Transcription factor for regulating and controlling peony terpene synthase gene expression and application thereof

Abstract

The invention discloses a transcription factor for regulating and controlling a peony terpene synthase gene and application of the transcription factor. The amino acid sequence of the transcription factor for regulating and controlling the peony terpene synthase gene is shown as a sequence 3 and a sequence 4 in a sequence table, and the nucleotide sequence of the transcription factor is shown as a sequence 1 or a sequence 2 in the sequence table. The transcription factor can be used for cultivating peony germplasm which contains higher terpenoids compared with wild type peony germplasm.

Description

Technical Field

[0001] The invention relates to a transcription factor for regulating the expression of peony terpene synthase gene and application thereof. Background Art

[0002] The release of floral fragrance is an important characteristic of flowering plants, and it has important biological significance in terms of plant reproduction, defense, and interactions between plants. In addition, floral fragrance, as an important indicator of flower quality, is of great significance for improving the ornamental and economic value of flowers. In recent years, the extraction of essential oils and spices from fragrant flower plants as raw materials for perfumes and cosmetics has also become a development trend. Plant floral fragrance compounds are mainly divided into three categories: terpenes, phenylpropionic acid / benzene ring compounds, and fatty acid derivatives. Terpene compounds are the largest class of plant volatiles, among which monoterpenes are the main components of the floral fragrance of many plants. Terpene synthase is located at the terminal of the terpene biosynthesis pathway and is directly involved in the synthesis of terpene products. It plays a vital role in plant terpene metabolism.

[0003] Peony (Paeonia suffruticosa) belongs to the Paeoniaceae family, Paeonia genus, Paeonia section (Sect. Moutan). It is a woody flower unique to my country. It has a strong fragrance and is known as "the most beautiful flower in the world". It has important ornamental and ecological values. Its rich historical and cultural connotations make it an important and special position in my country's flower industry. With the development of detection technology, research on peony fragrance has been carried out in recent years, mainly focusing on the identification of fragrance components, release patterns and genetic variation. It was found that terpenes are its main fragrance components, but little is known about the molecular genetic regulation mechanism of peony terpenes biosynthesis. Summary of the invention

[0004] To this end, an object of the present invention is to provide a transcription factor for regulating the expression of peony terpene synthase gene.

[0005] The transcription factors regulating peony terpene synthase genes provided by the present invention are named PsMYB7 and PsMYB18 respectively;

[0006] The sequences of PsMYB7 and PsMYB18 genes are shown in Sequence 1 or Sequence 2 in the sequence listing.

[0007] The amino acid sequences encoded by the PsMYB7 and PsMYB18 genes are shown in Sequence 3 or Sequence 4 in the sequence listing, respectively.

[0008] The peony terpene synthase gene can be PsDXS, PsDXR, PsGPPS, PsTPS5, PsTPS9, among which the nucleotide sequence of PsTPS9 is shown in sequence 5 in the sequence table.

[0009] Overexpression or silencing of PsMYB7 and PsMYB18 can regulate the expression of PsDXS, PsGPPS, PsTPS5, PsTPS9, and PsDXR genes, thereby regulating the content of peony terpenoids. In an embodiment of the present invention, the transcription factor can bind to the cis-acting element of the PsTPS9 gene promoter to regulate the expression of the peony terpene synthase gene, and the nucleotide sequence of the PsTPS9 gene promoter is shown in Sequence 6 in the sequence table.

[0010] Another object of the present invention is to provide a recombinant expression vector, which contains the transcription factor.

[0011] Another object of the present invention is to provide a recombinant host bacterium, wherein the recombinant host bacterium contains the recombinant expression vector.

[0012] The transcription factor of the present invention can be used for cultivating peony germplasm.

[0013] In certain embodiments, the peony germplasm contains higher terpenoids than the wild type.

[0014] Another object of the present invention is to provide a method for cultivating peony germplasm, comprising overexpressing the transcription factor in peony through transgenic technology to obtain peony plants containing higher terpenoid substances than wild type.

[0015] In certain embodiments, the terpenes include linalool, geraniol, myrcene, ocimene, and trans-ocimene.

[0016] The transcription factor for regulating the peony terpene synthase gene of the present invention provides a reliable basis for cultivating excellent peony germplasm with pleasant floral fragrance, and is of great significance for promoting the high-quality development of the flower industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 Multiple sequence alignment of amino acids encoded by PsMYB7 gene ( Figure 1 A), phylogenetic tree based on amino acid sequences ( Figure 1 B), conserved domains of proteins ( Figure 1 Middle C);

[0018] Figure 2 Multiple sequence alignment of amino acids encoded by PsMYB18 gene ( Figure 2 A), phylogenetic tree based on amino acid sequences ( Figure 2 B), conserved domains of proteins ( Figure 2 Middle C);

[0019] Figure 3 For PsMYB18( Figure 3 Middle A) and PsMYB7( Figure 3 Middle B) Relative expression levels of genes in different flower development stages and different tissues;

[0020] Figure 4 for the subcellular localization of PsMYB7 and PsMYB18 proteins;

[0021] Figure 5 To detect the expression level of peony PsMYB7 gene after silencing, and its effect on main terpenes and related genes;

[0022] Figure 6 To detect the expression level of peony PsMYB18 gene after silencing and its effect on main terpenes and related genes;

[0023] Figure 7 To detect the expression levels of PsMYB7 and PsMYB18 genes after transient overexpression of snapdragon and their effects on the main terpenes;

[0024] Figure 8 To verify the regulatory mechanism of PsMYB7 and PsMYB18 on the monoterpene synthase gene PsTPS9 (yeast one-hybrid and dual luciferase assays). DETAILED DESCRIPTION

[0025] In order to better illustrate the purpose, complete technical route and advantages of the present invention, the present invention will be further described in detail below in conjunction with specific embodiments and drawings. However, the embodiments described below are only part of the embodiments of the present invention and do not include all the embodiments. Based on the embodiments of the present invention, other embodiments that can be obtained by those skilled in the art without paying creative work all belong to the protection scope of the present invention.

[0026] In the embodiments described below, unless otherwise specified, the conventional methods used are technical means generally recognized or commonly used by those skilled in the art, and the instruments, reagents, consumables, etc. used in the embodiments of the present invention can be obtained through regular commercial channels.

[0027] Materials and Methods

[0028] Test materials

[0029] Peony 'Huangguan' was used as the research material for this experiment. It was taken from the peony planting experimental field of Beijing Agricultural College. Samples were collected around 12:00 at noon on a clear day. The classification standard of peony flowering period was modified with reference to the previous standards, and it was divided into four periods: dew color period, initial opening period, full bloom period, and decay period. The seven different organs and tissues were roots, stems, leaves, petals, carpels, calyx, and stamens. After the samples were collected, they were immediately wrapped in tin foil and placed in liquid nitrogen and stored in a -80℃ refrigerator for a long time. Snapdragon and Nicotiana benthamiana were cultured in the culture room of the Garden Building of Beijing Agricultural College. The culture light was 16h / dark 8h and the culture temperature was 24℃.

[0030] Commonly used instruments and equipment

[0031] 25mL glass vial with PTFE / blue silicone septa;

[0032] The extraction needle is 50 / 30μm DVB / CARBOXEN-PDMS (57328-U, );

[0033] SPME handle, manual injector (57330-U, );

[0034] Internal standard pure trioctanol (3-octanol) (Shanghai Aladdin Biochemical Technology Co., Ltd.);

[0035] Gas chromatograph-mass spectrometer (7890A / 5975C, Agilent);

[0036] The chromatographic column was a DB-5MS column (30 m × 0.25 mm × 0.25 μm);

[0037] Constant temperature water bath (DG-101S);

[0038] pipette, high-speed refrigerated centrifuge and thermostatic shaker (Eppendorf, Germany);

[0039] Real-time fluorescence quantitative PCR detection system, gel imaging system and PCR instrument (BIO-RAD, USA);

[0040] Vertical ultra-low temperature freezer (Thermo, USA);

[0041] UV detector (Phamacia, USA);

[0042] High pressure steam autoclave (Panasonic, Japan);

[0043] DYCP-31DN agarose horizontal electrophoresis apparatus and DYY-6C electrophoresis tank (Beijing Liuyi Instrument Factory);

[0044] Confocal microscope LCS-TC5 Leica (Leica, Germany).

[0045] Fully automatic chemiluminescence / fluorescence image analysis system (Tianneng, China)

[0046] Reagent test kit

[0047] Polysaccharide and polyphenol complex plant RNA rapid extraction kit (Beijing Adlai Biotechnology Co., Ltd.);

[0048] Polysaccharide and polyphenol complex plant DNA rapid extraction kit (Beijing Adelaide Biotechnology Co., Ltd.);

[0049] Cloning vector pTOPO001 Blunt Simple Cloning Kit (Beijing Jinsha Biotechnology Co., Ltd.);

[0050] E. coli competent cells Trelief TM 5αChemically Competent Cell (Beijing Jinsha Biotechnology Co., Ltd.);

[0051] Homologous recombination enzyme 2×Seamless Cloning Mix (Beijing Jinsha Biotechnology Co., Ltd.);

[0052] Agrobacterium competent cells GV3101 (Shanghai Weidi Biotechnology Co., Ltd.);

[0053] SfiⅠ enzyme (Baoriyi Biotechnology (Beijing) Co., Ltd.);

[0054] ApexHF CL DNA Polymerase FSMaster Mix (Hunan Aikerui Bioengineering Co., Ltd.);

[0055] Reverse transcription kit Evo M-MLV RT Premix (Hunan Aikerui Bioengineering Co., Ltd.);

[0056] Gene cloning PCR enzyme ApexHF HSDNA Polymerase FSMaster Mix (Hunan Aikerui Bioengineering Co., Ltd.);

[0057] Green Premix Pro Taq HS enzyme (Hunan Aikerui Bioengineering Co., Ltd.);

[0058] Primer synthesis and sequencing (Beijing Ruiboxingke Biotechnology Co., Ltd.);

[0059] DNA Gel Rapid Purification Kit Quick Gel Extraction (Beijing Qingke Biotechnology Co., Ltd.);

[0060] SD / -Ura (Beijing Bio-Ray Biotechnology Co., Ltd.);

[0061] D-luciferin potassium salt (Beijing Bio-Ray Biotechnology Co., Ltd.);

[0062] Bstb I, CutSmart buffer (New England Biotechnology (Beijing) Co., Ltd.);

[0063] Y1H gold, Carrier DNA, PEG / LiAC (Shanghai Weidi Biotechnology Co., Ltd.);

[0064] Minimal SD base, SD / -Leu / -Ura (Beijing Biode Biotechnology Co., Ltd.);

[0065] Aureobasidin A (Baori Medical Biotechnology (Beijing) Co., Ltd.).

[0066] Analysis software

[0067]

[0068] Example 1: Cloning, expression and subcellular localization of transcription factors PsMYB7 and PsMYB18

[0069] 1. Cloning and expression of transcription factors

[0070] 1. Primer design

[0071] According to the PsMYB7 and PsMYB18 transcription factors screened from the transcriptome data, the gene information and ORF sequence were obtained. Cloning primers were designed using Snapgene; the design methods of fluorescence quantitative primers and internal reference primers were the same as above; subcellular localization primers were designed according to the restriction site SfiΙ, and the primer sequences are shown in Table 1 (YPsMYB7-F / R, YPsMYB18-F / R).

[0072] Table 1. Primer sequences

[0073]

[0074]

[0075]

[0076] 2. RNA extraction and reverse transcription

[0077] The samples were ground into powder using liquid nitrogen grinding method, and RNA was extracted using Adelaide Polysaccharide Polyphenol RNA Extraction Kit. The integrity was detected by 1.2% agarose gel electrophoresis, and the concentration was determined using a protein meter. Based on the measured concentration, the cDNA of the petals of peony 'Huangguan' in full bloom was obtained using the Acori reverse transcription kit and stored in a -20℃ refrigerator.

[0078] 3. Fluorescence quantitative PCR

[0079] Corresponding fluorescent primers were designed according to the obtained two gene sequences, as shown in Table 1, with PsActin as the internal reference gene (primer sequences: PsActin-F: GCGTTGACGACTTTCTCATCCT; PsActin-R: CGCACATCCTTGACAAACCCTA). The total qRT-PCR reaction system was as follows: SYBR Premix Ex Taq II 10 μL, forward primer 0.5 μL, reverse primer 0.5 μL, template 1 μL, add ddH2O to 20 μL.

[0080] The reaction procedure was carried out according to the instructions of the fluorescent dye, and each sample was repeated 3 times.

[0081] 4. Target gene cloning

[0082] According to the gene cloning primers in Table 1, PCR amplification was performed using the cDNA of petals of peony 'Huangguan' at full flowering as a template to clone the PsMYB7 and PsMYB18 genes. The specific operations are as follows:

[0083] PCR reaction system: template 1 μL, forward primer 1 μL, reverse primer 1 μL, ApexHF HS PCR Master Mix 12.5 μL, add ddH2O to 25 μL.

[0084] PCR reaction program: 98°C, 5 min (pre-denaturation); 98°C, 10 s (denaturation); 56°C (annealing) 20 s; 72°C (extension) 1 min; steps 2-4 for 35 cycles; 72°C, 5 min; stored at 4°C.

[0085] Take 5 μL of PCR product and perform electrophoresis detection directly. Then, recover and purify the PCR product according to the instructions of the gel recovery kit, and connect the recovered product to the pTOPO001 vector. The connection system is as follows: PCR product, 0.5-4 μL; pTOPO 001, 1 μL; add ddH2O to 5 μL.

[0086] The ligation product was added according to the instructions of the E. coli competent cells DH5α, and after overnight culture in a 37°C incubator, positive colonies were selected and identified and sent to a biological company for sequencing.

[0087] 5. Results

[0088] Using the cDNA of the petals of peony 'Huangguan' in full bloom as a template, the open reading frames of PsMYB7 and PsMYB18 genes were obtained by PCR amplification, and the sequences of PsMYB7 and PsMYB18 genes were obtained. The sequence of PsMYB7 gene is the amino acid sequence shown in sequence 1 (990bp) in the sequence list, encoding sequence 3 (329 amino acids) in the sequence list, and the sequence of PsMYB18 gene is the amino acid sequence shown in sequence 2 (885bp) in the sequence list, encoding sequence 4 (294 amino acids) in the sequence list.

[0089] DNAMAN software was used to perform multiple sequence alignment of PsMYB7 and PsMYB18. The results showed that the homology between peony PsMYB7 protein and grape (Vitis vinifera) MYB44 protein reached 65.76%, macadamia (Macadamiaintegrifolia) MYB44 protein reached 64.09%, Telopea speciosissima MYB44 protein reached 63.61%, and pistachio (Pistacia vera) MYB44 protein reached 63.47%. The consistency with other species was above 60% ( Figure 1 A in the middle). The phylogenetic tree was constructed and found to be in the same branch as macadamia and tylos nucifera ( Figure 1 (middle B).

[0090] The homology of PsMYB18 protein to cocoa (Theobroma cacao) protein is 67.02%, that to Morelarubra (Morelarubra) protein is 65.42%, that to cassava (Manihot esculenta) protein is 64.86%, that to Bauhinia variegata protein is 64.23%, and the consistency with other species is above 62% ( Figure 2 The results of the evolutionary tree show that it is closely related to grapes and cassava ( Figure 2 (middle B).

[0091] PsMYB7( Figure 1 C) and PsMYB18 ( Figure 2 The conserved domain analysis of the proteins in C) showed that they all contained the MYB characteristic conserved domain Myb DNA-binding, which can bind to the MYB cis-acting element on the promoter.

[0092] Based on qRT-PCR detection of the spatiotemporal expression levels of PsMYB7 and PsMYB18 genes in peony 'Huangguan', the results showed that ( Figure 3 ), in the four flower development stages of peony, the expression levels of the two genes showed a pattern of first rising and then falling from the coloring stage to the decay stage. PsMYB7 and PsMYB18 reached the highest level in the early opening stage and the lowest level in the decay stage. In different flower tissues during the blooming period, the expression levels of PsMYB7 and PsMYB18 genes were the highest in petals, and the expression levels of PsMYB7 gene in carpels, calyx, and stamens were not much different. The expression level in stems was higher, which was equivalent to that in petals ( Figure 3 The expression level of PsMYB18 gene in stems and petals is similar, and the expression level in roots is the lowest, and the expression levels in other tissues are similar ( Figure 3 (A).

[0093] 2. Subcellular Localization

[0094] 1. Construction of subcellular localization vector

[0095] According to the obtained gene sequence and the pNC-Cam1304-SubN plant expression vector (the vector is recorded in the literature Yan P., Tuo D., Shen W., Deng H., Zhou P., and Gao XA Nimble Cloning-compatible vector system for high-throughput gene functional analysis in plants. Plant Communications (2023) 4, 100471., and the public can obtain it from the Chinese Academy of Tropical Agricultural Sciences), the vector restriction site was determined to be SfiΙ, and SfiΙ restriction endonuclease was used for enzyme cutting. Use the primers designed in Table 1 (YPsMYB7-F / R, YPsMYB18-F / R), PCR amplification was performed with PsMYB7 and PsMYB18 gene plasmids as templates, the purified PCR products were recovered, and the PCR products were connected to the pNC-Cam1304-SubN vector after enzyme digestion using homologous recombinase. The ligated products were transformed into Escherichia coli competent cells DH5α, and the pNC-Cam1304-PsMYB7 and pNC-Cam1304-PsMYB18 recombinant expression vectors were obtained after successful sequencing.

[0096] 2. Observation of infection of tobacco leaves and positioning results

[0097] The pNC-Cam1304-PsMYB7, pNC-Cam1304-PsMYB18 recombinant expression vectors and the pNC-Cam1304-SubN empty vector were respectively transformed into Agrobacterium competent cells GV3101 (the transformation method is described in the instructions of the kit, Weidi Biotechnology, China), and colony PCR was performed after culturing in a 28°C incubator for 3 days. The bacterial solution with the correct band was cultured overnight with shaking. The cells were collected by centrifugation at room temperature and resuspended in the infection solution to adjust the OD 600 To 0.8-1.2, then incubate in dark for 2-3 hours. Use 1mL needleless syringe to infect the back of tobacco leaves, treat in darkness for 24 hours, and then observe under laser confocal microscope after 2 days of normal light.

[0098] ProtComp 9.0 was used to predict the subcellular localization of transcription factors PsMYB7 and PsMYB18. Figure 4 As shown, the empty vector pNC-Cam1304-SubN was used as a negative control ( Figure 4 GFP), which can be expressed in the nucleus, cell membrane and intracellular organelles without distribution specificity; pNC-Cam1304-PsMYB7( Figure 4 35S: PsMYB7) and pNC-Cam1304-PsMYB18 ( Figure 4 It was observed that the green fluorescence signals were distributed in the cell nucleus in tobacco infected with 35S:PsMYB18, indicating that PsMYB7 and PsMYB18 were localized in the cell nucleus, which was consistent with the predicted results.

[0099] Example 2: Verification of virus-induced gene silencing function

[0100] 1. Construction of silencing vector

[0101] Snapgene software was used to select the fragment of non-conserved region length in target gene at 300bp, SfiΙ restriction site was added for primer design for gene silencing, and amplification primers were as shown in Table 1 (viyPsMYB7-F / R, viyPsMYB18-F / R). PCR amplification was performed using PsMYB7 and PsMYB18 gene plasmids as templates, and PCR products were recovered and then connected to the pNC-TRV2 vector after restriction digestion using homologous recombinase (the vector is recorded in document Yan P., Tuo D., Shen W., Deng H., Zhou P., and Gao XA Nimble Cloning-compatible vector system for high-throughput gene functional analysis in plants. Plant Communications (2023) 4, 100471., and the public can obtain it from the Chinese Academy of Tropical Agricultural Sciences). After successful sequencing, silencing vectors pNC-TRV2-PsMYB7 and pNC-TRV2-PsMYB18 were obtained, with empty vector pNC-TRV2 as negative control group.

[0102] 2. Infecting peony petals

[0103] pNC-TRV1 (the vector is recorded in the literature Yan P., Tuo D., Shen W., Deng H., Zhou P., and Gao XA Nimble Cloning-compatible vector system for high-throughput gene functional analysis in plants. Plant Communications (2023) 4, 100471., and the public can obtain it from the Chinese Academy of Tropical Agricultural Sciences), recombinant vector pNC-TRV2-PsMYB7, recombinant vector pNC-TRV2-PsMYB18 and negative control pNC-TRV2 were respectively transferred into Agrobacterium GV3101, and colony PCR was performed after culturing in a 28°C incubator for 3 days. The bacterial solution with the correct band was shaken and cultured overnight. The cells were collected by centrifugation at room temperature and resuspended in the infection solution to OD 600 The pNC-TRV2-PsMYB7, pNC-TRV2-PsMYB18 and pNC-TRV2 were mixed with the pNC-TRV1 bacterial solution at a volume ratio of 1:1, and incubated in the dark for 2-3 hours to obtain infection solutions 1, 2, and 3 containing pNC-TRV2-PsMYB7, pNC-TRV2-PsMYB18, and pNC-TRV2.

[0104] Select the 5-7cm flower stems of the newly opened flowers of the 'Huangguan' variety with good growth status, and place them in the mixed bacterial solution. Use the vacuum method to infect the peony. Three peony flowers are used as biological replicates for each treatment. After culturing in the dark for 1 day, normal light is applied for about 3 days. When the flowers are in full bloom, the floral fragrance components and gene expression levels are determined.

[0105] 3. Determination of changes in gene expression

[0106] Total RNA was extracted from the infected petals of Peony 'Huangguan' and reverse transcribed, and the expression level of genes was detected by qRT-PCR. Figure 5 and Figure 6 As shown in A, the relative gene expression levels of petals in the blooming stage after treatment were compared with those of the negative control group ( Figure 5 and Figure 6 TRV2) were significantly lower than those in PsMYB7 ( Figure 5 TRV2-PsMYB7) and PsMYB18 ( Figure 6 The expression levels of TRV2-PsMYB18) transcription factor genes in A decreased by 93% and 65%, respectively, indicating that both PsMYB7 and PsMYB18 genes were successfully silenced and subsequent experiments could be carried out.

[0107] After silencing PsMYB7 and PsMYB18 genes, the expression levels of PsTPS9 gene and key structural genes in the terpene biosynthesis pathway were detected. The results showed that after silencing PsMYB7, the expression levels of PsDXS, PsGPPS, PsTPS5, and PsTPS9 genes decreased by 52%, 87%, 55%, and 80%, respectively, and the expression level of PsDXR gene increased by 262% ( Figure 5 After silencing PsMYB18, the expression levels of PsDXS, PsTPS5, and PsTPS9 genes decreased by 23%, 48%, and 71%, respectively, while the expression levels of PsDXR and PsGPPS genes increased by 316% and 90% ( Figure 6 (middle B).

[0108] 4. Determination of changes in floral aroma components

[0109] The headspace solid phase microextraction (SPME) method was used to collect the floral aroma substances released by peony, and the floral aroma compounds were qualitatively and quantitatively analyzed using a gas chromatography-mass spectrometry (GC-MS) instrument. The specific operation is as follows: 2g of freshly picked petals were weighed and placed in a 25ml extraction bottle. After adding 10μL of internal reference solution (the internal reference solution was a mixture of 1μL trioctanol and 10mL of anhydrous ethanol), it was balanced at 40℃ for 10min, and the extraction needle was extracted for 50min. After the extraction was completed, the extraction needle was removed and inserted into the injection port of the gas chromatography-mass spectrometry instrument, and the extraction needle was placed in the GC injection port for 3min of dissociation for qualitative detection of floral aroma substances. Using trioctanol as the internal standard, the release amount of each floral aroma compound was quantitatively analyzed, and statistics were performed using Microsoft Excel 2021 and GraphPadPrism 9.0.

[0110] The analysis results are as follows Figure 5 and 6 As shown in Figure 2, after silencing the PsMYB7 and PsMYB18 genes, the release of the main terpene substances in peony was basically reduced compared with the negative control (TRV2). Figure 5 Figure C shows that after silencing PsMYB7, linalool, geraniol, and ocimene decreased by 62%, 100%, and 42%, respectively, while myrcene increased by 280%. Figure 6 Center C shows that after silencing PsMYB18, linalool, geraniol, myrcene, and ocimene decreased by 69%, 89%, 85%, and 72%, respectively.

[0111] Example 3: Verification of gene overexpression function

[0112] 1. Overexpression vector construction

[0113] According to the sequence of the terminator removed from the target gene, SfiΙ restriction site was added for primer design for gene overexpression, and the amplification primers are shown in Table 1 (35s-yPsMYB7-F / R, 35s-yPsMYB18-F / R). PCR amplification was performed using PsMYB7 and PsMYB18 gene plasmids as templates, and the PCR products were recovered and then connected to the pNC-Cam3304-35S vector after restriction digestion using homologous recombinase (the vector is recorded in the document Yan P., Tuo D., Shen W., Deng H., Zhou P., and Gao XA Nimble Cloning-compatible vector system for high-throughput gene functional analysis in plants. Plant Communications (2023) 4, 100471., and the public can obtain it from the Chinese Academy of Tropical Agricultural Sciences). After successful sequencing, the overexpression vectors pNC-Cam3304-35S-PsMYB7 and pNC-Cam3304-35S-PsMYB18 were obtained, and the empty vector pNC-Cam3304-35S was used as a negative control group.

[0114] 2. Infect snapdragon petals

[0115] The recombinant vectors pNC-Cam3304-35S-PsMYB7 and pNC-Cam3304-35S-PsMYB18, as well as the negative control pNC-Cam3304-35S, were respectively transformed into Agrobacterium GV3101. The method was the same as gene silencing, and colony PCR, shaking culture, centrifugation, and bacterial collection were performed, and the bacteria were resuspended in the infection solution to OD 600 is 0.8-1.2, incubate in the dark for 2-3 hours, and obtain infection solutions 4, 5, and 6 containing pNC-Cam3304-35S-PsMYB7, pNC-Cam3304-35S-PsMYB18, and pNC-Cam3304-35S.

[0116] A 1mL needleless syringe was used to infect the petals of snapdragons in the early stage of growth with good growth conditions, and each treatment was repeated three times. After 12 hours of dark culture, 16 hours of light / 8 hours of dark culture were carried out for 5-6 days. When the flowers were in full bloom, the floral fragrance components were determined, and the infected petals were stored in a -80℃ refrigerator for gene expression determination, using the same method as gene silencing.

[0117] 3. Determination of gene expression and changes in floral fragrance components

[0118] Total RNA was extracted from snapdragon petals for reverse transcription, and qRT-PCR was used to detect the expression levels of PsMYB7 and PsMYB18 genes after heterologous overexpression in snapdragon. Figure 7 As shown in Figure 2, the gene expression levels in the petals infected with pNC-Cam3304-35S-PsMYB7 and pNC-Cam3304-35S-PsMYB18 were significantly increased compared with the negative control group pNC-Cam3304-35S, and the expression level of PsMYB7 gene increased by 9 times ( Figure 7 Middle A), the expression level of PsMYB18 gene increased by 29.2 times ( Figure 7 Middle B), indicating successful gene overexpression.

[0119] SPME-GC-MS results showed that after overexpression of PsMYB7 and PsMYB18 genes, the release of the main terpenes in the flower fragrance of snapdragon basically increased compared with the negative control. Among them, after overexpression of PsMYB7 gene, ocimene, myrcene, linalool and trans-ocimene increased by 239%, 308%, 320% and 611% respectively ( Figure 7 After overexpression of PsMYB18 gene, ocimene, myrcene, linalool and trans-ocimene increased by 456%, 151%, 98% and 201% respectively ( Figure 7 (middle D).

[0120] Example 3: PsTPS9 gene promoter cloning, yeast one-hybrid and dual-luciferase assays

[0121] 1. Cloning and sequence analysis of the PsTPS9 gene promoter

[0122] 1. DNA extraction and cloning of PsTPS9 promoter

[0123] The sample was ground into powder by liquid nitrogen grinding method, and DNA from petals of peony 'Huangguan' in full bloom was extracted with reference to DNA extraction kit, and DNA concentration and integrity were tested for promoter cloning. According to the known PsTPS9 gene sequence information (sequence 5 in the sequence list), the required promoter sequence was found from the peony genome draft using TBtools software, and the promoter cloning primers PsTPS9pro-F and PsTPS9pro-R were designed as shown in Table 1. The extracted DNA was used as a template, and PCR amplification was performed by primers and ApexHF CLDNA Polymerase FSMaster Mix according to the enzyme instructions. The sequencing results were compared with the corresponding gene sequences in the genome, the target fragment sequence was confirmed, and finally the promoter sequence of the PsTPS9 gene (sequence 6 in the sequence list) 2003bp was obtained.

[0124] 2. PsTPS9 promoter sequence analysis

[0125] The promoter sequence of PsTPS9 gene was analyzed using PlantCARE online website, and its cis-acting elements are listed in Table 2. Twenty-nine sites were analyzed in the promoter of PsTPS9, including TATA-box, AT-TATA-box, G-box and CAAT-box, which are common cis-acting elements in promoter and enhancer regions. Unnamed elements are not reflected and counted in Table 2. At the same time, the promoter region of PsTPS9 contains 5 MYB binding sites, 2 MYC binding sites and 1 WRKY binding site W-box.

[0126] Table 2. Statistics of cis-acting elements in the PsTPS9 promoter

[0127]

[0128]

[0129]

[0130] 2. Yeast One-Hybrid Assay

[0131] 1. Vector construction and culture medium preparation

[0132] Referring to the above-mentioned vector construction method, and using the amplification primers in Table 1 (AD-PsMYB7-F / R, AD-PsMYB18-F / R), PsMYB7 and PsMYB18 were constructed into the pNC-GADT7 vector (available from Hainan Nixing Biotechnology Co., Ltd.) to obtain the pNC-GADT7-PsMYB7 and pNC-GADT7-PsMYB18 recombinant vectors. In the same way, using the amplification primers AB-PsTPS9pro-F and AB-PsTPS9pro-R in Table 1, the PsTPS9 gene promoter sequence was constructed into the pNC-AbAi (available from Hainan Nixing Biotechnology Co., Ltd.) vector to obtain the Pabai-PsTPS9 recombinant vector. Prepare the following culture media separately for use:

[0133] SD / -Ura medium: weigh 26.7g of Minimal SD base and 1.29g of Do supplement / -Ura and dissolve them in 1L of deionized water (if preparing solid medium, weigh 15g of agar and dissolve them in 1L of deionized water), adjust the pH to 5.8, and sterilize at 121℃ for 15min. Store at 4℃ away from light.

[0134] SD / -Leu / -Ura solid medium: weigh 26.7g of Minimal SD base, 1.19g of Do supplement / -Leu / -Ura, and 15g of agar in 1L of deionized water, adjust the pH to 5.8, and sterilize at 121℃ for 15min. Store at 4℃ away from light.

[0135] SD / -Leu / -Ura screening medium: After the SD / -Leu / -Ura medium is sterilized and cooled to 40°C, different concentration gradients (200, 300, 400 ng / mL) of aureobasidin A (AbA) are added, mixed and poured onto plates.

[0136] 2. Preparation of competent cells

[0137] The Pabai-PsTPS9 plasmid was linearized with BstbⅠ enzyme (50℃, 25min). The linearized plasmid was recovered and transferred into Y1HGold competent cells (refer to the instruction manual for detailed methods), coated on SD / -Ura plates, inverted and cultured at 28℃ for 48-96h to obtain a single yeast colony containing Pabai-PsTPS9.

[0138] After the spots appear, the bacteria are picked for bacterial identification. After successful identification, the corresponding colonies are picked and placed in 5 mL of SD / -Ura liquid culture medium, and cultured overnight at 28°C and 200 rpm until OD 600 After the pH is about 0.5, start preparing competent cells. First, centrifuge the bacterial solution at 5000r / min for 1min, remove the supernatant, resuspend with 2mL ddH2O, repeat the centrifugation once, remove the supernatant; resuspend with 1mL ddH2O, centrifuge at 5000r / min for 30s, remove the supernatant, repeat this process 3 times; add 500μL 1×TE buffer to resuspend, centrifuge at 5000r / min for 30s and remove the supernatant; add 1×TE / LiAc to resuspend, obtain Pabai-PsTPS9 yeast competent cells, divide into 1.5mL centrifuge tubes for use, and store in a -20℃ refrigerator.

[0139] 3. Screening and verification of AbA concentration

[0140] The pNC-GADT7 plasmid was transferred into the prepared Pabai-PsTPS9 yeast competent medium, spread on the defective SD / -Leu / -Ura solid medium, and inverted at 28°C for 48-96h. Pick a single colony and dilute it into water, and then apply it to the SD / -Leu / -Ura screening medium (containing 200, 300, and 400ng / mL AbA), repeat three times, and inverted at 28°C for 48-96h. The self-activation concentration of the PsTPS9 gene promoter was screened out by the yeast one-hybrid test, and it was found that the growth of yeast could be inhibited at a concentration of 400ng / mL, and the self-activation concentration of the PsTPS9 gene promoter was determined to be 400ng / mL AbA.

[0141] pNC-GADT7-PsMYB7, pNC-GADT7-PsMYB18, and negative control pNC-GADT7 were respectively transferred into the prepared Pabai-PsTPS9 yeast competent cells, spread on SD / -Leu / -Ura screening medium (containing 400ng / mL AbA), and cultured at 28℃ for observation. Figure 8 As shown in A, it was found that the yeast colonies transformed with pNC-GADT7-PsMYB7 and pNC-GADT7-PsMYB18 could grow normally, while the colonies transformed with the negative control pNC-GADT7 could not grow, indicating that both PsMYB7 and PsMYB18 can bind to the cis-acting elements on the PsTPS9 promoter to play a regulatory role.

[0142] 3. Dual luciferase assay

[0143] 1. Vector construction

[0144] Referring to the above-mentioned vector construction method, and using the amplification primers LUC-PsTPS9pro-F and LUC-PsTPS9pro-R in Table 1, the PsTPS9 gene promoter sequence was constructed into the pNC-Green-LUC (the vector is recorded in the literature Yan P., Tuo D., Shen W., Deng H., Zhou P., and Gao XA Nimble Cloning-compatible vector system for high-throughput gene functional analysis in plants. Plant Communications (2023) 4, 100471., and the public can obtain it from the Chinese Academy of Tropical Agricultural Sciences) vector to obtain the LUC-PsTPS9pro recombinant vector.

[0145] The pNC-Cam3304-35S-PsMYB7 constructed in Example 3 and

[0146] The pNC-Cam3304-35S-PsMYB18 plasmid and the empty vector pNC-Cam3304-35S (the vector is described in the literature Yan P., Tuo D., Shen W., Deng H., Zhou P., and Gao XA Nimble Cloning-compatible vector system for high-throughput gene functional analysis in plants. Plant Communications (2023) 4, 100471., and is available to the public from the Chinese Academy of Tropical Agricultural Sciences) were respectively transferred into GV3101 Agrobacterium competent cells with the P19 tag to obtain the corresponding Agrobacterium bacterial solution, and the infection solution was used to resuspend the cells to an OD of 1. 600 The LUC-PsTPS9pro infection solution was mixed with pNC-Cam3304-35S-PsMYB7, pNC-Cam3304-35S-PsMYB18, and pNC-Cam3304-35S infection solutions at a volume ratio of 1:1 to obtain mixed infection solutions 7, 8, and 9. The tobacco leaves infected with LUC-PsTPS9pro+pNC-Cam3304-35S were used as the negative control group.

[0147] Tobacco leaves were infected with mixed infection solutions 7, 8, and 9 respectively, and treated in darkness for 1 day. After exposure to normal light for 2 days, 1 mmol / L firefly potassium salt solution was applied to the back of the tobacco leaves. After being placed in darkness for 1 minute, the leaves were observed in a fully automatic chemiluminescence / fluorescence image analysis system. Figure 8 As shown in B, compared with tobacco leaves injected with the negative control, the fluorescence brightness signals in tobacco leaves co-injected with pNC-Cam3304-35S-PsMYB7 and LUC-PsTPS9pro and tobacco leaves co-injected with pNC-Cam3304-35S-PsMYB18 and LUC-PsTPS9pro were significantly higher than those in the control group, indicating that PsMYB7 and PsMYB18 can activate the PsTPS9 promoter.

[0148] The preferred embodiments of the present invention have been specifically described above, but the present invention is not limited to the embodiments. Those skilled in the art may make various equivalent modifications or substitutions without violating the spirit of the present invention. These equivalent modifications or substitutions are all included in the scope defined by the claims of this application.

Claims

1. A transcription factor for regulating peony terpene synthase gene, characterized in that: The amino acid sequence of the transcription factor is shown in Sequence 3 or Sequence 4 in the sequence list.

2. The transcription factor according to claim 1, characterized in that The nucleotide sequence of the transcription factor is shown in Sequence 1 or Sequence 2 in the sequence listing.

3. A recombinant expression vector, characterized in that: The recombinant expression vector contains the transcription factor according to any one of claims 1 or 2.

4. A recombinant host bacterium, characterized in that: The recombinant host bacteria contains the recombinant expression vector according to claim 3.

5. Use of the transcription factor according to claim 1 or 2 in activating the peony PsTPS9 gene promoter, the nucleotide sequence of the peony PsTPS9 gene promoter is shown in sequence 6 in the sequence listing.

6. Use of the transcription factor according to claim 1 or 2 in cultivating peony germplasm with increased terpenoid content.

7. The use according to claim 6, characterized in that: The terpenoid substances include linalool, geraniol, myrcene, ocimene and / or trans-ocimene.

8. A method for cultivating peony germplasm, comprising overexpressing the transcription factor according to any one of claims 1 to 5 in peony by transgenic technology to obtain peony plants with increased terpenoid content compared with wild type.

9. The method according to claim 8, characterized in that The terpenoid substances include linalool, geraniol, myrcene, ocimene and / or trans-ocimene.

10. Use of the transcription factor according to claim 1 or 2 in regulating the expression of peony terpene synthase gene.

Images