Porcine circovirus type 3 antibody detection kit as well as preparation method and application thereof

Abstract

On one hand, the invention discloses the monoclonal antibody for resisting the porcine circovirus type 3 Cap protein, the monoclonal antibody for resisting the porcine circovirus type 3 Cap protein is a monoclonal antibody P3, and amino acid sequences of a heavy chain variable region and a light chain variable region of the monoclonal antibody P3 are respectively shown as SEQ ID NO.3 and SEQ ID NO.4. The invention also discloses a preparation method of the monoclonal antibody for resisting the porcine circovirus type 3 Cap protein. The invention also discloses a porcine circovirus type 3 antibody detection kit. The kit comprises the monoclonal antibody P3, the porcine circovirus type 3 Cap protein and a matched detection reagent. The monoclonal antibody P3 has the advantages of good specificity and good affinity, and can be used for detection of the porcine circovirus type 3 antibody and development of related detection products. Meanwhile, the kit provided by the invention has good specificity and sensitivity, and is suitable for large-scale detection of the porcine circovirus type 3 antibody.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a porcine circovirus type 3 antibody detection kit and a preparation method and application thereof. Background Art

[0002] Porcine circovirus type 3 (PCV3) is a single-stranded DNA virus belonging to the Circoviridae family. Since it was first reported in 2016, it has attracted widespread attention in the pig industry around the world. The PCV3 genome is relatively simple, containing two open reading frames (ORFs), encoding replication protein (Rep) and capsid protein (Cap). Among them, Rep protein is responsible for viral replication and transcriptional regulation, and is a key enzyme in the process of viral infection and replication; while Cap protein is the main structural protein of PCV3, located on the surface of the viral capsid, directly mediating binding to host cells, and is the main immunogenic protein of PCV3, often used as the main target for the development of vaccines and diagnostic reagents.

[0003] At present, the technology of PCV3 isolation and cultivation is not mature, and there is no safe and effective PCV3 vaccine product. The prevention and control of PCV3 still needs to rely on biosafety prevention and control measures. In biosafety prevention and control, pig farms should do a good job of monitoring PCV3, avoid introducing new breeds, eliminate infected pigs in time, and eliminate the source of infection; do a good job of physical isolation to prevent carriers from bringing them into the pig farm; implement disinfection work well to cut off the transmission route, etc.

[0004] At present, the diagnostic technology for emerging animal diseases such as PCV3 is insufficient, mainly based on conventional PCR and qPCR molecular biological detection technology. These detection methods are time-consuming, costly, and require high equipment, which is not convenient for rapid diagnosis and application in pig farms. There are few studies on PCV3 serological detection technology, and only a few reports on indirect ELISA using recombinant PCV3 Cap protein. There are currently no detection methods or products for PCV3 antigens on the market.

[0005] Given that there is currently no commercial PCV3 vaccine available, it is urgent to establish corresponding pathogen monitoring and assessment methods, comprehensively carry out systematic monitoring and risk assessment of PCV3, timely grasp the epidemic situation and scientifically analyze trends, and effectively prevent and control the outbreak of such epidemics. Summary of the invention

[0006] In order to make up for the deficiencies of the prior art, the object of the present invention is to provide a porcine circovirus type 3 antibody detection kit and a preparation method and application thereof.

[0007] Therefore, on one hand, the present invention discloses an anti-porcine circovirus type 3 Cap protein monoclonal antibody, wherein the anti-porcine circovirus type 3 Cap protein monoclonal antibody is monoclonal antibody P3, wherein the amino acid sequences of the heavy chain variable region and the light chain variable region of monoclonal antibody P3 are shown as SEQ ID NO.3 and SEQ ID NO.4, respectively.

[0008] In another aspect, the present invention further discloses a product for detecting porcine circovirus type 3 antibodies, wherein the product comprises the monoclonal antibody P3.

[0009] Preferably, the product of the present invention further comprises porcine circovirus type 3 Cap protein and a matching detection reagent.

[0010] Preferably, the amino acid sequence of the porcine circovirus type 3 Cap protein of the present invention is shown as SEQ ID NO.1, and the codon-optimized nucleotide sequence thereof is shown as SEQ ID NO.2.

[0011] In another aspect, the present invention further discloses a porcine circovirus type 3 antibody detection kit, the kit comprising the monoclonal antibody P3 and porcine circovirus type 3 Cap protein and a matching detection reagent.

[0012] Preferably, the coating concentration of the porcine circovirus type 3 Cap protein of the present invention is 1 μg / mL.

[0013] Preferably, the detection reagents of the kit of the present invention include a sample diluent, a 25× concentrated washing solution, a substrate solution, a stop solution, a positive control and a negative control.

[0014] In another aspect, the present invention also discloses the use of the monoclonal antibody P3 in the preparation of porcine circovirus type 3 antibody detection reagent.

[0015] The monoclonal antibody P3 prepared by the present invention has good specificity and sensitivity, and is suitable for preparing different porcine circovirus type 3 diagnostic reagents, such as colloidal gold, ELISA and other detection kits. At the same time, the porcine circovirus type 3 Cap protein prepared by the present invention has good specificity and expression amount, and is suitable for the preparation of porcine circovirus type 3 diagnostic reagents or the development of subunit vaccines.

[0016] The porcine circovirus type 3 antibody detection kit prepared by the present invention is suitable for the detection of porcine circovirus type 3 antibodies in pig serum, has strong specificity, high sensitivity, good stability and fast detection speed, and can be used for early screening of porcine circovirus type 3 antibodies, immune evaluation (applicable when vaccines are available) and epidemiological surveys, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1SDS-PAGE detection results of recombinant PCV3 Cap protein.

[0018] Figure 2 Western blot detection results of recombinant PCV3 Cap protein.

[0019] Figure 3 SDS-PAGE detection results of monoclonal antibody P3.

[0020] Figure 4 Western blot detection results of monoclonal antibody P3 on PCV3 Cap protein and PCV2 Cap protein. DETAILED DESCRIPTION

[0021] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art of the present invention. The terms used herein in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The term "and / or" used herein includes any and all combinations of one or more related listed items.

[0022] Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art. Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0023] Example 1: Preparation and testing of recombinant PCV3 Cap protein

[0024] 1. Preparation of Porcine Circovirus Type 3 Cap Protein

[0025] Primers were designed to amplify the target fragment Cap from the existing recombinant vector containing Cap (wherein the amino acid sequence of PCV3 Cap protein is shown as SEQ ID NO.1, and the nucleotide sequence after codon optimization is shown as SEQ ID NO.2), the target fragment was recovered, and then the recovered target fragment was amplified using primers with restriction sites, and the amplified product was gel-recovered again and stored for later use.

[0026] Upstream primer: GCTCTAGAATGCGAGCAATCTTTC

[0027] Downstream primer: CCGGAATTCTTAATGGTGATGGTGATGATGGAG

[0028] The Cap gene was inserted into the corresponding restriction site of the pFastBac vector using BamHI and EcoRI double restriction digestion to construct the recombinant vector pFastBac-PCV3-Cap. The E. coli DH5α strain was transformed, and a single clone was selected for PCR verification and sequencing to confirm the insertion of the Cap gene.

[0029] pFastBac-PCV3-Cap was transformed into DH10Bac competent cells and transposed to insert the Cap gene into the baculovirus vector Bacmid. After transformation, a white single clone was picked, the Bacmid plasmid DNA was extracted, and the correct insertion of the Cap gene was confirmed by PCR. The Bacmid with successful insertion of the Cap gene was confirmed and used for subsequent insect cell transfection.

[0030] Inoculate Sf9 cells in a culture flask to a cell density of 80-90% confluence. Use a transfection reagent to transfect the extracted recombinant Bacmid DNA into Sf9 cells, adding 5-10μg Bacmid and 3-5μL transfection reagent to each 1mL culture medium. Observe the cytopathic effect (CPE) after 48-72 hours, such as cell shrinkage, granulation, etc., indicating that the virus has successfully proliferated. Collect the culture supernatant, centrifuge to remove cell debris, and the supernatant is the primary baculovirus (P1). Inoculate a small amount of P1 generation virus supernatant into fresh Sf9 cells, continue to culture for 72 hours, and collect P2 generation virus. Repeat this process 2-3 times, amplify to a high titer virus solution (P3), and use the virus titration method to determine the virus titer. The ideal titer is 10^7-10^9PFU / mL.

[0031] The high titer P3 virus supernatant was used to infect Sf9 cells at an MOI of 2. The cytopathic effect (CPE) was observed within 48-72 hours after infection. Significant lesions usually indicate high protein expression. The cells were collected and centrifuged at 1500 rpm for 5 minutes, and the supernatant was collected. The target PCV3-Cap protein was purified by cation exchange, sterilized with a 220 nm filter membrane, and temporarily stored at 4°C for later use.

[0032] 2. Detection of Porcine Circovirus Type 3 Cap Protein

[0033] SDS-PAGE electrophoresis and Western Blot identification: After the purified PCV3 Cap was prepared, it was electrophoresed on 12% SDS-PAGE gel, stained with Coomassie brilliant blue, and decolorized. The results are as follows Figure 1 Western Blot was performed using porcine circovirus type 3 positive serum, and the results are shown in Figure 2 shown.

[0034] The results showed that it was identified as recombinant PCV3 Cap protein by SDS-PAGE and Western blot, and its SDS-PAGE purity was greater than 95%, and the concentration was 0.68 mg / mL. The expression amount after purification was calculated to be 0.5 g / L or more. This shows that the PCV3 Cap protein prepared by the present invention has good specificity and good expression amount, and is suitable for a large number of applications.

[0035] Example 2: Preparation and testing of monoclonal antibodies against PCV3 Cap protein

[0036] 1. Preparation of monoclonal antibodies against PCV3 Cap protein

[0037] The recombinant PCV3 Cap protein prepared in Example 1 was immunized with BALB / c mice at a dose of 100 μg / mouse for the first immunization and 50 μg / mouse for the second to fourth immunizations. During the immunization process, Freund's adjuvant and antigen were emulsified and mixed at a mass ratio of 1:1. Freund's complete adjuvant was used for the first immunization; and Freund's incomplete adjuvant was used for the subsequent booster immunization stage. Immunization was performed by subcutaneous multi-point injection in mice, ensuring that the interval between each immunization was 2 weeks. Starting from the third immunization, blood samples were collected from the mouse eye sockets on the 7th day after each immunization for the preparation of serum for subsequent evaluation and analysis. On the 7th day after the fourth immunization, blood samples were collected from the mouse eye sockets again, and the blood samples were centrifuged and the supernatant was taken for subsequent analysis.

[0038] The serum of the above-mentioned immunized mice was tested by indirect ELISA, and the spleen of mice with higher titers was aseptically removed. After separation of B lymphocytes, they were fused with sp2 / 0 myeloma cells and screened by HAT medium to obtain hybridoma cell lines that can produce antibodies. According to the results of the ELISA test of the serum of the above-mentioned immunized mice, the spleen of the mouse with the highest titer was finally selected for cell fusion. After fusion, 85 positive hybridoma cell lines were obtained through preliminary screening. The culture supernatant of the positive hybridoma cells was further screened by indirect ELISA to obtain 10 positive hybridoma cell lines with higher titers for monoclonal amplification. Finally, a hybridoma cell with the highest titer was selected to prepare ascites by intraperitoneal injection into mice, and antibody affinity purification in ascites was performed.

[0039] The selected hybridoma cell lines were expanded and cultured at a rate of 1×10 7 Hybridoma cells / mouse were injected intraperitoneally to prepare ascites, and the collected ascites was centrifuged at 4000rpm for 10min, the precipitate was discarded, and the antibody was purified after filtering with a 0.45μm / 0.22μm filter membrane. The purified monoclonal antibody (denoted as monoclonal antibody P3) was sterilized by filtering with a 220nm filter membrane and stored at -80℃ for future use.

[0040] 2. Testing for monoclonal antibodies against PCV3 Cap protein

[0041] (1) Monoclonal antibody P3 was subjected to SDS-PAGE. The results are shown in Figure 3 , and its SDS-PAGE purity can reach more than 95%.

[0042] (2) Monoclonal antibody P3 was used to perform Western blot detection on PCV3 Cap protein prepared in Example 1 and PCV2 Cap protein (prepared by this research unit). The results showed that the monoclonal antibody did not specifically bind to PCV2 Cap protein, indicating that this monoclonal antibody has good specificity. Figure 4 shown.

[0043] (3) The monoclonal antibody P3 with different dilutions (the antibody concentration was adjusted to 1 mg / mL before dilution) was tested using the indirect ELISA method. 7 When the concentration of OD450nm was 0.6, the monoclonal antibody P3 had good activity.

[0044] (4) The monoclonal antibody was HRP-labeled using the classic sodium periodate method or a commercially available HRP labeling kit, and the labeling titer was determined using the direct ELISA method (coated with recombinant PCV3 Cap protein, with a coating amount of 1 μg / ml) (positive when OD value ≥ 1.0), and the result was 1:20000. This indicated that the HRP labeling was successful, the labeling efficiency was high, and it met the requirements for kit development.

[0045] (5) Lyse the hybridoma cells to extract total RNA, and use RACE technology to reverse transcribe the RNA into cDNA after passing the test; PCR amplify to obtain the heavy chain and light chain variable region sequences; use ligase to connect the target fragment to the vector, and transform the ligation product into Escherichia coli competent cells, and then pick a single clone for sequencing; finally, analyze and annotate the sequencing results to obtain the variable region sequence of the monoclonal antibody gene, as shown in Table 1. The amino acid sequences of the heavy chain variable region and light chain variable region of the monoclonal antibody P3 are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively.

[0046] Table 1 Monoclonal antibody P3 variable region amino acid sequence information

[0047]

[0048] Example 3: Preparation of porcine circovirus type 3 antibody detection kit

[0049] A porcine circovirus type 3 Cap protein antibody detection kit was established using the porcine circovirus type 3 Cap protein prepared in Example 1 and the anti-PCV3 Cap protein monoclonal antibody (monoclonal antibody P3) prepared in Example 2 for the detection of porcine circovirus type 3 serum antibodies.

[0050] 1. Preparation of the kit

[0051] 1.1 Preparation of ELISA plate: Dilute porcine circovirus type 3 Cap protein with coating buffer (0.05M pH 9.6 sodium carbonate solution) to 1 μg / mL, add to ELISA plate, 100 μL / well, and incubate at 4°C overnight (12-14 hours); remove and discard the liquid in the wells, wash three times with washing solution, and pat dry; add blocking solution (PBST solution containing 2% BSA), 200 μL / well, and incubate at 37°C for 2 hours.

[0052] 1.2 Positive control: Use the prepared porcine circovirus type 3 Cap protein and ISA 201 adjuvant emulsified vaccine (100 μg / mL) to immunize healthy susceptible 21-day-old piglets (CSFV, FMDV, PRV, PCV3, PCV2, PRRSV antibodies and antigens are all negative), and perform the second and third immunizations on the 14th and 28th day of the first immunization, respectively, 2 ml / head / time, and collect blood 7 days after the third immunization, and detect it by indirect ELISA method, and select pigs with a titer higher than 1:10000 for serum preparation. Carotid artery bleeding was performed on experimental pigs that met the conditions, centrifuged at 3000r / min for 10 minutes, and the supernatant was taken. The supernatant was mixed and sterilized by 0.22μm filter membrane. Quantitative packaging is the positive control.

[0053] 1.3 Negative control: Select healthy and susceptible 21-day-old piglets (CSFV, FMDV, PRV, PCV3, PCV2, PRRSV antibodies and antigens negative), perform carotid artery bleeding, centrifuge at 3000r / min for 10 minutes, take the supernatant, mix the supernatant and filter it through a 0.22μm filter membrane for sterilization. Quantitative packaging is the negative control.

[0054] 1.4 Preparation of sample diluent: add preservative ProClin300 (V / V) with a final concentration of 0.1% and BSA (m / V) with a final concentration of 2% to 1×PBST, mix well, filter through a 0.22 μm filter membrane for sterilization, and quantitatively distribute.

[0055] 1.5 Preparation of 25× concentrated washing solution: Add the preservative ProClin 300 (V / V) with a final concentration of 0.1% to the 25× PBST solution, mix well, filter through a 0.22μm filter membrane for sterilization, and quantitatively distribute.

[0056] 1.6 Preparation of enzyme-labeled antibody: Use sample diluent to dilute HRP-labeled anti-PCV3 Cap protein monoclonal antibody (monoclonal antibody P3) 10,000 times to obtain enzyme-labeled antibody.

[0057] 1.7 Preparation of substrate solution: Use the single-component TMB colorimetric solution or other universal colorimetric solution from Beijing Solebow Biotechnology Co., Ltd., and package it in quantitative quantities.

[0058] 1.8 Preparation of stop solution: Prepare 2M H2SO4 and divide into quantitative portions.

[0059] 1.9 Assembly of the kit: Assemble the kit according to Table 2.

[0060] Table 2 Kit Assembly

[0061] name quantity Antigen coated plates 2 plates (192 copies / box) Positive Control 1mL / tube Negative control 1mL / tube Sample diluent 12mL / bottle 25× concentrated detergent 30mL / bottle Enzyme-labeled antibody 25mL / bottle Substrate solution 25mL / bottle Stop Solution 12mL / bottle manual 1 serving

[0062] 2. Test kit

[0063] 2.1 Add samples: Add 50 μL of sample diluent to each well, then add 50 μL of positive control, negative control and serum to be tested to the corresponding wells, shake and mix well. Incubate at 37°C for 60 minutes.

[0064] 2.2 Washing: After incubation, shake off the liquid in the wells, add washing solution, 300 μL / well, wash 3 to 5 times, and pat dry.

[0065] 2.3 Enzyme-labeled antibody incubation: Add enzyme-labeled antibody, 100 μL / well, and incubate at 37°C for 30 minutes.

[0066] 2.4 Washing: After incubation, shake off the liquid in the wells, add washing solution, 300 μL / well, wash 3 to 5 times, and pat dry.

[0067] 2.5 Color development: Add substrate solution, 100 μL / well, and incubate at 37°C in the dark for 10 minutes.

[0068] 2.6 Stop: Add stop solution, 50 μL / well, and gently shake to mix evenly.

[0069] 2.7 Reading: After adding the stop solution, immediately place the coated plate in the microplate reader and read the OD 450nm value.

[0070] 2.8 S / N value calculation Calculate the S / N value according to the following calculation formula.

[0071]

[0072] 2.9 Judgment

[0073] 2.9.1 Test establishment conditions: The OD450nm reading of each negative control well should be greater than 1.0 and the maximum difference between wells should be <0.3; the OD450nm reading of each positive control well should be <0.3.

[0074] 2.9.2 When the S / N value is greater than 0.5, it is judged as negative; when the S / N value is less than or equal to 0.5, it is judged as positive.

[0075] 3. Test kit performance verification: Three batches of test kits were produced successively according to the above method, with batch numbers 241001, 241002, and 241003, respectively. These three batches of test kits were used for performance verification.

[0076] 3.1 Characteristic test

[0077] The outer packaging of the test kit should be clean and intact, the label should comply with relevant national regulations, the inner packaging should be free of damage, cracks, or leakage, and the product name, batch number, storage conditions, and expiration date should be clear.

[0078] The aluminum foil bag of the antigen-coated plate (96-well plate) is well sealed, the surface is smooth and crack-free, the bottom of the coated plate is clean, transparent, and free of foreign matter, and the packaging quantity is 2 pieces / box.

[0079] Positive control is a colorless or light yellow clear liquid, with a filling volume of 1 mL / tube, 1 tube / box.

[0080] Negative control: colorless or light yellow clear liquid, volume 1mL / tube, 1 tube / box.

[0081] Sample diluent is a colorless or light yellow clear liquid, with a filling volume of 12mL / bottle, 1 bottle / box.

[0082] 25× concentrated washing solution is a colorless clear liquid. Crystals may appear at low temperatures. The filling volume is 30mL / bottle, 1 bottle / box.

[0083] Enzyme-labeled antibody is a colorless or light yellow clear liquid, with a filling volume of 25 mL / bottle, 1 bottle / box.

[0084] The substrate solution is a colorless or light blue clear liquid, with a capacity of 25 mL / bottle, 1 bottle / box.

[0085] Stop solution is colorless clear liquid, the filling volume is 12mL / bottle, 1 bottle / box.

[0086] 3.2 Sterility Test The positive and negative controls, sample diluent, 25× concentrated washing solution and enzyme-labeled antibody components in the kit were subjected to sterility test according to the appendix of the current "Chinese Pharmacopoeia of Veterinary Medicine". The results are shown in Table 3.

[0087] Table 3 Sterility test results of five batches of test kits

[0088] batch number 241001 batch 241002 batches 241003 batches Positive Control Sterile growth Sterile growth Sterile growth Negative control Sterile growth Sterile growth Sterile growth Sample diluent Sterile growth Sterile growth Sterile growth 25× concentrated detergent Sterile growth Sterile growth Sterile growth Enzyme-labeled antibody Sterile growth Sterile growth Sterile growth

[0089] 3.3 Sensitivity verification: The three batches of kits were used to perform gradient tests on the prepared positive serum, and the lowest detection gradient could reach 3200 times, indicating that the sensitivity of the kit was very good. Specific data are shown in Table 4.

[0090] Table 4 Sensitivity test results (S / N value)

[0091] sample 241001 batch 241002 batches 241003 batches Negative control OD450 1.356 1.384 1.412 Positive control OD450 0.065 0.071 0.068 1:100 0.064 0.061 0.059 1:200 0.071 0.067 0.068 1:400 0.102 0.098 0.099 1:800 0.163 0.164 0.168 1:1600 0.278 0.287 0.281 1:3200 0.435 0.432 0.426 1:6400 0.654 0.674 0.689

[0092] 3.4 Specificity verification: The three batches of kits were used to test 7 porcine specific quality control sera, and the results were all negative, indicating that the specificity of this kit is very good. See Table 5 for specific data.

[0093] Table 5 Specificity detection results

[0094]

[0095] 3.5 Repeatability verification: The inter-batch and intra-batch coefficients of variation of the three batches of kits for positive and negative serum were all less than 10%, indicating that the repeatability of this kit is very good. See Table 6 and Table 7 for details.

[0096] Table 6 Repeatability test results (within batch)

[0097]

[0098]

[0099] Table 7 Repeatability test results (between batches)

[0100]

[0101] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. An anti-Porcine circovirus type 3 Cap protein monoclonal antibody, characterized in that: The anti-porcine circovirus type 3 Cap protein monoclonal antibody is monoclonal antibody P3, wherein the amino acid sequences of the heavy chain variable region and the light chain variable region of monoclonal antibody P3 are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively.

2. A product for detecting porcine circovirus type 3 antibodies, characterized in that: The product comprises the monoclonal antibody P3 according to claim 1.

3. The product according to claim 2, characterized in that The product also includes porcine circovirus type 3 Cap protein and matching detection reagents.

4. The product according to claim 2, characterized in that The amino acid sequence of the porcine circovirus type 3 Cap protein is shown in SEQ ID NO.1, and the codon-optimized nucleotide sequence is shown in SEQ ID NO.

2.

5. A porcine circovirus type 3 antibody detection kit, characterized in that: The kit comprises the monoclonal antibody P3 and porcine circovirus type 3 Cap protein according to claim 1 and a matching detection reagent.

6. The kit according to claim 5, characterized in that The coating concentration of the porcine circovirus type 3 Cap protein is 1 μg / mL.

7. The kit according to claim 5, characterized in that The detection reagents matched with the kit include sample diluent, 25× concentrated washing solution, substrate solution, stop solution, positive control and negative control.

8. Use of the monoclonal antibody P3 as claimed in claim 1 in the preparation of a porcine circovirus type 3 antibody detection reagent.

Images