Figure 2 This is a genotyping diagram of different fresh soybean germplasms using the marker KASP628331 in Example 3 of the present invention; the small circle in the upper left corner represents the narrow fresh soybean germplasm with genotype (T / T), the small circle in the lower right corner represents the wide fresh soybean germplasm with genotype (A / A), the small circle in the middle represents the soybean germplasm with genotype (T / A), and the small circle in the lower left corner represents the template-free control NTC. Detailed Implementation
[0033] To make the objectives and technical solutions of this invention clearer, the invention will be further described below in conjunction with the accompanying drawings and embodiments.
[0034] Example 1: Screening to obtain SNP sites related to soybean pod width
[0035] 1. Experimental Materials
[0036] This invention utilizes 300 collected and preserved soybean germplasm resources, which were planted in the spring of 2022 at the Jiangsu Academy of Agricultural Sciences experimental base in Lishui District, Nanjing City. At the R6 stage, the width of the soybean pods was measured, and the results are shown in Table 1.
[0037] Table 1. Statistics on soybean germplasm resource names and pod widths
[0038]
[0039]
[0040]
[0041]
[0042]
[0043] 2. Genome-wide association analysis of soybean pod width
[0044] DNA was extracted from the leaves of the experimental materials in Table 1 using a soybean genomic DNA extraction kit (purchased from Tiangen Company).
[0045] In this invention, the SNP marker information of the natural population used for GWAS analysis came from the group's previous resequencing work, containing a total of 2777,022 SNPs. Genome-wide association analysis was performed using a mixed linear model and the GAPIT package in R software. Simultaneously, a p-value ≤ 1 / 2777,022 = 3.60E-7 was selected. 10 P ≥ 6.4 is the significance threshold, when the SNP's -log 10 A p-value ≥ 6.4 indicates a significantly associated site. Based on this, SNP sites significantly associated with 8 pod lengths and 6 pod widths were identified (Table 2). Figure 1 ).
[0046] Table 2. SNP information related to soybean pod width.
[0047]
[0048]
[0049] Example 2: Development of Pod Width-Related KASP Tags
[0050] A 301bp sequence was obtained by selecting 150bp sequences upstream and downstream of position 628331bp on soybean chromosome S13, as shown in SEQ ID NO:1. The molecular marker at position 628331bp on soybean chromosome S13 corresponds to position 151 of SEQ ID NO:1, and the nucleotide at this position is either T or A.
[0051] Using NCBI's Primerblast function, primers were designed based on the soybean pod width significantly associated SNP site S13_628331(T / A). Two forward primers, KASP628331F1 and KASP628331F2, and one universal reverse primer, KASP628331R, were designed, with the following nucleotide sequences:
[0052] KASP628331F1:GGATTCTCCATGTACCTGCT
[0053] KASP628331F2:GGATTCTCCATGTACCTGCA
[0054] KASP628331R:CTGGTGTAAAGGTGGAT
[0055] The KASP primers were designed based on the genotypic variations of broad-pod and narrow-pod plants at position 628331 on chromosome S13, with the broad-pod genotype being A and the narrow-pod genotype being T.
[0056] The 5' short linker sequence of primer F1 is connected to the FAM fluorescent adapter sequence, the 5' short linker sequence of primer F2 is connected to the HEX fluorescent adapter sequence, and the primer sequences after linking the fluorescent adapters are as follows:
[0057] F1-FAM: GAAGGTGACCAAGTTCATGCT GGATTCTCCATGTACCTGCT (SEQ ID NO.2, where the underlined portion is the FAM fluorescent tag sequence)
[0058] F2-HEX: GAAGGTCGGAGTCAACGGATT GGATTCTCCATGTACCTGCA (SEQ ID NO.3, where the underlined portion is the HEX fluorescent tag sequence)
[0059] Reverse primer R: CTGGTGTAAAGGTGGAT (SEQ ID NO.4)
[0060] Example 3: Gene Analysis and Pod Width Identification
[0061] The synthesized KASP628331-FAM, KASP628331F2-HEX, and reverse primer R were dissolved in ddH2O to a concentration of 10 μM. Then, a 50 μL primer mixture was prepared by mixing KASP628331F1-FAM (6 μL), KASP628331F2-HEX (6 μL), reverse primer R (15 μL), and ddH2O (23 μL). Using the genomic DNA of various soybean germplasm resources obtained in step 2 as templates, PCR reactions were performed according to the following reaction system and procedure. For the negative control, ddH2O was used instead of genomic DNA in the reaction.
[0062] PCR reaction system:
[0063]
[0064] PCR amplification procedure:
[0065]
[0066] Second round of cycling
[0067]
[0068] Fluorescence detection was performed on the amplification products. If only the fluorescence signal corresponding to KASP628331F1-FAM was detected in the PCR product of the sample, the genotype of the detection site was T, and it was determined to be a narrow-pod, wide-strain plant. If only the fluorescence signal corresponding to KASP628331F2-HEX was detected in the PCR product of the sample, the genotype of the detection site was A, and it was determined to be a wide-pod, wide-strain plant.
[0069] The developed KASP marker was used to amplify and genotype 27 soybean germplasms. The results are shown in Table 3. Figure 2 As shown, molecular markers can clearly distinguish between the two genotypes.
[0070] Table 327 results of pod width and genotyping of fresh soybean germplasms.
[0071]
[0072]
[0073] The above description is only a preferred embodiment of the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. The application of the KASP molecular marker associated with the width of fresh soybean pods shown in SEQ ID NO.1 or the reagent for detecting the KASP molecular marker in the identification of the width of fresh soybean pods; a T / A base mutation exists at position 151 of the sequence shown in SEQ ID NO.1, where the genotype for wide pods is A and the genotype for narrow pods is T.
2. The application according to claim 1, characterized in that, The reagent is a primer combination for detecting the KASP molecular marker described in claim 1.
3. The application according to claim 2, characterized in that, The primer combination consists of the following primers: Forward primer F1-FAM: SEQ ID NO.2; Forward primer F2-HEX: SEQ ID NO.3; Reverse primer R: SEQ ID NO.
4.
4. A method for identifying the width of fresh soybean pods, characterized in that, The method includes the following steps: using the genomic DNA of the soybean sample to be tested as a template, performing quantitative real-time PCR amplification using the primer combination described in claim 3, and performing genotyping based on the fluorescence detection results of the amplification products. If the sample PCR product only detects the fluorescence signal corresponding to F1-FAM, the genotype of the detection site is T, and it is determined to be a narrow-pod, wide-plant single plant; if the sample PCR product only detects the fluorescence signal corresponding to F2-HEX, the genotype of the detection site is A, and it is determined to be a wide-pod, wide-plant single plant.
5. The method according to claim 4, characterized in that, The fluorescence quantitative PCR reaction system is as follows: KASP master mix 2.5μL Primer mixture 0.14 μL, Template DNA 2.0 μL 0.36 μL of pure water; The primer mixture is the primer combination mixture described in claim 3.
6. The method according to claim 4, characterized in that, PCR amplification procedure: 。