Escherichia coli gene engineering bacteria for producing hyaluronic acid, construction method and application thereof
By modifying the Escherichia coli Nissle1917 chassis bacteria, using glucose-xylose dual carbon source fermentation and hyaluronic acid synthase modification, the high cost and low yield problems in the existing hyaluronic acid production were solved, and efficient, safe and environmentally friendly hyaluronic acid production was achieved.
Patent Information
- Application Number
- CN202411353086.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-26
- Publication Date
- 2025-10-10
- Estimated Expiration
- 2044-09-26
AI Technical Summary
Existing hyaluronic acid production methods have high costs, low yields and safety issues, especially when using Streptococcus zooepidemicus for fermentation. The viscosity increases, the dissolved oxygen decreases, the carbon source is wasted and lactic acid accumulates, which affects the growth and synthesis of the bacteria and poses a risk of pathogenic factors.
The probiotic Escherichia coli Nissle1917 was used as the base bacteria. By knocking out specific genes and overexpressing key genes in the hyaluronic acid synthesis pathway, combined with glucose-xylose dual-carbon source fermentation, the carbon metabolic flow was optimized, the xylose utilization pathway enzymes were overexpressed, and the hyaluronic acid synthase was molecularly modified to improve the enzyme's stability and catalytic efficiency.
It has achieved high-yield and low-cost production of hyaluronic acid, transformed into a green and sustainable production method, reduced production costs, improved product safety and environmental protection, and has broad market prospects.
Smart Images

Figure CN119177204B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of microorganisms and fermentation engineering, and particularly relates to genetically engineered Escherichia coli bacteria producing hyaluronic acid, a construction method thereof, and an application thereof. Background Art
[0002] The information disclosed in the background of the invention is only intended to enhance understanding of the overall background of the invention and should not necessarily be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art.
[0003] Hyaluronic acid (HA) is an important type of mucopolysaccharide with excellent moisturizing effect and high safety. Therefore, it is widely used in many fields such as medicine, cosmetics, and food, and has wide application value.
[0004] The production methods of hyaluronic acid have evolved from the initial animal tissue extraction method to chemical synthesis and microbial fermentation methods. Tissue extraction methods extract hyaluronic acid from various species and tissues, such as rooster combs, human umbilical cords, vitreous humor, and synovial fluid. However, the composition of animal tissue cells is complex, and hyaluronic acid easily aggregates with macromolecules such as proteins and DNA, making it difficult to separate. This results in a cumbersome extraction process, complex processes, and high costs. Furthermore, the purity and quality of the product are greatly affected, which limits the application of this method in hyaluronic acid production. Chemical synthesis methods synthesize hyaluronic acid through chemical reactions. Using D-glucuronic acid and N-acetylglucosamine as raw materials, the crude product is prepared through acid hydrolysis, polycondensation, neutralization, and purification. The purified hyaluronic acid usually requires further processing steps, such as washing, drying, and pulverization. This method usually requires relatively complex synthesis steps and conditions, and the product produced may contain impurities, making it unsuitable for use in the medical and cosmetic fields. In recent years, synthetic biology has continued to advance, and the synthesis mechanism of hyaluronic acid has been continuously elucidated. Using microorganisms with clear genetic backgrounds and high biosafety to synthesize hyaluronic acid has become a trend in the development of microbial fermentation methods for hyaluronic acid synthesis. The synthesis pathway for hyaluronic acid has been successfully constructed and characterized in relatively safe strains such as Escherichia coli, Lactobacillus, Bacillus subtilis, and Corynebacterium glutamicum. Currently, the most commonly used strain is Streptococcus zooepidemicus, which is still widely used in the hyaluronic acid production industry. However, there are many shortcomings in the fermentation of hyaluronic acid using S. zooepidemicus. As the hyaluronic acid content increases, the viscosity of the fermentation broth increases sharply, resulting in uneven mixing of the material and a decrease in the ability of the water to dissolve oxygen, causing the bacteria to use anaerobic respiration for growth. This results in a large waste of carbon sources and the production of large amounts of lactic acid. The accumulation of lactic acid inhibits bacterial growth and hyaluronic acid synthesis. Secondly, the continuous synthesis of hyaluronic acid consumes a large amount of UDP-N-acetylglucosamine (UDP-GlcNAc) and UDP-glucuronic acid (UDP-GlcA) in the bacteria. These two substances are essential for the growth of microorganisms. Therefore, a large amount of synthetic hyaluronic acid will affect the growth of bacteria. Most importantly, the presence of pathogenic factors such as endotoxins in Streptococcus zooepidemicus can cause many diseases, which has seriously restricted its development in the fields of medicine and other fields, seriously affecting the safety, health and green environmental protection of polysaccharide products. Although it has been successfully constructed and characterized in safer strains such as Escherichia coli and Corynebacterium glutamicum in recent years, its output and production cost still have a lot of room for improvement. In order to improve the shortcomings of hyaluronic acid synthesis by Streptococcus zooepidemicus, it is urgent to find more high-yield, environmentally friendly and economical production technologies and methods. Summary of the Invention
[0005] In view of the problems existing in the prior art, the object of the present invention is to provide a genetically engineered Escherichia coli bacteria that produces hyaluronic acid, and its construction method and application. Specifically, the present invention reports for the first time the use of probiotic Escherichia coli Escherichiacoli Nissle1917 (ECN) as a base bacteria for the biosynthesis of HA. It is also the first time that "glucose-xylose" dual carbon source is used for fermentation, further saving the production cost of HA. At the same time, the directional modification of the key enzyme hyaluronan synthase further increases the yield of HA. Based on the above research results, the present invention is completed.
[0006] Specifically, the technical solution of the present invention is as follows:
[0007] In a first aspect of the present invention, a hyaluronic acid-producing genetically engineered Escherichia coli strain is provided. The genetically engineered Escherichia coli strain is characterized by knocking out any one or more of the following: the gene pck encoding phosphoenolpyruvate carboxykinase; the gene ppsA encoding phosphoenolpyruvate synthase; the genes pykA and pykF encoding two isoenzymes of pyruvate kinase; the gene ppc encoding phosphoenolpyruvate carboxylase; the gene ptsG encoding the key component EⅡCBGlc in the PTS system; and the gene ptsI encoding the phosphohistidine transport protein HPr. The strain also overexpresses key genes in the hyaluronic acid synthesis pathway.
[0008] Among them, the key genes of the hyaluronic acid synthesis pathway include any one or more of the gene ugdA encoding UDP-glucose 6-dehydrogenase, the gene pgm encoding glucose phosphoglucomutase, the gene glmU encoding the bifunctional enzyme acetylglucosamine pyrophosphorylase / glucose-1-phosphate acetyltransferase, the gene galU encoding glucose-6-phosphate uramide transferase, the gene glmS encoding glutamine-fructose-6-phosphate aminotransferase, and the gene hasA encoding hyaluronic acid synthase.
[0009] In another specific embodiment of the present invention, in order to circumvent the bacterial carbon repression effect and further improve the utilization rate of xylose, the hyaluronic acid-producing genetically engineered Escherichia coli overexpresses the D-xylose dehydrogenase gene xylB and the xylolactonase gene xylC in the Weimberg pathway of xylose to convert xylose into xylulose; and simultaneously overexpresses the xylulose dehydratase encoding gene YjhG and the aldolase encoding gene YjhH.
[0010] In another specific embodiment of the present invention, the base bacteria is Escherichia coli, further Escherichia coli Nissle1917 (ECN).
[0011] In another specific embodiment of the present invention, among the key genes in the hyaluronic acid synthesis pathway, the gene ugdA encoding UDP-glucose 6-dehydrogenase, the gene pgm encoding glucose phosphoglucomutase, the gene glmU encoding the bifunctional enzyme acetylglucosamine pyrophosphorylase / glucose-1-phosphate acetyltransferase, the gene galU encoding glucose-6-phosphate uramide transferase, and the gene glmS encoding glutamine-fructose-6-phosphate aminotransferase are derived from Escherichia coli MG1655;
[0012] The gene hasA encoding hyaluronan synthase is derived from Streptococcus equi; further, since hyaluronan synthase is the key enzyme in hyaluronan synthesis, the present invention further molecularly modifies it and screens to obtain the dominant double mutant SeHasA (G38A & F304E) that can improve the stability of hyaluronan synthase, thereby further increasing the final hyaluronan production.
[0013] The second aspect of the present invention provides the use of the above-mentioned genetically engineered Escherichia coli in the fermentation production of hyaluronic acid.
[0014] A third aspect of the present invention provides a method for producing hyaluronic acid by fermentation, the method comprising: fermenting and culturing the genetically engineered Escherichia coli to express hyaluronic acid; and isolating and purifying the hyaluronic acid.
[0015] Wherein, the fermentation medium contains at least glucose and xylose.
[0016] A fourth aspect of the present invention provides a method for constructing a genetically engineered Escherichia coli that produces hyaluronic acid. The method comprises: using Escherichia coli as a base bacteria, and performing the following transformations on the base bacteria:
[0017] a) knocking out any one or more of the following: the gene pck encoding phosphoenolpyruvate carboxykinase; the gene ppsA encoding phosphoenolpyruvate synthase; the genes pykA and pykF encoding two isoenzymes of pyruvate kinase; the gene ppc encoding phosphoenolpyruvate carboxylase; and the gene ptsG encoding the key component EⅡCBGlc in the PTS system; and the gene ptsI encoding the phosphohistidine transporter HPr in the chassis bacteria;
[0018] b) overexpressing any one or more of the exogenous gene ugdA encoding UDP-glucose 6-dehydrogenase, the gene pgm encoding glucose phosphoglucomutase, the gene glmU encoding the bifunctional enzyme acetylglucosamine pyrophosphorylase / glucose-1-phosphate acetyltransferase, the gene galU encoding glucose-6-phosphate uridylamidotransferase, the gene glmS encoding glutamine-fructose-6-phosphate aminotransferase, and the gene hasA encoding hyaluronan synthase.
[0019] Furthermore, the construction method also includes overexpressing the D-xylose dehydrogenase gene xylB and the xylolactonase gene xylC in the Dahms pathway of exogenous xylose; and simultaneously overexpressing the xylulose dehydratase encoding gene YjhG and the aldolase encoding gene YjhH in the chassis bacteria.
[0020] Wherein, the D-xylose dehydrogenase gene xylB and the xylolactonase gene xylC
[0021] The genes ugdA encoding UDP-glucose 6-dehydrogenase, pgm encoding phosphoglucomutase, glmU encoding the bifunctional enzyme acetylglucosamine pyrophosphorylase / glucose-1-phosphate acetyltransferase, galU encoding glucose-6-phosphate uramide transferase, and glmS encoding glutamine-fructose-6-phosphate aminotransferase were derived from Escherichia coli MG1655.
[0022] The gene hasA encoding hyaluronan synthase is derived from Streptococcus equi; further, since hyaluronan synthase is the key enzyme in hyaluronan synthesis, the present invention further molecularly modifies it and screens to obtain the dominant double mutant SeHasA (G38A & F304E) that can improve the stability of hyaluronan synthase, thereby further increasing the final hyaluronan production.
[0023] The fifth aspect of the present invention provides the application of the above-mentioned genetically engineered Escherichia coli or fermentation method for producing hyaluronic acid in various fields such as medicine, cosmetics and food.
[0024] Beneficial technical effects of one or more of the above technical solutions:
[0025] The above technical solution uses probiotics as the chassis for the biosynthesis of HA for the first time, and is also the first time to use "glucose-xylose" dual carbon source for fermentation, which further saves the production cost of HA. At the same time, the targeted modification of the key enzyme hyaluronic acid synthase further increases the production of HA.
[0026] This technical solution transforms HA synthesis into a green, sustainable production method that is environmentally friendly, sustainable, efficient, and clean. It is expected to transform the existing chemical synthesis method, which relies heavily on fossil feedstocks and suffers from unsustainable pollution and high emissions, and has broad market prospects. Furthermore, a series of carbon metabolic flux enrichment technologies can bring about multiple economic benefits, including increased HA production, improved quality, reduced costs, industrial development, and innovation-driven development, thereby promoting the healthy and sustainable development of the HA biosynthesis industry. BRIEF DESCRIPTION OF THE DRAWINGS
[0027] The accompanying drawings, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.
[0028] Figure 1 HA is produced for the wild mushroom chassis of the present invention.
[0029] Figure 2 Schematic diagram of the metabolism of "glucose-xylose" for the biosynthesis of hyaluronic acid in the present invention.
[0030] Figure 3 The chassis modification and dual-carbon mixed fermentation of the strain MG07 of the present invention produce HA; wherein, A is a pcK gene knockout map, lanes 1-9 are the knockout bacteria of each gene, lane 10 is the wild-type control, and lane 11 is a marker; B is a ppsA gene knockout map, lanes 1-3 are the knockout bacteria of each gene, lane 4 is the wild-type control, and lane 5 is a marker; C is a PyKA gene knockout map, lanes 1-8 are the knockout bacteria of each gene, lane 9 is the wild-type control, and lane 10 is a marker. PyKA gene knockout map, lanes 1-8 are for each gene knockout strain, lane 9 is for the wild-type control, and lane 10 is a marker; D is PyFA gene knockout map, lanes 1-5 are for each gene knockout strain, lane 6 is for the wild-type control, and lane 7 is a marker; E is PtsG gene knockout map, lanes 1-6 are for each gene knockout strain, lane 7 is for the wild-type control, and lane 8 is a marker; F is ppC gene knockout map, lanes 1-5 are for each gene knockout strain, lane 6 is for the wild-type control, and lane 7 is a marker; G is PtsI gene knockout map, lanes 1-6 are for each gene knockout strain, lane 7 is for the wild-type control, and lane 8 is a marker; H is a map of HA production by dual-carbon mixed fermentation.
[0031] Figure 4 The UDP-GlcA precursor synthesis pathway of the present invention is enhanced; wherein, A is a map of the overexpressed pgm gene, lane 1 is a marker, and lanes 2-3 are each overexpression strain; B is a map of the overexpressed galU gene, lanes 1-3 are each overexpression strain, and lane 4 is a marker; C is a map of the overexpressed ugdA gene, lane 1 is a marker, and lanes 2-4 are each overexpression strain.
[0032] Figure 5 (A) UDP-GlcNAc precursor synthesis pathway enhancement of the present invention, lane 1 is the glmU overexpression strain, lane 2 is the glmM overexpression strain, lane 3 is the glmS overexpression strain, lane 4 is the negative control strain, and lane 5 is the marker; and (B) dual-carbon mixed fermentation to produce HA.
[0033] Figure 6 This is the result of the point mutation of the hyaluronan synthase of the present invention.
[0034] Figure 7 This is the result of the point mutation of the hyaluronan synthase of the present invention.
[0035] Figure 8 This is the result of the double mutation of hyaluronan synthase of the present invention.
[0036] Figure 9 This is a diagram showing the results of HA production in the fermenter of the present invention. DETAILED DESCRIPTION
[0037] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present invention belongs.
[0038] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit the exemplary embodiments according to the present invention. As used herein, unless the context clearly indicates otherwise, the singular form is intended to include the plural form. In addition, it should be understood that when the terms "comprise" and / or "include" are used in this specification, they indicate the presence of features, steps, operations, devices, components and / or combinations thereof.
[0039] In order to further reduce the production cost of HA biosynthesis, the present invention reprograms the central metabolic network of Escherichia coli, and divides the chassis bacteria into two major modules of "biological production" and "bacterial growth" through the synergistic metabolism of the "glucose-xylose" dual carbon source, thereby optimizing the production performance of the chassis cells. In the chassis bacteria, glucose is used exclusively for the biosynthesis of hyaluronic acid, further increasing the yield of hyaluronic acid, while the growth of bacteria is supported by xylose. At the same time, the use of xylose can reduce the production cost of hyaluronic acid and improve economic benefits. It achieves fine regulation of the distribution and utilization of carbon sources in engineered bacteria, balances cell metabolism, and enhances the efficiency of polysaccharide synthesis, with theoretical advancement; the present invention transforms the synthesis method of hyaluronic acid from a low-yield, high-cost animal tissue extraction method to a green, high-yield and relatively safe biosynthesis method. The present invention has broad market application prospects by changing the existing industrial production pattern, achieving green energy saving, and reducing costs and increasing efficiency.
[0040] Specifically, the starting substrates for hyaluronan biosynthesis are glucose-1-phosphate (Glc-1-P) and fructose-6-phosphate (Fru-6-P) from the central metabolic pathway. The Glc-1-P and Fru-6-P in the original chassis need to be catabolized and enter the tricarboxylic acid cycle (TCA) to support bacterial growth metabolism, thus having a certain impact on hyaluronan biosynthesis. Phosphoenolpyruvic acid (PEP) and pyruvic acid (PYR) are important intermediates in the synthesis of hyaluronan and also participate in TCA to support cell growth. Therefore, hyaluronan synthesis competes with TCA for carbon flux. Directly disrupting the TCA metabolic pathway or blocking the flow of carbon sources into TCA will lead to bacterial metabolic imbalance, thereby affecting the normal life activities of the cells. To this end, the present invention uses metabolic engineering to divide the metabolic activities of the chassis bacteria into two major modules: "biological production" and "bacterial growth." In the chassis bacteria, glucose is exclusively used for the biosynthesis of hyaluronic acid, while xylose is used to support bacterial growth.
[0041] By analyzing the metabolic network of Escherichia coli, a glycoengineered optimized chassis strain was rapidly constructed using CRISPR-Cas9 technology. The chassis is divided into two modules: "bioproduction" and "bacterial growth." PEP is consumed through three pathways: conversion to pyruvate by the pyruvate kinase isoenzyme PYKA / F, which enters the TCA cycle; phosphorylation of glucose by the glucose-specific PTS enzyme PTSG, which converts glucose to pyruvate; and reaction with carbon dioxide by the phosphoenolpyruvate carboxylase (PPC) to form oxaloacetate, which enters the TCA pathway. Blocking the PEP consumption pathway allows PEP to be converted to PYR and enter the TCA cycle only with glucose phosphorylation, thereby enriching the carbon metabolic flux for hyaluronan biosynthesis. However, PYR generates PEP through the action of phosphoenolpyruvate synthase PPSA, and oxaloacetate generates PEP through the action of phosphoenolpyruvate carboxykinase (PCK), reducing carbon flux in the TCA pathway and impairing cell growth and metabolism. This study aimed to supplement cell growth by introducing xylose as a second carbon source. Through multi-step knockout, a highly efficient hyaluronic acid production platform strain, MG07 (Escherichiacoli Nissle1917:Δpck:ppsA:pykA:pykF:ppc:ptsG:ptsI), was constructed. Hyaluronic acid is synthesized from the polymerization of UDP-GlcA (UDP-glucuronic acid) and UDP-GlcNAc (UDP-N-acetylglucosamine). This method optimizes the tandem combination of pathway genes to increase the concentrations of both precursors.
[0042] The recombinant MG07 strain also overexpressed the key genes pgm, ugdA, glmU, galU, glmS, and hasA in the hyaluronan biosynthesis pathway. To circumvent the bacterial carbon repression effect and further improve xylose utilization, this study overexpressed the D-xylose dehydrogenase gene xylB and the xylolactonase gene xylC, both of which are involved in the Dahms pathway, to convert xylose into xylulose. Overexpression of the endogenous xylulose dehydratase YjhG and aldolase YjhH in E. coli converted xylulose into PYR and glycolaldehyde, which can directly enter TCA and compensate for the cell's growth defect.
[0043] It should be noted that the key enzyme for HA synthesis is hyaluronan synthase. The present invention combines bioinformatics and biological experiments to excavate and screen out the best species-derived hyaluronan synthase. At the same time, the molecular modification of the key enzyme is achieved through the rational design of the enzyme, the three-dimensional structure of the enzyme is analyzed, and the enzyme catalytic performance and stability are further improved, thereby achieving the green, efficient and safe synthesis of HA. Ultimately, through the above-mentioned multi-step optimization, the recombinant strain EcnO7 uses the dual carbon source of "glucose-xylose" for batch fermentation in a 5L fermentor. The yield of hyaluronic acid reaches up to 10.7g, which is the highest yield of HA produced using a probiotic chassis reported so far.
[0044] The present invention is further explained by the following examples, but is not intended to limit the present invention. It should be understood that these examples are only intended to illustrate the present invention and are not intended to limit the scope of the present invention.
[0045] Example
[0046] Extraction of E. coli MG1655 genome
[0047] Activation of bacterial strains: Take out the E. coli strains stored at -80℃, streak them on LB plates, and incubate them inverted in the dark at 37℃ for more than 16 hours until single colonies that can be observed with the naked eye grow.
[0048] Bacterial culture: Use a sterile toothpick or pipette to pick a single colony and place it in 20 mL of LB. Incubate at 37°C, 180 rpm, and incubate for at least 16 hours. Once the culture becomes turbid, transfer the colony to 200 mL of LB and continue culturing. Once the bacteria become turbid, collect them by centrifugation and extract the genome according to the kit instructions. Finally, measure the concentration and purity using a Nano-800 micro-spectrophotometer. Label the corresponding values and store in aliquots at -20°C to avoid repeated freeze-thaw cycles during subsequent experiments.
[0049] Construction of knockout system
[0050] Primers are used to amplify 200bp of homologous fragments upstream and downstream of the gene to be knocked out. Next, the 1000bp sequence of the target gene is used to find N20 and design the sgRNA. Furthermore, the corresponding primers are used to amplify the pTarget linear fragment. Finally, multi-fragment assembly is performed. The assembly system is as follows:
[0051]
[0052] After gentle mixing, place the reaction mixture in a PCR instrument at 50°C for 15 minutes. After the PCR reaction is completed, place the reaction product on ice for 3 minutes before performing the transformation experiment.
[0053] Knockout:
[0054] The pcas9 plasmid was transformed into E. coli MG1655 by electroporation. The successfully transformed bacteria were made competent for electroporation and re-transformed with the pTarget constructed above to knock out the gene. The specific knockout steps are as follows:
[0055] 1) Pick a single pcas9 colony and inoculate it into 10 mL LB. When the OD600 grows to about 0.2, add arabinose to a final concentration of 10 mM to induce expression.
[0056] 2) When the bacteria grow to an OD600 of approximately 0.4-0.6, harvest the bacteria and prepare competent cells using conventional methods.
[0057] 3) The prepared competent cells were transformed into the successfully constructed pTarget and plated on a plate containing kanamycin and spectinomycin dual antibodies. The plates were incubated upside down at 30°C for more than 16 hours to allow homologous recombination and knockout of the gene.
[0058] 4) Single colonies grown on the double-antibody plate were screened for positive colonies with successful knockout using bacterial liquid PCR and sequencing.
[0059] 5) Induce the selected positive colonies by inoculating them with LB containing a final concentration of 0.1 mM IPTG. Incubate at 30°C for at least 24 hours, then dilute and plate onto non-resistant plates. Once single colonies have grown to visible size, replicate them onto plates containing three resistances (kanamycin, spectinomycin, and kanamycin- and spectinomycin-resistant). Finally, select colonies that grow only on the kanamycin-resistant plates and not on the spectinomycin-resistant or kanamycin- and spectinomycin-resistant plates. These colonies are considered positive strains for successful pTarget elimination. Rejuvenate the strains by inoculating them into LB and store at -80°C until needed.
[0060] 6) Eliminate pTarget success positive bacteria at 42 ℃ to eliminate pCas9 plasmid. After several transfers, we dilute the bacterial solution and spread it on an antibiotic-free plate, and incubate it at 37 ℃ overnight to grow into an observable single colony state.
[0061] 7) Repeat the above steps to obtain the chassis MG07 with pck (GenBank Accession No.: 945667), ppsA (GenBank Accession No.: 946209), pykA (GenBank Accession No.: 946527), pykF (GenBank Accession No.: 946179), ppc (GenBank Accession No.: 948457), ptsG (GenBank Accession No.: 945651) and ptsI (GenBank Accession No.: 946879) gene clusters deleted;
[0062] 6) The nucleotide sequences of the pck, ppsA, pykA, pykF, ppc, ptsG and ptsI deletion primers and identification primers are shown in the following table.
[0063]
[0064]
[0065]
[0066] 7) The single colonies grown on the antibiotic-free plate were transferred to the kanamycin-resistant plate and the antibiotic-free plate, respectively. Finally, only the colonies growing on the antibiotic-free plate were selected for colony PCR to verify again. The knockout successful strain was determined and stored at -80 ℃ for standby. Finally, through multi-gene knockout, the optimized hyaluronic acid synthesis chassis cell was successfully constructed.
[0067] Transformation:
[0068] 1) Thaw the competent cells on ice.
[0069] 2) Add all the PCR reaction products above to the competent cells and ice bath for 15 min.
[0070] 3) 42 ℃ heat shock for 90 s, and quickly place on ice for 2 min.
[0071] 4) Add recovery medium and culture and spread.
[0072] 5) Perform bacterial solution PCR identification on the grown single colonies to screen positive clones.
[0073] Double enzyme digestion of ugdA gene and PET28m plasmid
[0074] The recovered ugdA gene amplification product was double-digested with plasmid pET28m and reacted at 16°C overnight. After double-digestion, the digestion products were detected by agarose gel electrophoresis and recovered using a gel recovery kit. The reaction system is as follows:
[0075] Target gene ugdA double enzyme digestion reaction system
[0076]
[0077]
[0078] Plasmid PET28m double enzyme digestion reaction system
[0079]
[0080] Expression vector ligation and amplification
[0081] The recovered ugdA gene fragment and the PET28m plasmid fragment were ligated using T4 DNA ligase to form the complete recombinant plasmid PET28m-ugdA. The reaction system is as follows:
[0082]
[0083] The ligation product was transformed into E. coli DH5α competent cells to amplify the recombinant plasmid:
[0084] 1) Take 10 μL of the ligated product and add it to 100 μL of E. coli DH5α competent cells, mix well, and incubate on ice for 20 minutes;
[0085] 2) After the ice bath, place in a metal bath at 42°C for 45 seconds;
[0086] 3) After the heat shock, place the tube in an ice bath for 2 minutes, then immediately add 900 μL of LB medium, mix thoroughly, and incubate at 37°C, 180 rpm, and shake for 1 hour.
[0087] 4) After the recovery culture is completed, the bacterial liquid is spread on an LB plate containing 50 mg / L ampicillin and cultured in an inverted manner at 37°C overnight.
[0088] After overnight culture, single colonies were picked for colony PCR to test whether the recombinant plasmid was successfully constructed and verified using primers.
[0089]
[0090] 1) The UDP-glucose 6-dehydrogenase gene ugdA (GenBank Accession No.: 946571), the glucose phosphoglucomutase gene pgm (GenBank Accession No.: 945271), the acetylglucosamine pyrophosphorylase / glucose-1-phosphate acetyltransferase bifunctional enzyme gene glmU (GenBank Accession No.: 948246), the glucose-6-phosphate uramide transferase gene galU (GenBank Accession No.: 945730), the glutamine-fructose-6-phosphate aminotransferase gene glmS (GenBank Accession No.: 948241), and the Streptococcus equi hyaluronan synthase gene hasA (GenBank Accession No.: LC753992.1) were cloned.
[0091] 2) ligating the UDP-glucose 6-dehydrogenase gene ugdA, the glucose phosphomutase gene pgm, the acetylglucosamine pyrophosphorylase / glucose-1-phosphate acetyltransferase bifunctional enzyme gene glmU, the gene encoding glucose-6-phosphate uramide transferase galU, the glutamine-fructose-6-phosphate aminotransferase gene glmS, and the Streptococcus equi-derived hyaluronan synthase gene hasA obtained in step 1) into the plasmid vector PET28m to obtain a recombinant plasmid: PET28m-ugdA-pgm-hasA-glmU-galU-glmS;
[0092]
[0093] 3) The xylB gene, xylose dehydrogenase from Caulobacter crescentus, and the xylC gene, xylolactonase from Caulobacter crescentus, were cloned and codon-optimized (SEQ ID NOs: 1-2). The xylB gene, xylose dehydrogenase gene, yjhG gene (Gene ID: 946829), and yjhH gene (Gene ID: 948825) from Caulobacter crescentus were then ligated into the plasmid vector PCDFm to obtain the recombinant plasmid PCDFm-xylB-xylC-yjhG-yjhH.
[0094]
[0095] 4) The recombinant plasmid obtained in step 2) and step 3) is introduced into the modified chassis bacteria MG07 to obtain the recombinant bacteria.
[0096] 5) Based on site-directed mutagenesis, the hyaluronan synthase seHasA enzyme (GenBank: BDX35410.1, its encoding gene is GenBank: LC753992.1, and the nucleotide sequence after codon optimization is shown in SEQ ID NO: 3) was molecularly modified to screen for dominant mutants with improved enzyme catalytic efficiency. In this example, a mutant library was constructed by error-prone PCR and mutants with improved catalytic activity were screened; the single-point mutants obtained by screening were subjected to iterative combinatorial mutation library construction and screening, and ultimately dominant mutants with improved catalytic efficiency were obtained, thereby achieving directed evolution of the enzyme molecule.
[0097] 1) Using the pET28a-seHasA plasmid as a template, primers containing HindIII and BamHI restriction sites at both ends were designed to amplify the seHasA gene fragment;
[0098] 2) By adjusting the Mn in the PCR reaction system 2+ Random mutagenesis was performed with 400 μg / ml of 1% β-catenin at 400 μg / ml;
[0099] 3) Determine the optimal Mn based on the mutation rate 2+ The error-prone PCR products were detected by gel electrophoresis and recovered using a DNA gel recovery kit;
[0100] 4) The purified PCR product was double-digested with HindIII and BamHI, and then recombined with the pET-28a(+) expression vector;
[0101] 5) Transform the recombinant product into the expression host E. coli BL21 (DE3) competent cells and spread on LB plates containing 50 μg / mL Kan. Incubate overnight at 37°C for 12-16 hours to obtain a mutant library.
[0102] 6) Select a single colony from the resistance plate, inoculate it into a 96-well screening plate, and incubate at 37°C and 200 rpm for 12 hours;
[0103] 7) Transfer 100 μL of the cultured seed solution to a 48-deep-well plate containing 1 mL of M9 fermentation medium;
[0104] 8) adding UDP-GlcA (UDP-glucuronic acid) and UDP-GlcNAc (UDP-N-acetylglucosamine) substrates at a final concentration of 1 g / L to the fermentation medium for fermentation;
[0105] 9) When OD600 reaches 0.6-0.8, add IPTG to a final concentration of 100 μM and induce expression at 30°C for at least 16 h;
[0106] 10) The fermentation broth was centrifuged to collect the supernatant, and the synthesis of HA was detected by HPLC, with seHasA wild type as negative control, to screen the mutant with improved HA yield, and sequencing verification was performed to determine the sequence of the mutant.
[0107] The screened single-point mutant strain was subjected to iterative combination mutation to obtain double-site combination mutation. A series of combination mutant plasmids were transformed into the expression host E. coli BL21(DE3) competent cells by heat shock method, and coated with LB plates containing 50 μg / mL Kan, and incubated at 37°C overnight for 12-16 h to obtain the combination mutant strain. Positive colonies were selected and inoculated into 96-well screening plates containing 500 μL of LB medium per well for overnight culture; 100 μL of seed liquid was transferred to a 48-deep well plate containing 1 mL of M9 fermentation medium (50 μg / mL kanamycin) for fermentation, and 1 g / L of UDP-GlcA (UDP-glucuronic acid) and 1 g / L of UDP-GlcNAc (UDP-N-acetylglucosamine) substrates were added respectively; when the OD600 reached 0.6-0.8, 100 μM of IPTG was added for induction at 30°C for 16 h or more; the fermentation broth was centrifuged to collect the supernatant, and the synthesis of HA was detected by HPLC, and the superior mutant SeHasA with improved HA yield was screened out d (G38A&F304E, the nucleotide sequence thereof after codon optimization is shown as SEQ ID NO: 4), and the yield of HA was 223.71 mg / L, and sequencing verification was performed.
[0108] Fermentation culture for producing hyaluronic acid
[0109] (1) Culture medium and fermentation method:
[0110] 1) LB medium (1 L): Tryptone (10 g), Yeast Extract (5 g), sodium chloride (10 g), and double-distilled water to 1 L, sterilized at 121°C for 15 min. If a solid culture medium is prepared, 15 g of agar is further added.
[0111] 2) NBS medium (1 L): Tryptone (10 g), Yeast Extract (5 g), KH2PO4 (3.5 g), (NH4)2SO4 (1.6 g), K2HPO4·3H2O (6.5 g), FeSO4·7H2O: 0.0775 g, MnSO4·H2O: 0.004525 g, Na2SO 4: 0.02 g, ZnSO 4:0.0064 g, CoCl2-6H2O: 0.004 g, CuSO4-5H2O: 0.0006 g. 50% glucose 40 mL, 50% xylose 40 mL, 1 M MgSO4 1 mL, 1 M CaCl2 100 μL. The FeSO4-7H2O and the last five were prepared as 1000x stock solutions, filter sterilized. The glucose and xylose were autoclaved at 105°C for 15 min. The others were autoclaved at 121°C for 15 min. If a solid medium is prepared, add 15 g agar (Difco).
[0112] 3) Fermentor medium: glucose 20 g / L, xylose 10 g / L, yeast extract 2.5 g / L, MgSO4-7H2O 0.1 g / L, manganese sulfate tetrahydrate 1.5 g / L, potassium phosphate dibasic 0.64 g / L, potassium phosphate monobasic 2 g / L, sodium bicarbonate 0.5 g / L, calcium chloride 0.2 g / L, zinc chloride 0.2 g / L, copper sulfate pentahydrate 0.019 g, and ammonia water was added to maintain pH at 7.0.
[0113] (2) Shake flask fermentation and fermentor fermentation:
[0114] The shake flask fermentation procedure is as follows:
[0115] The constructed fermentation strain in the preservation tube or on the plate was inoculated into a 20 mL LB medium in a flask and incubated at 37°C, 180 rpm overnight. The seed liquid was added to a 50 mL fermentation medium in a flask at a ratio of 2%, and the corresponding antibiotics were added. The bacteria were incubated at the corresponding temperature and 200 rpm to OD600 of about 0.6, and 1.0 mmol / L isopropyl-β-D thiogalactopyranoside (IPTG) and 5 g / L glucose and xylose were added.
[0116] Fermentor fermentation:
[0117] A 5L microbial reactor was used to perform high-density fermentation of HA with 2L of fermentation medium. The HA fermentation strain was transferred from a tube or plate to 20mL of LB medium and cultured overnight in a shaker at 37°C and 180rpm. A 1% transfer ratio was then added to 200mL of LB medium and cultured in a shaker at 37°C and 180rpm until the OD600 reached approximately 0.6-0.8. This seed culture was then transferred to a fermentor containing 2L of fermentation medium. The microbial reactor monitored pH in real time, maintaining a stable pH of 6.8±0.5 by feeding ammonia. The system coupled the dissolved oxygen (DO) content of the fermentation system with the agitator speed to maintain a constant DO level. The fermentor aeration rate was set at 1.5-2.0 vvm, and the agitator speed was set at 300-800rpm. When the OD600 reached 10, the temperature was adjusted to 28°C, and IPTG was added to a final concentration of 1 mmol. Sampling was performed every two hours, and the carbon source and HA in the fermentation broth were determined by liquid chromatography. The OD600 of the bacterial broth was also measured. When the glucose concentration was below 10 g / L, glucose was fed continuously to maintain a minimum of 10 g / L. When the xylose concentration was below 5 g / L, xylose was fed continuously to maintain a minimum of 5 g / L. After 48 hours of fermentation, the HA yield reached 10.15 g / L, the highest yield currently achieved using probiotics as a base for HA production.
[0118] Sequence of the exogenous gene after codon optimization:
[0119] xylB:
[0120] ATGTCAAGTGCTATATATCCCTCTCTAAAAGGCAAGCGCGTCGTGATCACTGGTGGCGGC
[0121] AGCGGTATTGGTGCTGGCCTGACCGCAGGCTTCGCCCGTCAGGGTGCGGAGGTTATCTTT
[0122] CTGGATATTGCGGACGAGGACAGCCGTGCGCTTGAGGCCGAGTTAGCGGGTTCGCCGAT
[0123] TCCACCGGTTTACAAGCGTTGCGATCTGATGAATTTGGAGGCAATTAAAGCTGTGTTCGC
[0124] GGAGATCGGTGATGTTGATGTTCTTGTCAACAACGCGGGCAATGATGACCGCCACAAACT
[0125] GGCGGACGTGACCGGTGCGTACTGGGACGAACGCATTAACGTGAACCTGCGTCACATGC
[0126] TGTTTTGTACCCAGGCAGTAGCTCCGGGTATGAAAAAGCGCGGTGGCGGCGCTGTGATCA
[0127] ACTTTGGTTCCATTAGCTGGCATCTGGGCCTGGAAGACTTGGTTCTGTATGAAACGGCGA
[0128] AAGCGGGCATCGAAGGCATGACCAGAGCATTGGCACGTGAACTGGGTCCGGATGACATC
[0129] CGTGTGACGTGCGTTGTTCCGGGTAATGTTAAAACCAAGCGCCAAGAAAAGTGGTACAC
[0130] CCCGGAGGGTGAAGCGCAAATCGTGGCGGCGCAGTGTCTGAAAGGTCGTATCGTGCCGG
[0131] AGAACGTCGCTGCCTTGGTTCTGTTCCTCGCGTCTGACGACGCCAGCCTGTGCACCGGTCATGAATATTGGATTGATGCTGGCTGGCGTTAA (SEQ ID NO: 1)
[0132] xylC:
[0133] CTAGACAAAGCTGATCTTATGTTGGGATTAGCTGGCCACATCGACCGCAACGGTGAACAT
[0134] ACCGCAGGCCAGCGTGTCCTGGGCCAAGGCTTGGTTGCCCAAGCTTTAGCGGGTGGCGG
[0135] CGAGATCGAGGGTCTGCAAGTGCGCCCAGCTGAAGCGGGTCTGGGTGACGTGGGCGGC
[0136] GGCCAATTTGATGCCCGTCATGGTGTGGCGTTGCGCCGCGAGGCGGACCGCGCGGAAAC
[0137] CGCTCCTCAGGGTGGTCCGCAAATCGCGTTTGGTATCGATGACAGAACTGTACGTATTGA
[0138] CATCGTGGCGCAGGGTGAGCTGCATGAAGATGCGTTGGTTCGTCAGCAAGCTGTGCTGG
[0139] GTCAAGTTGAAGGCGTGGACCGCCTGTTCCAGGGCGTCGGCGTGGTTGAGGGCCTGGCG
[0140] GTGGGTCGTGATGCACGTGCGGTGGGCGACGCGGATGTTGCAGTTCACCCGGGTGACGC
[0141] AGGTGAGGTTCATCCGATTGAACGTGCGGCAATTGTTCTCTTCCCGGTTGTGCACGGTGC
[0142] GGAGCCGCAGACCGCACTGCGTGTTGATCGTGGTGTGGTGGGCGCCGTCGTTCAGCGCC
[0143] GTGTTCTTGACCTGGAACAGCAGGCTGAGGCCCGTGGTCGTGTAGAAGCGGTTAATCCG
[0144] GGTTTACAAACGGACGACAAGGCGGGTCGTGCGGACGACCGCCGCGAGGAAGGCCACC
[0145] TGATCCGTCGTGTCGAGGCCGAGGCCTTGGCGGGGGGCGGTGTCGTGGTTGTGGATTTTA
[0146] CCCTGCTGGATGTGGATGAACCGCAGGGTGTCGCAATGCCGGATCGTGCGTTCGCACAGAGAGGCTTGCAAATTCCGTACGCGTCCGATCTGAGCGGTCAC(SEQ ID NO:2)
[0147] hasA
[0148] ATGAGAACACTTAAAAATCTGATCACGGTTGTTGCATTTAGCATCTTTTGGGTTCTGCTGA
[0149] TCTATGTTAATGTTTATTTATTTGGCGCAAAAGGCTCACTGTCAATCTATGGCTTTCTGCTG
[0150] ATCGCATATTTACTGGTTAAAATGAGCCTTAGCTTTTTTTATAAACCGTTTAAAGGAAGAG
[0151] CAGGCCAATATAAAGTTGCAGCAATTATCCCGAGCTATAATGAAGATGCAGAATCATTACT
[0152] TGAAACACTTAAATCAGTTCAACAACAAACGTATCCTCTGGCAGAAATCTATGTTGTTGAT
[0153] GATGGAAGCGCAGATGAAACAGGAATTAAACGCATCGAAGATTATGTTCGCGATACGGGG
[0154] GATCTCTCTTCTAATGTTATCGTTCATCGCTCAGAAAAAAATCAAGGCAAACGCCATGCAC
[0155] AAGCATGGGCATTTGAACGCTCAGATGCAGATGTTTTTCTTACAGTTGATAGCGATACGTA
[0156] TATCTATCCGGATGCACTTGAAGAACTTCTTAAAACATTTAATGATCCGACAGTTTTTGCA
[0157] GCAACGGGACATCTTAATGTTAGAAATAGACAAACGAATTTACTGACACGCCTGACGGAT
[0158] ATTCGCTATGATAATGCATTTGGAGTTGAACGCGCAGCACAAAGCGTTACAGGCAATATCC
[0159] TGGTTTGCTCAGGACCTCTGTCAGTTTATAGACGCGAAGTTGTTGTTCCTAATATCGATAA
[0160] ATATATTAATCAAACGTTTCTTGGGATTCCGGTTAGCATCGGCGATGATCGCTGCCTGACG
[0161] AATTATGCAACGGATCTGGGCAAAACGGTTTATCAATCTACAGCAAAATGCATTACGGATG
[0162] TTCCGGATAAAATGTCTACGTATCTTAAACAACAAAATAGATGGAATAAATCGTTTTTTCG
[0163] CGAATCAATTATCTCAGTTAAAAAAATCATGAATAATCCGTTTGTTGCACTGTGGACGATC
[0164] CTGGAAGTTAGCATGTTTATGATGCTGGTTTATAGCGTTGTTGATTTTTTTGTTGGCAATGT
[0165] TAGAGAATTTGATTGGCTGCGCGTTCTGGCATTTCTGGTTATTATCTTTATCGTTGCACTGT
[0166] GCCGCAATATTCATTATATGCTGAAACATCCGCTGAGCTTTCTGCTGTCACCGTTTTATGGA
[0167] GTTCTTCATTTATTTGTTCTTCAACCTCTGAAACTGTATAGCCTGTTTACGATTCGCAATGC
[0168] AGATTGGGGCACACGCAAAAAACTGCTTGCTAGCCATCATCATCATCATCATTAA(SEQ
[0169] ID NO:3)
[0170] SeHasA d (G38A&F304E)
[0171] ATGAGAACACTTAAAAATCTGATCACGGTTGTTGCATTTAGCATCTTTTGGGTTCTGCTGA
[0172] TCTATGTTAATGTTTATTTATTTGGCGCAAAAGGCTCACTGTCAATCTATGCCTTTCTGCTG
[0173] ATCGCATATTTACTGGTTAAAATGAGCCTTAGCTTTTTTTATAAACCGTTTAAAGGAAGAG
[0174] CAGGCCAATATAAAGTTGCAGCAATTATCCCGAGCTATAATGAAGATGCAGAATCATTACT
[0175] TGAAACACTTAAATCAGTTCAACAACAAACGTATCCTCTGGCAGAAATCTATGTTGTTGAT
[0176] GATGGAAGCGCAGATGAAACAGGAATTAAACGCATCGAAGATTATGTTCGCGATACGGGG
[0177] GATCTCTCTTCTAATGTTATCGTTCATCGCTCAGAAAAAAATCAAGGCAAACGCCATGCAC
[0178] AAGCATGGGCATTTGAACGCTCAGATGCAGATGTTTTTCTTACAGTTGATAGCGATACGTA
[0179] TATCTATCCGGATGCACTTGAAGAACTTCTTAAAACATTTAATGATCCGACAGTTTTTGCA
[0180] GCAACGGGACATCTTAATGTTAGAAATAGACAAACGAATTTACTGACACGCCTGACGGAT
[0181] ATTCGCTATGATAATGCATTTGGAGTTGAACGCGCAGCACAAAGCGTTACAGGCAATATCC
[0182] TGGTTTGCTCAGGACCTCTGTCAGTTTATAGACGCGAAGTTGTTGTTCCTAATATCGATAA
[0183] ATATATTAATCAAACGTTTCTTGGGATTCCGGTTAGCATCGGCGATGATCGCTGCCTGACG
[0184] AATTATGCAACGGATCTGGGCAAAACGGTTTATCAATCTACAGCAAAATGCATTACGGATG
[0185] TTCCGGATAAAATGTCTACGTATCTTAAACAACAAAATAGATGGAATAAATCGTTTGAACG
[0186] CGAATCAATTATCTCAGTTAAAAAAATCATGAATAATCCGTTTGTTGCACTGTGGACGATC
[0187] CTGGAAGTTAGCATGTTTATGATGCTGGTTTATAGCGTTGTTGATTTTTTTGTTGGCAATGT
[0188] TAGAGAATTTGATTGGCTGCGCGTTCTGGCATTTCTGGTTATTATCTTTATCGTTGCACTGT
[0189] GCCGCAATATTCATTATATGCTGAAACATCCGCTGAGCTTTCTGCTGTCACCGTTTTATGGA
[0190] GTTCTTCATTTATTTGTTCTTCAACCTCTGAAACTGTATAGCCTGTTTACGATTCGCAATGCAGATTGGGGCACACGCAAAAAACTGCTTGCTAGCCATCATCATCATCATCATTAA(SEQ ID NO:4)
[0191] The remaining matters of the present application are known technologies.
[0192] The above only describes the preferred embodiments of the present application and is not intended to limit the present application. The present application can have various modifications and changes for those skilled in the art. Any modification, equivalent replacement, improvement, etc. within the spirit and principle of the present application shall be included in the protection scope of the present application.
Claims
1. A genetically engineered Escherichia coli strain producing hyaluronic acid, characterized in that: The Escherichia coli genetically engineered bacteria knock out the gene encoding phosphoenolpyruvate carboxykinase in the chassis bacteria pck , genes encoding phosphoenolpyruvate synthase ppsA , genes encoding two isoenzymes of pyruvate kinase pykA and pykF , gene encoding phosphoenolpyruvate carboxylase ppc , the gene encoding the key component EⅡCBGlc in the PTS system ptsG and the gene encoding the histidine phosphotransporter HPr ptsI , while simultaneously overexpressing key genes in the hyaluronan synthesis pathway; Among them, the key genes of the hyaluronic acid synthesis pathway include the gene encoding UDP-glucose-6-dehydrogenase ugA , genes encoding phosphoglucomutase pgm, Gene encoding the bifunctional enzyme acetylglucosamine pyrophosphorylase / glucose-1-phosphate acetyltransferase glmU , Gene encoding glucose-6-phosphate uramide transferase galU , Gene encoding glutamine-fructose-6-phosphate aminotransferase glmS and the gene encoding hyaluronan synthase hasA ; The hyaluronic acid-producing Escherichia coli genetically engineered bacteria overexpresses the D-xylose dehydrogenase gene xylB and xylosyl lactonase genes xylC ; Simultaneously overexpress the gene encoding xylonate dehydratase Yj Y and aldolase-encoding genes Yj Y ; Gene encoding hyaluronan synthase hasA Derived from Streptococcus equi; the hyaluronan synthase is a hyaluronan synthase double mutant SeHasA d , the hyaluronan synthase double mutant SeHasA d It is based on hyaluronan synthase, with the glycine at position 38 mutated to alanine and the phenylalanine at position 304 mutated to glutamate.
2. The genetically engineered Escherichia coli according to claim 1, wherein The bottom plate bacteria is Escherichia coli Escherichia coli Nissle, 1917.
3. The genetically engineered Escherichia coli according to claim 1, wherein Among the key genes in the hyaluronic acid synthesis pathway, the gene encoding UDP-glucose-6-dehydrogenase ugA , encoding phosphoglucomutase gene pgm, Gene encoding the bifunctional enzyme acetylglucosamine pyrophosphorylase / glucose-1-phosphate acetyltransferase glmU , Gene encoding glucose-6-phosphate uramide transferase galU and the gene encoding glutamine-fructose-6-phosphate aminotransferase glmS Derived from Escherichia coli MG1655.
4. Use of the genetically engineered Escherichia coli according to any one of claims 1 to 3 in the fermentation production of hyaluronic acid.
5. A method for producing hyaluronic acid by fermentation, characterized in that: The method comprises: fermenting and culturing the genetically engineered Escherichia coli according to any one of claims 1 to 3 to express hyaluronic acid; and isolating and purifying the hyaluronic acid; Wherein, the fermentation medium contains at least glucose and xylose.
6. A method for constructing a genetically engineered Escherichia coli that produces hyaluronic acid, characterized in that: The construction method includes: using Escherichia coli as the base bacteria, and performing the following transformation on the base bacteria: a) Knockout of the gene encoding phosphoenolpyruvate carboxykinase in the basal bacteria pck , genes encoding phosphoenolpyruvate synthase ppsA , genes encoding two isoenzymes of pyruvate kinase pykA and pykF , gene encoding phosphoenolpyruvate carboxylase ppc , the gene encoding the key component EⅡCBGlc in the PTS system ptsG and the gene encoding the histidine phosphotransporter HPr ptsI ; b) Overexpression of an exogenous gene encoding UDP-glucose-6-dehydrogenase ugA , genes encoding phosphoglucomutase pgm, Gene encoding the bifunctional enzyme acetylglucosamine pyrophosphorylase / glucose-1-phosphate acetyltransferase glmU , Gene encoding glucose-6-phosphate uramide transferase galU , Gene encoding glutamine-fructose-6-phosphate aminotransferase glmS and the gene encoding hyaluronan synthase hasA ; The construction method also includes overexpressing the D-xylose dehydrogenase gene xylB and xylosyl lactonase genes xylC ; Simultaneously overexpress the xylonate dehydratase encoding gene in the chassis bacteria Yj Y and aldolase-encoding genes Yj Y ; Gene encoding hyaluronan synthase hasA Derived from Streptococcus equi; the hyaluronan synthase is a hyaluronan synthase double mutant SeHasA d , the hyaluronan synthase double mutant SeHasA d It is based on hyaluronan synthase, with the glycine at position 38 mutated to alanine, and the phenylalanine at position 304 mutated to glutamate.
7. The construction method according to claim 6, wherein: The bottom plate bacteria is Escherichia coli Escherichia coli Nissle, 1917.
8. The construction method according to claim 6, wherein: Gene encoding UDP-glucose-6-dehydrogenase ugA , genes encoding phosphoglucomutase pgm, Gene encoding the bifunctional enzyme acetylglucosamine pyrophosphorylase / glucose-1-phosphate acetyltransferase glmU , Gene encoding glucose-6-phosphate uramide transferase galU and the gene encoding glutamine-fructose-6-phosphate aminotransferase glmS Derived from Escherichia coli MG1655.
Citation Information
Patent Citations
Method for constructing recombinant bacillus subtilis with high-yield hyaluronic acid oligosaccharide
CN110055201A
Fermentative production of carbohydrates by microbial cells utilizing mixed feedstock
CN113474463A