Casp-based RNA sensor systems, methods and uses thereof

Abstract

The present invention relates to sensor systems, methods and uses for detecting target RNA molecules in mammalian cells. The sensor system comprises a recognition part, a signal processing protein and an execution part, the recognition part is composed of a DiCas7-11 protein / Csx29 protein / crRNA compound, the signal processing protein comprises a positioning structural domain, a Csx30 structural domain, a transcriptional regulation structural domain and a transcriptional activation structural domain, and the execution part is composed of a DiCas7-11 protein / Csx29 protein / crRNA compound. The execution moiety comprises a nucleic acid sequence that interacts with the transcriptional regulatory domain of the signal processing protein. The systems and methods of the present invention can be advantageously used to detect endogenous RNA in mammalian host cells, thereby achieving RNA-dependent expression, disease diagnosis, and targeted therapy.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology and relates to a sensor system for detecting target RNA molecules in mammalian cells using CRISPR-associated proteases (CASPs), as well as uses of the system in endogenous RNA quantitative detection, RNA-dependent expression, disease diagnosis and targeted therapy. Background Art

[0002] The large-scale single-cell sequencing projects currently underway have generated a large amount of data. For example, the Human Cell Atlas project and the Cancer Genome Atlas project have collected more than 4,000 transcriptomic data, including dynamic changes in expression levels, single-base mutations, and comprehensive information on transcriptional regulatory networks under different spatiotemporal conditions and in a variety of cell types and states. These data can be used to analyze and identify cell types and states at a large scale, thereby revealing cell-specific physiological characteristics and cell development trajectories in normal and abnormal tissues; they can also be used to improve the ability to predict physiological activities at the cellular level and provide usable biomarkers for basic and clinical medicine. For example, based on such biomarkers, the mRNA of cancer cells can be used as a target for immune or gene therapy.

[0003] In order to better utilize transcriptomics big data, the field urgently needs to develop higher performance and programmable RNA sensing technology, so that the cell lineage can be tracked through RNA sequence information, the type and / or state of the cell can be identified, and the cell can be subsequently processed (such as promoting differentiation or apoptosis, etc.) based on the results of identification and tracking. Several methods have been developed to detect target RNA molecules overexpressed in mammalian cells, and to control downstream functional proteins based on the results of the detection. Such methods include miRNA, eukaryotic toehold switches, and programmable switches based on RNA adenosine deaminase (ADAR). Among them, the sensitivity and specificity of miRNA and toehold switches are not enough to identify the difference of a single nucleotide. ADAR is highly expressed in specific cell types (such as neurons), so endogenous mRNA in cells will be affected by the off-target effect of exogenous ADAR, interfering with normal physiological processes. In actual operation, the concentration of ADAR administered needs to be adjusted according to the cell type, resulting in extremely complicated operation. In addition, the sensors developed in this field are difficult to identify low-abundance RNA.

[0004] In some cases, accurate identification of target sequences is crucial for the diagnosis and treatment of diseases. For example, for cancer, the identification of mutant sequences is a prerequisite for personalized treatment. In this regard, single-base mutations in KRAS and TP53 proto-oncogenes can cause pancreatic cancer or other malignancies, and these tumors usually do not express specific surface antigens suitable for CAR-T immunotherapy. Although the recently published RNA sensing technology using ADAR can detect whether the second C in the CCA sequence is mutated, thereby achieving single-base resolution, this technology cannot identify other mutation types. How to accurately distinguish cells with any mutation type from normal cells with high sensitivity, and then selectively target and eliminate pathological cells while retaining healthy cells is an urgent problem to be solved in cancer treatment. Summary of the invention

[0005] In a first aspect, the present invention provides a system for detecting a target RNA molecule in a mammalian cell, the system comprising:

[0006] A recognition portion, the recognition portion consisting of DiCas7-11 protein, Csx29 protein and crRNA, wherein the spacer region of the crRNA contains a sequence complementary to the target RNA molecule;

[0007] A signal processing protein, the signal processing protein comprising a localization domain, a Csx30 domain, a transcriptional regulatory domain and a transcriptional activation domain, wherein the transcriptional activation domain is selected from RTa, P65, VP16, VP64, VTR1, VTR2, VTR3, VPR or a combination of the above domains; and

[0008] An executive portion, the executive portion comprising a nucleic acid sequence that interacts with the transcriptional regulatory domain of the signal processing protein.

[0009] In a second aspect, the present invention provides a method for detecting a target RNA molecule in a mammalian cell, the method comprising transfecting a plasmid comprising the following sequence into the mammalian cell:

[0010] An identification part expression cassette, wherein the identification part expression cassette is composed of a DiCas7-11 gene expression cassette, a Csx29 gene expression cassette and a crRNA expression cassette, wherein the spacer region of the crRNA comprises a sequence complementary to the target RNA molecule;

[0011] A signal processing protein expression cassette, wherein the signal processing protein comprises a localization domain, a Csx30 domain, a transcriptional regulatory domain and a transcriptional activation domain, wherein the transcriptional activation domain is selected from RTa, P65, VP16, VP64, VTR1, VTR2, VTR3, VPR or a combination of the above domains; and

[0012] An execution part expression cassette, wherein the execution part comprises a nucleic acid sequence that interacts with the transcriptional regulatory domain of the signal processing protein.

[0013] In a third aspect, the present invention provides a method for RNA-dependent expression of a protein of interest in a mammalian cell, the method comprising transfecting a plasmid comprising the following sequence into the mammalian cell:

[0014] An identification part expression cassette, wherein the identification part expression cassette is composed of a DiCas7-11 gene expression cassette, a Csx29 gene expression cassette and a crRNA expression cassette, wherein the spacer region of the crRNA comprises a sequence complementary to the target RNA molecule;

[0015] A signal processing protein expression cassette, wherein the signal processing protein comprises a localization domain, a Csx30 domain, a transcriptional regulatory domain and a transcriptional activation domain, wherein the transcriptional activation domain is selected from RTa, P65, VP16, VP64, VTR1, VTR2, VTR3, VPR or a combination of the above domains; and

[0016] An execution part expression cassette, wherein the execution part comprises a nucleic acid sequence that interacts with the transcriptional regulatory domain of the signal processing protein.

[0017] In a fourth aspect, the present invention provides use of the system described in the first aspect, the method described in the second aspect, or the method described in the third aspect in disease diagnosis or treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is the working principle of the sensor system of the present invention. The sensor comprises a recognition part, a signal processing protein and an execution part.

[0019] Figure 2The present invention is a design and characterization of a programmable sensor according to Example 1 of the present invention. (a) The sensor comprises a recognition part DiCas7-11 protein / Csx29 protein / crRNA, a signal processing protein MTS-Csx30-CI434-VP64 fusion protein and an execution part mCherry expression cassette, and the inducible promoter in the mCherry expression cassette comprises the CI434 operator site OR434. When the host cell expresses the target RNA (target RNA), the target RNA is complementary paired with the crRNA of the recognition part to form a target RNA / DiCas7-11 / crRNA / Csx29 quaternary complex, activating the protease activity of Csx29, cleaving Csx30, and releasing the chimeric transcription factor CI434-VP64 from the MTS-Csx30-CI434-VP64 fusion protein; CI434-VP64 enters the cell nucleus and activates the expression of the export protein mCherry, so the presence or absence of the target RNA can be determined by the fluorescence signal. (b) The fluorescence intensity of HEK293T cells containing the sensor measured by flow cytometry. Target RNA (+) is the experimental group in which the host cells express the target gene; Target RNA (-) is the control group in which the host cells do not express the target gene. **** Two-tailed t-test significance p < 0.0001. The data given are the average fluorescence values ​​of more than three repeated experiments, and the error bars are sem. (c) Fluorescence intensity distribution of HEK293T cells containing sensors measured by flow cytometry, and the number of cells collected is at least 10,000. Target RNA (+) is the host cell expressing the target RNA; target RNA (-) is the host cell not expressing the target RNA.

[0020] Figure 3To optimize the DiCas7-11 of the recognition part. (a) The recognition element comprises the sensor output of wild-type DiCas7-11 (wt) or mutant DiCas7-11 (mut), and the sensor output is calculated by the ratio (fold change) of the fluorescence intensity when the target crRNAcrRNA (Gluc) is expressed in the host cell and the random crRNAcrRNA (NT) is expressed. The target sequences are Gluc (Gluc crRNA, Gluc crRNA3, Gluc crRNA7, Gluc crRNA10, Gluc crRNA13, GluccrRNA16), CKB, FBL, CANX, RAN, HSP90AB1, RPS16, RPS18 and GADPH. (b) The dose response curve of the sensor output varies with the amount of target RNA. The target RNA to be detected is Gluc mRNA. The sensor output is calculated by the ratio of the fluorescence intensity when the host cell expresses Gluc and Gluc (mut). The amount of target RNA is measured by the amount of target DNA expression plasmid BB2-III. (c) Sensor output when the host cell is PANC1 cell line, NOZ cell line, AGS cell line, HuH7 cell line, HS683 cell line, RL952 cell line, T47D cell line, SW48 cell line, MIA PaCa2 cell line, NCIH508 cell line, WM115 cell line, MCF7 cell line and SF126 cell line. The target RNA is Gluc mRNA. The sensor output is calculated as the ratio of the fluorescence intensity when the host cell expresses Gluc and Gluc (mut). (d) The mRNA expression of 20 endogenous genes in the HEK293T cell line was detected using the sensor. For each target gene, 2-3 crRNAs were designed for different positions of the target sequence. The sensor output is calculated as the ratio of the fluorescence intensity when the target crRNA is expressed in the host cell and when the random crRNA is expressed. Figure 3 a- Figure 3 In d, the data presented are the averages of more than three repeated experiments, and the error bars are sem.

[0021] Figure 4To improve the specificity of detection by optimizing the crRNA sequence. (a) is a schematic diagram of a sensor for detecting point mutations. The sequence to be detected may be a wild-type sequence or a sequence with a point mutation on the basis of the wild type, and the sequence with the point mutation is used as the target sequence. The crRNA spacer is designed to be completely paired with the target sequence, that is, it has a single base mispairing with the wild-type sequence. When the sequence to be detected is the target sequence, the target sequence is completely paired with the crRNA spacer, the sensor is activated and a fluorescent signal is generated. When the sequence to be detected is a wild-type sequence, the sequence to be detected and the crRNA are not paired at the point mutation recognition site, so it can be judged whether the sequence to be detected carries a point mutation based on the difference in the fluorescent signal. (b) The sensor output when the point mutation recognition site is set at different positions in the crRNA spacer. The sensor output is calculated as the ratio of the fluorescence intensity when the sequence to be detected is the target sequence (completely paired with crRNA) or the wild-type sequence (not paired with crRNA at the point mutation recognition site). (c) The point mutation recognition site is fixed to the 21st position of the crRNA spacer, and the sensor output when the position of the auxiliary site in the crRNA spacer is changed. The auxiliary site is the position where the crRNA spacer is not paired with the target sequence. The sensor output is calculated as the ratio of the fluorescence intensity when the sequence to be detected is the target sequence (not paired with crRNA at the auxiliary site) or the wild-type sequence (not paired with crRNA at the point mutation recognition site and the auxiliary site). (d) The point mutation recognition site is fixed to the third position of the crRNA spacer, and the sensor output when the position of the auxiliary site in the crRNA spacer is changed. The sensor output is calculated as the ratio of the fluorescence intensity when the sequence to be detected is the target sequence or the wild-type sequence. The signal processing protein of the sensor is MTS-Csx30-CI434-VP64 fusion protein (above) or MTS-Csx30-CI434-VTR3 (below). (e) Schematic diagram of the structure of the recognition part when the auxiliary site is introduced. When the sequence to be detected is wild-type, it cannot activate the protease activity of Csx29 due to the mismatch with crRNA at two sites. However, the target sequence has only one mismatch with crRNA (the seventh position), which can activate the protease activity of Csx29. (f) Sensor output when the target gene is Gluc or a cancer driver gene. The sensor output is obtained by normalizing the fluorescence intensity when the recognition portion contains crRNA (NT). The crRNA used is a spacer region that is completely paired with the sequence to be detected (matched), unpaired at position 7 (point-mutated), unpaired at positions 3 and 7 (dual-mutated), and the crRNA spacer region is crRNA (NT) (non-targeting). (g) The heat map shows the relative fluorescence intensity of the sensor when the crRNA has two unpaired sites with the sequence to be detected.The fluorescence intensity when the spacer of crRNA is completely paired with the sequence to be detected is 100% (diagonal area). (h) Heat map showing the relationship between the position combination of point mutation recognition site-auxiliary site and sensor output. The sensor output is calculated as the ratio of the fluorescence intensity when the sequence to be detected is the target sequence (unpaired with crRNA at the auxiliary site) or the wild-type sequence (unpaired with crRNA at the point mutation recognition site and the auxiliary site). The sensor outputs on the diagonal are all 1. Figure 4 In b-4d and 4f, the data presented are the average values ​​of more than three repeated experiments, and the error bars are SEM. Figure 4 In g-4h, the data given are the average values ​​of more than three repeated experiments.

[0022] Figure 5Optimization of signal processing protein and output gene expression cassette. (a) Fluorescence intensity of HEK293T host cells when the cell membrane localization motif of the signal processing protein is designed with N-MTS or C-MTS. Among them, N-MTS indicates that the signal processing protein is N-MTS-Csx30-CI434-VP64 fusion protein; C-MTS indicates that the signal processing protein is CI434-VP64-Csx30-C-MTS. crRNA(+) / Target RNA(+) indicates that the host cell expresses the target gene Gluc and the target crRNA crRNA(Gluc). crRNA(+) / Target RNA(-) indicates that the host cell expresses the non-target gene Gluc(mut) but expresses crRNA(Gluc). crRNA(-) / Target RNA(-) indicates that the host cell expresses Gluc(mut) and non-target crRNA(NT). (b) Sensor output when the transcriptional activation domain of the signal processing protein is VP64, VP64-P65, P65-Rta, VTR3 or VPR. (c) Sensor output when the inducible promoter operator sites in the mCherry expression cassette are 1, 3 or 4 pairs. (d) Sensor output when the Csx30 domain of the signal processing protein is wild-type Csx30 or truncated Csx30. The sensor output is calculated as the ratio of the fluorescence intensity when the host cell expresses Gluc and Gluc(mut). (e) Sensor output when the Csx30 domain of the signal processing protein is wild-type Csx30 or truncated Csx30. (f) Fluorescence intensity of host cells when the Degron domain is added to the C-terminus or N-terminus of the cell membrane localization motif. (g) Sensor output when the Degron domain is added to the C-terminus or N-terminus of the cell membrane localization motif. (h) When the transcriptional activation domain of the signal processing protein is VP64, the sensor output varies with the amount of BB2-I plasmid transfected. The BB2-V plasmid contains the signal processing protein coding sequence. (i) When the transcriptional activation domain of the signal processing protein is VPR, the sensor output changes with the amount of transfected BB2-V plasmid. Figure 5 In a-5i, the point mutation recognition site is the 3rd position of the crRNA spacer, and the auxiliary site is the 7th position of the crRNA spacer; the data given are the average values ​​of more than three repeated experiments, and the error bars are sem. Figure 5 In 5b, 5c, 5e, 5g and 5h-5i, the sensor output is calculated as the ratio of the fluorescence intensity when the sequence to be detected is the target sequence (unpaired with crRNA at the auxiliary site) or the wild-type sequence (unpaired with crRNA at the point mutation recognition site and the auxiliary site).

[0023] Figure 6: are exemplary uses of sensors. (ac) The sensor is used to identify cancer cells carrying point mutations and to target and induce apoptosis. (a) crRNAs were designed with point mutations and wild-type sequences as target sequences, and the above crRNAs were used to detect the endogenous TP53 R273H mutation (c.818G>A) in PANC1 tumor cells, and the fluorescence intensity of the host cells obtained. The control crRNA (nontarget) is a random sequence. ** Two-tailed t-test significance p<0.01. (b) crRNAs were designed with point mutations and wild-type sequences as target sequences, and the above crRNAs were used to detect the endogenous TP53 Y220C mutation (c.659A>G) in HuH7 tumor cells, and the fluorescence intensity of the host cells obtained. (c) The output gene expression cassette is the HSV-tk gene expression cassette. When the sequence to be detected is the target sequence, the output protein HSV-tk in the sensor is activated, causing apoptosis of host cells carrying the target sequence. Results of inducing apoptosis of HEK293T, PANC1 and HuH7 tumor cells using crRNA with random spacer sequences, no auxiliary sites (pointmutation CASP) and auxiliary sites (optimized CASP). The fold change of cell death was calculated by comparing with the group with the highest survival rate. (dh) Monitoring of adipogenic differentiation of mesenchymal stem cells. (d) Schematic diagram of the adipogenic differentiation process of mesenchymal stem cells. Under the culture of specific culture medium, mesenchymal stem cells differentiate into adipocytes, and the expression levels of Adipoq, Fabp4 and PPARG increase during this process. (e) Bright field and Oil Red O staining fields show the presence of lipid droplets in cells. (f) Fluorescence microscopy images of mesenchymal stem cells containing Adipoq, Fabp4 or PPARG sensors. (g) Relative RNA expression levels of Adipoq, Fabp4 and PPARG in differentiated and undifferentiated cells measured by RT-PCR. (h) Fluorescence intensity of mesenchymal stem cells containing Adipoq sensor, Fabp4 sensor and PPARG sensor measured by flow cytometry. (il) Monitoring of HaCat cell dedifferentiation. (i) Schematic diagram of epithelial HaCat cell mesenchymal transformation. By adding TGFβ to the culture medium, the expression of fibronectin and vimentin is induced, so that epithelial HaCat cells are reverse-differentiated into mesenchymal HaCat cells. (j) Cell morphology with or without the addition of TGFβ to the culture medium under a bright field microscope, and the red fluorescence of the fibronectin sensor and vimentin sensor under the fluorescence field. (k) The expression levels of fibronectin and vimentin when TGFβ is added or not to the culture medium. (l) Fluorescence intensity of mesenchymal HaCat cells containing fibronectin sensors and vimentin sensors. The data given are the average values ​​of more than three repeated experiments, and the error bars are sem.

[0024] Figure 7 To achieve RNA-dependent expression according to Example 2 of the present invention. (a) Schematic diagram of the sensor. The sensor includes a recognition portion DiCas7-11 protein / Csx29 protein / crRNA and a signal processing protein AcrIIA4-NES-Csx30-dSpCas9-NLS-VPR fusion protein. The execution portion of the sensor is sgRNA, which can complementarily bind to dSpCas9 and the promoter region of the gene of interest. When the target RNA is present, the target RNA is complementary to the crRNA of the recognition portion to form a tgRNA / DiCas7-11 / crRNA / Csx29 quaternary complex, activate the protease activity of Csx29, cut Csx30, and release dSpCas9-NLS-VPR from the AcrIIA4-NES-Csx30-dSpCas9-NLS-VPR fusion protein. Due to the nuclear localization sequence, dSpCas9-NLS-VPR enters the cell nucleus and activates the expression of the protein of interest according to the guidance of sgRNA. (b) RPS2, HSP90AB1 and CANX mRNA were used as input to activate MIAT expression. The host cells were HEK293T cells, and the blank control was HEK293T cells without sensor. The relative RNA expression was normalized using the blank control. (c) For the RPS2-MIAT sensor, the activation effect of adding Degron to the N-terminus of the signal processing protein on the MIAT gene. (d) For the RPS2-MIAT sensor, the activation effect of the sensor on the MIAT gene when the signal processing protein contains a Degron domain and the AcrIIA4 domain has a mutation. (e) The working principle of the HSP70-MIAT temperature sensor, the crRNA is the crRNA (HSP70) for HSP70, and the sgRNA is the sgRNA (MIAT). Since the expression of the heat shock protein HSP70 increases when the temperature rises, the activation level of MIAT will change, so the expression of MIAT reflects the culture temperature. (f) Relative expression of HSP70 at different temperatures measured by RT-PCR (normalized to the expression at 37°C). (g) Relative expression of MIAT at different temperatures measured by RT-PCR. Significance was obtained by two-tailed t-test, ***p<0.001. All data are the average of more than three repeated experiments, and the error bars are sem.

[0025] Figure 8To produce progesterone using three endogenous genes RPS2, HSP90AB1 and CANX as input. (a) crRNA is for the three endogenous genes RPS2, HSP90AB1 and CANX, and sgRNA is for the promoter region of endogenous genes STAR, CYP11A1 and HSD3B2. (b) The activation effect of the three sensors on the genes of interest STAR, CYP11A1 and HSD3B2. (c) The left figure shows the synthesis pathway of progesterone, and the right figure shows the secretion level of progesterone when RPS2, HSP90AB1 or CANX is used as the input signal. All data are the average of more than three repeated experiments, and the error bars are sem. DETAILED DESCRIPTION

[0026] The latest RNA sequencing technology and transcriptomics data show a large number of mutations and changes in RNA expression levels in different cell types and states. These expression profiles provide a large number of potential biomarkers for cell lineage tracing, cell-specific killing and programmable differentiation. The present invention provides a programmable RNA sensor system that recognizes target RNA molecules through crRNA in the CRISPR-associated protease (CASP) complex and releases part of the signal processing protein in a manner dependent on RNA binding to stimulate the expression of endogenous or exogenous proteins ( Figure 1 ), thereby realizing the sensing and response of RNA as low as 1TPM (transcripts per million) in host cells. This highly sensitive sensor has many potential applications, such as cell type and state identification, biofermentation, biosensing, disease diagnosis and treatment, drug screening, and cell RNA imaging.

[0027] The CRISPR-Cas effector complex is formed by the combination of CRISPR-associated (Cas) proteins and guide RNA (gRNA). In the native bacterial immune system, gRNA is a duplex formed by hybridization of tracrRNA and crRNA through 15nt complementary sequences, and gRNA guides Cas9 to a specific position for cutting genomic DNA. In the laboratory, tracrRNA and crRNA are synthesized into a single molecule, and a hairpin structure is formed in the complementary part of tracrRNA and crRNA to construct a single guide RNA (singleguideRNA, sgRNA). The combination of Cas9 and sgRNA has become the most commonly used and powerful tool for genome editing and gene regulation of various organisms. By designing a guide sequence, the system can be used to edit a specific sequence. The term "programmable" means that a targeted guide sequence can be designed for a target RNA with any sequence.

[0028] In the present invention, crRNA is designed according to the target sequence (target RNA, tgRNA) to activate the recognition part of the sensor. The recognition part is composed of DiCas7-11 protein, Csx29 protein and crRNA, and the signal processing protein includes the Csx30 domain. In the presence of tgRNA, the combination of DiCas7-11 / crRNA / Csx29 ternary complex and target RNA can activate the protease function of Csx29, thereby cutting the Csx30 domain in the signal processing protein, releasing the transcriptional regulatory domain and transcriptional activation domain fused to the Csx30 domain, and activating the transcription of downstream proteins.

[0029] DiCas7-11 protein is a type III-E Cas protein Cas7-11 from Desulfonema ishimotonii bacteria, which has no obvious cytotoxicity. Biochemical experiments show that Cas7-11 protein can process precursor crRNA into mature crRNA, and based on the mature crRNA sequence, specifically cut the single-stranded target RNA substrate. The Cas locus of the Desulfonema ishimotonii bacterial genome encodes multiple conserved auxiliary proteins, such as Csx29 protein, Csx30 protein, Csx31 protein, RpoE protein, etc. Cryo-electron microscopy analysis shows that DiCas7-11 consists of 4 Cas7-like domains (Cas7.1 to Cas7.4 domains), 1 Cas11-like domain (Cas11 domain) and 1 insertion domain; the crRNA it recognizes contains a 15nt handle region at the 5' end and a spacer region downstream. The sequence of the 15nt handle region (i.e., crRNA positions -15 to -1) is conserved, which is UUGAUGUCACGGAAC [6] , combined with Cas7.1 and Cas7.2. Further biochemical experiments confirmed that Cas7.1 can cut the phosphodiester bond between crRNA-15 and -16 bases to generate mature crRNA. In the engineering process, the DiCas7-11 protein localization is guided by designing the spacer sequence. Usually, a spacer with a 15nt handle and not shorter than 23nt is directly used. In a preferred embodiment, the length of the spacer is 23-31nt.

[0030] The Csx29 protein has a triangular tetrapeptide repeat sequence (TPR) and a CHAT (Caspase HetF Associated with Tpr) structure, which has a regulatory effect on the degradation activity of Cas7-11 against the substrate. Based on the structural comparison between the DiCas7-11 / crRNA / Csx29 ternary complex and the type III-A CRISPR-Cas system, it can be seen that the activation of Csx29 protease activity may depend on the complementary binding of tgRNA and crRNA. Biochemical experiments have shown that the complementary pairing of tgRNA and crRNA spacer regions can activate the protease activity of Csx29, thereby cutting Csx30 protein at position 428, thereby causing the death of host bacteria. The NCBI protein ID of the DiCas7-11 protein is WP_124327589.1, and the NCBI protein ID of the Csx29 protein is WP_124327588.1. The NCBI genome IDs of DiCas7-11, Csx29, and Csx30 are NZ_BEXT01000001.1. In this article, the terms "recognition part" and "sensing part" are used interchangeably.

[0031] In a preferred embodiment, a DiCas7-11 protein with D429A and D654A mutations is used in the recognition portion. In the present invention, the DiCas7-11 protein comprising D429A and D654A mutations is referred to as DiCas7-11 (mut). Without wishing to be limited by theory, the D429 and D654 residues are key sites for ribonuclease activity in the Cas7 domain. Once the target RNA is degraded, the protease activity of Csx29 will be inhibited. Therefore, the activated Csx29 protease activity can be made more durable by introducing mutations at the above-mentioned sites.

[0032] The term "crRNA" used herein means that it can form a ternary complex with DiCas7-11 and Csx29, and when the ternary complex is bound to the target RNA, it can activate the protease activity of Csx29. The crRNA in the recognition part includes a 15nt handle region and a spacer of not less than 23nt, preferably 23-31nt. In a preferred embodiment, in order to achieve a better recognition effect, the mismatch site between the crRNA spacer and the sequence of the target RNA is at most 1, or fully paired. It will be understood by those skilled in the art that the handle region of crRNA (-15 to -1 position) is a sequence that interacts with DiCas7-11, so it is not paired with the target sequence, fully paired or partially paired for the crRNA spacer.

[0033] The terms "target sequence" and "target RNA" used herein are sequences targeted by the sensor of the present invention. "Target gene" is a DNA template of the target RNA on the genome or plasmid. In fact, the target sequence can be used as an input to the sensor to activate the sensor gene circuit. It will be understood by those skilled in the art that, under the same system, crRNA can be designed for different positions of the target sequence, target RNA or target gene to improve the specificity of detection. In an actual detection system, the sequence to be detected may be a target sequence or a sequence with a point mutation compared to the target sequence. The term "cancer driver gene" used herein refers to a gene that mutates in cancer cells, which causes the cell to grow out of control. The term "single nucleotide site variation" (SNV) refers to a change in a single base, which can be a germline variation or a somatic variation. For example, in a cancer tissue sample, an SNV in a cancer driver gene can cause cell proliferation to be out of control. In the context of the present invention, single nucleotide site variation and point mutation are used interchangeably. As shown in the embodiments of the present invention, the sensor system of the present invention is capable of identifying whether a single point mutation is contained in the sequence to be detected.

[0034] In some embodiments, the full length of the crRNA spacer is completely paired with the target sequence (or part thereof). As shown in the embodiments of the present invention, by designing the site for identifying point mutations at a specific position of crRNA, the sensitivity of the sensor for point mutation recognition can be improved. The term "point mutation recognition site" used herein refers to a site on crRNA for identifying point mutations. The point mutation recognition site is selected from one of the following positions of the crRNA spacer: +2, +3, +5, +7, +9 and +21. For example, when the target gene is a cancer driver gene, SNV can be set at the point mutation recognition site, and the corresponding gene (i.e., proto-oncogene or wild-type gene) in the non-cancerous cell cannot be complementary to crRNA at the point mutation site. Without being limited by theory, although the detection sensitivity that can be obtained by setting the wild-type sequence as the target gene is the same, it is preferred to set the cancer driver gene or the sequence with mutation as the target sequence due to the targeted treatment after SNV recognition. The term "sequence to be detected" or "gene to be detected" used herein can be a target sequence, for example, it can include SNV. Since the crRNA of the recognition part is designed for the target sequence, this crRNA is also called target crRNA.

[0035] In a preferred embodiment, the crRNA spacer is not fully complementary to the target sequence and only contains one mismatch site. The term "auxiliary site" used herein is a site where the crRNA spacer is not complementary to the target RNA. According to the present invention, by setting an auxiliary site, the difference in the detection signal of the sequence containing / not containing a point mutation can be amplified to more than 90 times. It can be understood by those skilled in the art that when the sequence to be detected may be a target sequence containing SNV or a wild-type sequence not containing SNV, crRNA and the target sequence are not complementary at the auxiliary site, and crRNA and the wild-type sequence are not complementary at the auxiliary site and the point mutation recognition site. The signal difference generated by the single mismatch / double mismatch of crRNA and the RNA to be detected at a specific site is much greater than that of no mismatch / single mismatch, therefore, for the case where SNV may be included in the sequence to be detected, it is preferred to use a single mismatch / double mismatch of crRNA and the sequence to be detected to distinguish between wild type and sequences with point mutations. In a preferred embodiment, the point mutation recognition site and the auxiliary site are selected from one of the following combinations: +3 position / +7 position, +7 position / +3 position, +3 position / +9 position, +9 position / +3 position, +3 position / +5 position, +5 position / +3 position, +2 position / +7 position, +7 position / +2 position, +2 position / +5 position, +5 position / +2 position. In a more preferred embodiment, the point mutation recognition site and the auxiliary site are +3 position / +7 position, +7 position / +3 position or +3 position / +9 position, respectively. The sensitivity of the RNA sensor switch is improved by the binding synergy of different sites.

[0036] In the present invention, the signal processing protein is a fusion protein comprising a localization domain, a Csx30 domain, a transcriptional regulatory domain, and a transcriptional activation domain. Csx29 can respond to the tgRNA recognized by crRNA and cut Csx30, so that the signal processing protein releases the transcriptional regulatory domain and the transcriptional activation domain, activates the expression of downstream genes, and thus can transmit information about whether the target sequence exists to the downstream. On the other hand, the localization domain in the fusion protein ensures that the transcriptional regulatory domain-transcriptional activation domain before cutting will not be located to the promoter region of the protein of interest / .

[0037] The NCBI protein ID of Csx30 protein is WP_124329907.1. In the present invention, the Csx30 domain may be the full-length or truncated Csx30 of the Csx30 protein. As described above, the complementary pairing of tgRNA and crRNA spacer can activate the protease activity of Csx29, thereby cutting the Csx30 protein at position 428. In fact, the truncated Csx30 protein can be effectively cut by Csx29 as long as it contains amino acids 407 to 565. In a preferred embodiment, the Csx30 domain is a truncated Csx30 protein comprising amino acids 366 to 565 of the Csx30 protein.

[0038] It is known in the art that prokaryotic transcription regulatory proteins can be fused with eukaryotic transcription activation domains to regulate gene expression in eukaryotic cells. US8383364B2 discloses the fusion of the VP16 activation domain of herpes simplex virus with the prokaryotic repressor protein TetR to prepare the transcription activator tTA. In eukaryotic cells, tTA regulates the transcription activity of the promoter Ptet containing tetO. Neddermann et al. fused the LuxR family allosteric transcription factor TraR with the eukaryotic transcription activation domain p65. The transcription factor TraR-p65 can induce the expression of mammalian genes. In addition, four tandem repeats of VP16 (i.e., VP64), p65 [8] Or SAM and other eukaryotic transcriptional activation domains are fused to dSpCas9, and the target gene is activated by sgRNA. Ma et al. fused the known eukaryotic transcriptional activation domains p65, RTA and VP64 to construct a series of VTR domains, and the fusion proteins with dSpCas9 can be used to regulate eukaryotic gene transcription. [7] The transcriptional activation domain of the signal processing protein of the present invention may be, for example, RTa, P65, VP16, VP64, VTR1, VTR2, VTR3, VPR, or a combination of the above domains, preferably VTR3 or VPR [5] Other eukaryotic transcriptional activation domains known in the art may also be used. The sequences of the above transcriptional activation domains are well known in the art.

[0039] In a preferred embodiment, each domain is operably connected by means of a connecting peptide. It is known in the art that the connecting peptide is generally a plurality of serines and glycines in series, thereby providing flexibility and not affecting the activity of each domain. The sequence of the connecting peptide may be (GGGGS)n, where n is an integer selected from 1-6. The term "domain" as used herein is the basic unit of protein structure, folding, function, evolution and design. A fusion protein includes at least two domains, each of which is encoded by an independent gene and connected so that it can be transcribed and translated as a unit to produce a polypeptide.

[0040] In some embodiments, the localization domain in the signal processing protein is AcrIIA4 protein and the transcriptional regulatory domain is dSpCas9 protein. In this regard, the fusion protein as a signal processing protein may include the following domains: AcrIIA4 domain, Csx30 domain, dSpCas9 domain and transcriptional activation domain. In the context of the present invention, the fused dSpCas9 domain and the transcriptional activation domain are also referred to as chimeric dSpCas9 domains. By operably connecting AcrIIA4 to one end of the Csx30 protein and connecting the chimeric dSpCas9 to the other end of the Csx30 protein, the chimeric dSpCas9 can be released according to the binding signal of crRNA and target RNA to trigger the transcription of downstream genes.

[0041] SpCas9 protein is a type II-A Cas protein from Streptococcus pyogenes, which recruits target double-stranded DNA (dsDNA) by recognizing PAM fragments through the PAM interaction domain. After the two strands of the target dsDNA are separated, the target strand forms a heteroduplex with the guide sequence of crRNA. The complementary and non-complementary strands of DNA are cleaved by the nuclease domains of HNH and RuvC, respectively. SpCas9, combined with synthetic single guide RNA (sgRNA), has become the most commonly used and powerful tool for genome editing and gene regulation in various organisms. Through the RNA-guided endonuclease activity of Cas9, SpCas9 can degrade double-stranded DNA with PAM and complementary sequences to the guide RNA. Recently, it was discovered that the AcrIIA4 protein in Listeria monocytogenes prevents SpCas9 protein from recognizing double-stranded DNA substrates by binding to the SpCas9 active site. Structural analysis showed that AcrIIA4 competes with PAM-containing dsDNA substrates for binding to SpCas9-sgRNA, thereby inhibiting the activity of SpCas9.

[0042] dSpCas9 is a nuclease-deficient SpCas9. dSpCas9 is a Cas9 protein with mutations in the RuvC1 and HNH nuclease domains. Compared with wild-type Cas9, the aspartic acid at position 10 of dCas9 is replaced by alanine, and the histidine at position 840 is replaced by alanine (D10A, H840A)

[17] . dspCas9 has no nuclease activity but can still form a complex with sgRNA and bind to its DNA target, so that after fusion with the eukaryotic transcription activation domain, it can serve as a transcriptional regulatory domain that activates transcription in response to sgRNA signals. It should be noted that the D10A and H840A mutations do not affect the inhibition of dSpCas9 by AcrIIA4. The NCBI protein ID of dSpCas9 that can be used in the present invention is WP_011285506.1; the NCBI protein ID of AcrIIA4 is WP_003723290.1.

[0043] In a preferred embodiment, by adding a nuclear localization sequence (NLS) at the N-terminus of the transcriptional activation domain and adding a nuclear export signal (NES) at the N-terminus of the Csx30 protein, the cleaved AcrIIA4 domain can be positioned outside the nucleus, and the chimeric dSpCas9 can be assisted to be positioned in the nucleus, thereby improving the signal-to-noise ratio of the output. The NES sequences and NLS sequences commonly used in the art are well known in the art. In a preferred embodiment, AcrIIA4 may have D14A, Y15A and / or N39A mutations, thereby reducing the binding affinity to dSpCas9. In a preferred embodiment, a dihydrofolate reductase (DHFR) degradation factor (Degron) is operably connected to the N-terminus of AcrIIA4. Without wishing to be limited by theory, free AcrIIA4 may still inhibit chimeric dSpCas9, and by adding a dihydrofolate reductase degradation factor, DHFR can cut free AcrIIA4 and increase the expression of the protein of interest. In a preferred embodiment, the signal processing protein is AcrIIA4-NES-Csx30-dSpCas9-NLS-transcription activation domain or Degron-AcrIIA4-NES-Csx30-dSpCas9-NLS-transcription activation domain.

[0044] In such embodiments, the execution portion includes sgRNA. In the presence of target RNA, the combination of target RNA and DiCas7-11 / crRNA / Csx29 can cut the Csx30 domain in the signal processing protein, so that the signal processing protein is divided into AcrIIA4-N'Csx30 and C'-Csx30-chimeric dSpCas9. In the presence of sgRNA complementary to the promoter of the downstream gene of interest, the sgRNA can locate the C'-Csx30-chimeric dSpCas9 to the transcription start region of the effector gene, thereby activating the transcription of the effector gene. The effector gene can be any gene endogenous to the cell, so that any effector gene can be activated using any set target RNA, and the gene circuit inside the cell can be reconstructed to achieve functions such as cell differentiation, dedifferentiation, and cell factories for producing specific compounds. It can be understood by those skilled in the art that the eukaryotic cell promoter is longer, and the spacer region of the sgRNA is complementary to a part of the promoter to locate the chimeric dSpCas9 to the promoter region. The length of the sgRNA spacer region in the CRISPR / Cas9 system is well known in the art, and is generally not shorter than 19 nt, and preferably not shorter than 23 nt.

[0045] It will be appreciated by those skilled in the art that, in order to achieve the purpose of sensing, the expression of the effector gene can be analyzed (e.g., RT-PCR) to detect the target RNA; when the effector gene is, for example, a luminescent gene or a fluorescent gene, the host cell can also be optically detected to detect the target RNA. In a preferred embodiment, the effector gene is a gene endogenous to the cell, so that the expression of endogenous proteins in the cell is regulated by the target RNA (i.e., RNA-dependent expression). In such embodiments, as described above, the chimeric dSpCas9 is positioned to the nucleus by adding an NLS sequence. In other embodiments, the execution portion comprises sgRNA and an output gene expression cassette, wherein the sgRNA is partially complementary to the promoter of the output gene. The transcriptional activation domain connected to dSpCas9 is positioned to the output protein by combining the sgRNA with the promoter portion of the output gene, thereby regulating the exogenous output protein using the target RNA. The output gene expression cassette may be located in a plasmid or a genome. In a sensor system, a variety of sgRNAs may be provided to construct a regulatory network.

[0046] In other embodiments, the localization domain in the signal processing protein is a cell membrane localization motif; the transcriptional regulatory domain is an allosteric transcription factor of prokaryotic origin. In this regard, the fusion protein as a signal processing protein may include the following domains: a cell membrane localization motif, a Csx30 domain, an allosteric transcription factor domain, and a transcription activation domain. In the context of the present invention, the fused allosteric transcription factor domain and the transcription activation domain are also referred to as chimeric allosteric transcription factor domains. By operably connecting the cell membrane localization motif to one end of the Csx30 protein and connecting the chimeric allosteric transcription factor to the other end of the Csx30 protein, the chimeric allosteric transcription factor can be released according to the binding signal of crRNA and the target RNA, triggering the transcription of downstream genes.

[0047] The term "membrane targeting sequence" as used herein refers to a signal peptide that targets the fusion protein to the cell membrane. In mammalian cells, membrane proteins have a conserved sequence, so that during translation and post-translational processing, the membranous organelles can transport the protein carrying the sequence to the cell membrane. The cell membrane targeting motifs that can be used in the present invention include, but are not limited to, the membrane anchor sequence N-MTS fused to the N-terminus of the protein (e.g., the transmembrane domain sequence GCIKSKRKDNLNDDE from PDGFR) [1] , membrane localization sequence GCIKSKRKDNLNDDE [2] etc.), and a membrane anchor sequence C-MTS fused to the C-terminus of the protein (e.g. the CaaX sequence GKKKKKKSKTKCVIM from Kras4b [3] 、Lck sequence MGCVCSSNPE [4] wait).

[0048] The term "chimeric allosteric transcription factor" used herein means that the allosteric transcription factor of prokaryotic origin is fused with the eukaryotic transcription activation domain, thereby regulating gene expression in eukaryotic cells. The allosteric transcription factor of prokaryotic origin in the signal processing protein is used as the regulatory domain, and the eukaryotic transcription activation domain is the "transcription activation domain". The term "chimeric enzyme" used herein is different from the enzyme found in nature. It can include catalytic domains of different sources (from different enzymes) or enzymes whose catalytic domains are from the same source but arranged differently from nature. The term "allosteric transcription factor" used in the present invention has a well-known meaning in the art, referring to a protein that can recognize a specific operator site, and its binding to the operator site changes the binding affinity of RNA polymerase to the promoter sequence. Herein, the terms "operator site", "operator sequence", and "transcription factor binding site" (TFBS) are used interchangeably and refer to a DNA sequence that inhibits / activates transcription when bound to a transcription factor. The regulatory domain that can be used in the present invention may be any known allosteric transcription factor of prokaryotic origin, including but not limited to RpaR, BraR, BjaR, TetR, CI434, Phlf, HKCl, LmrA, Bm3R, TP901CI, CymR, TtgR and LexA, etc. For the above-mentioned allosteric transcription factors and the operator site sequences they recognize and their original sources, please refer to Chinese patent application 202310136734.1. In some embodiments, the number of TFBS is set to more than 2 pairs, which can produce a synergistic effect by inducing the multimerization of the regulatory domain. However, too many TFBS will produce excessive steric hindrance, resulting in a decrease in the overall transcription efficiency. In the present invention, the number of TFBS is preferably 1-4 pairs; more preferably 3 pairs (6).

[0049] In a preferred embodiment, the dihydrofolate reductase (DHFR) degradation factor Degron is operably linked to the N-terminus of Csx30. During the translation and transport to the cell membrane, the signal processing protein may still bind to the inducible promoter in the execution part, resulting in leakage of the output protein. Therefore, by adding the dihydrofolate reductase degradation factor, DHFR can cut the signal processing protein that is not localized to the cell membrane, thereby reducing the background expression of the output protein. In such embodiments, the signal processing protein is N-MTS-Degron-Csx30-allosteric transcription factor domain-transcription activation domain.

[0050] In such embodiments, the execution part is an output gene expression cassette. The output gene expression cassette comprises an output gene sequence and an inducible promoter that controls the transcription of the output gene; wherein the inducible promoter comprises an operator site recognized by the chimeric transcription factor domain. The chimeric transcription factor domain in the signal processing protein is released from the cell membrane by using the principle that tgRNA activates the DiCas7-11 / crRNA / Csx29 ternary complex to cause Csx30 protein cleavage, and the chimeric transcription factor domain in the signal processing protein is bound to the promoter in the execution part, thereby finally activating the expression of the output protein, thereby converting the signal of tgRNA binding to crRNA into the expression of the output protein. The output gene expression cassette may be a luminescent protein or a fluorescent protein, which can determine the presence of the target RNA optically. The output protein may also be a functional protein, so that the physiological process of the host cell can be dynamically regulated, the control of the cell state or the synthesis of heterologous proteins can be achieved, etc.

[0051] In some embodiments, the export protein is a reporter gene, such as a fluorescent protein or luciferase, so that the signal of whether the target RNA exists is converted into an optical signal. In some embodiments, the export protein is a protein of interest, so that the expression of the protein of interest can be turned on / off in an RNA-dependent manner. In some embodiments, the export protein is a functional protein, so that the target RNA can be used as a switch, and the expression of the functional protein can be turned on or off in response to the target RNA to dynamically regulate the physiological process of the host cell. For example, delayed feedback is provided by RNA-dependent expression to maintain specific physiological indicators in a stable state. In addition, in the use of tumor treatment, the export protein can be herpes simplex virus thymidine kinase (HSV-tk), and HSV-tk can convert the prodrug ganciclovir into a cytotoxic substance to inhibit the synthesis of DNA. In this way, apoptosis can be induced for cancer cells that lack specific surface antigens, for example.

[0052] definition

[0053] The term "engineered" and similar terms can refer to a system that does not exist in nature and is intentionally generated. Such engineering can include introducing one or more mutations into a gene sequence, combining multiple protein sequences into non-natural fusion proteins, and / or generating non-natural RNA, etc.

[0054] The term "expression" etc. refers to the process of polynucleotide transcription (such as transcription into mRNA or other RNA transcripts) from a DNA template and / or the process in which the transcribed mRNA is subsequently translated into peptides, polypeptides or proteins. The term "expression cassette" refers to a DNA fragment consisting of one or more genes and a sequence controlling the expression of the gene, so that the protein encoded by the gene can be expressed in a desired host cell (i.e., a mammalian cell). "Expression cassette" may also refer to a DNA fragment corresponding to a functional RNA and a sequence controlling the expression of the DNA fragment, such as a crRNA expression cassette and an sgRNA expression cassette. It is known in the art that a sequence controlling expression is included in an expression cassette, and the sequence controlling expression optionally includes a promoter sequence, a 3' non-coding region, a transcription termination site and / or polyadenylic acid, etc. In the present invention, an expression cassette comprising a promoter and a DNA sequence may be integrated into a genome or present in a plasmid vector.

[0055] The term "promoter" refers to a DNA region that drives the expression or transcription of a nucleic acid sequence, located upstream of the synonymous strand of the gene transcription start site. RNA polymerase and transcription factors or other transcription regulatory proteins (such as dSpCas9) can bind to DNA at the promoter. Inducible promoters generally include an operator site, an RNA polymerase recognition region, and a transcription start site. It is known in the art that the coding sequence of a gene of interest is operably connected to the downstream of an inducible promoter, and an inducer is added at the desired time, and the transcription of the gene can be dynamically turned on or off. The term "minimal promoter" or "core sequence of a promoter" refers to a minimal transcription control unit that can trigger transcription in eukaryotic cells, such as a promoter core region that only includes an RNA polymerase recognition region and a transcription start site. At least one operator site can be added upstream and / or downstream of the minimal promoter to construct an inducible promoter with excellent switching performance. In a preferred embodiment of the present invention, the core sequence of the inducible promoter can be selected from CMV1 promoter, CMVmini promoter, TRE3G promoter, EF1a core promoter or hEF1a promoter; preferably, the core sequence is CMV1 promoter or TRE3G promoter. For the sequence of the above promoter, see Chinese patent application 202111150967.4. In the present invention, the promoters contained in each expression cassette of the recognition part and the signal processing protein expression cassette can independently be constitutive promoters or inducible promoters.

[0056] The term "cell line" and the like refers to a clone of a primary cell that can be stably grown in vitro for many generations.

[0057] It will be appreciated by those skilled in the art that, with respect to the protein domain of the present invention, proteins substantially homologous to the above-mentioned capping enzyme or RNA polymerase may also be used. The term "substantially homologous" means that the protein sequence level is at least 95%, at least 98%, or at least 99% identical. Homologous sequences may be sequences with the same function in different species. Homologs of the genes or proteins of the present invention may be easily determined by those skilled in the art.

[0058] The term "RNA-dependent expression" refers to the ability to use an RNA molecule as an input signal to activate the expression of another gene. The activated gene can be present in the plasmid or in the genome.

[0059] Implementation of the various aspects described herein may be described by the following numbered paragraphs:

[0060] 1. A system for detecting a target RNA molecule in a mammalian cell, the system comprising:

[0061] A recognition portion, the recognition portion consisting of DiCas7-11 protein, Csx29 protein and crRNA, wherein the spacer region of the crRNA contains a sequence complementary to the target RNA molecule;

[0062] A signal processing protein, the signal processing protein comprising a localization domain, a Csx30 domain, a transcriptional regulatory domain and a transcriptional activation domain, wherein the transcriptional activation domain is selected from RTa, P65, VP16, VP64, VTR1, VTR2, VTR3, VPR or a combination of the above domains; and

[0063] An executive portion, the executive portion comprising a nucleic acid sequence that interacts with the transcriptional regulatory domain of the signal processing protein.

[0064] 2. The system of paragraph 1, wherein the DiCas7-11 protein of the recognition portion has a D429A / D654A mutation.

[0065] 3. The system of paragraph 1, wherein the crRNA spacer of the recognition portion is 23-31 nt.

[0066] 4. A system as described in paragraph 1, wherein the spacer region of the crRNA has a point mutation recognition site, and the point mutation recognition site is selected from any of the following positions of the crRNA spacer region: position 2, position 3, position 5, position 7, position 9 and position 21.

[0067] 5. A system as described in paragraph 4, wherein the spacer region of the crRNA has a point mutation recognition site and an auxiliary site, and the point mutation site and the auxiliary site are selected from any of the following position combinations of the crRNA spacer region: position 2 and position 5, position 2 and position 7, position 3 and position 5, position 3 and position 7, position 3 and position 9, position 5 and position 2, position 5 and position 3, position 7 and position 2, position 7 and position 3, and position 9 and position 3.

[0068] 6. A system as described in paragraph 5, wherein the spacer region of the crRNA has a point mutation recognition site and an auxiliary site, and the point mutation site and the auxiliary site are selected from any of the following position combinations of the crRNA spacer region: position 3 and position 7, position 7 and position 3, or position 3 and position 9.

[0069] 7. The system of paragraph 1, wherein the Csx30 domain is a truncated Csx30 having amino acids 366-565 of Csx30.

[0070] 8. The system of paragraph 1, wherein the localization domain of the signal processing protein is AcrIIA4, the transcriptional regulatory domain is dSpCas9; and the execution portion comprises sgRNA.

[0071] 9. The system of paragraph 8, wherein the signal processing protein further comprises a NES sequence at the C-terminus of the AcrIIA4 domain and further comprises a NLS sequence at the N-terminus of the transcription activation domain.

[0072] 10. The system of paragraph 8, wherein the signal processing protein further comprises a Degron domain at the N-terminus of the AcrIIA4 domain.

[0073] 11. The system of paragraph 8, wherein the AcrIIA4 domain of the signal processing protein comprises D14A, Y15A and / or N39A mutations.

[0074] 12. The system of paragraph 8, wherein the execution portion comprises an sgRNA and an output gene expression cassette, wherein the spacer region of the sgRNA is complementary to a promoter in the output gene expression cassette.

[0075] 13. A system as described in paragraph 1, wherein the localization domain of the signal processing protein is a cell membrane localization domain, and the transcriptional regulatory domain is an allosteric transcription factor; the execution part is an output gene expression cassette, wherein the output gene expression cassette comprises an output protein coding sequence and an inducible promoter that controls the transcription of the output protein; wherein the inducible promoter comprises an operator site that interacts with the allosteric transcription factor.

[0076] 14. The system of paragraph 13, wherein the cell membrane localization domain is N-MTS or C-MTS.

[0077] 15. The system of paragraph 13, wherein the allosteric transcription factor is selected from RpaR, BraR, BjaR, TetR, CI434, Phlf, HKCl, LmrA, Bm3R, TP901CI, CymR, TtgR and LexA.

[0078] 16. The system of paragraph 13, wherein the inducible promoter in the export gene expression cassette has 1-4 pairs of operator sites.

[0079] 17. A method for detecting a target RNA molecule in a mammalian cell, the method comprising transfecting a plasmid comprising the following sequence into the mammalian cell:

[0080] An identification part expression cassette, wherein the identification part expression cassette is composed of a DiCas7-11 gene expression cassette, a Csx29 gene expression cassette and a crRNA expression cassette, wherein the spacer region of the crRNA comprises a sequence complementary to the target RNA molecule;

[0081] A signal processing protein expression cassette, wherein the signal processing protein comprises a localization domain, a Csx30 domain, a transcriptional regulatory domain and a transcriptional activation domain, wherein the transcriptional activation domain is selected from RTa, P65, VP16, VP64, VTR1, VTR2, VTR3, VPR or a combination of the above domains; and

[0082] An execution part expression cassette, wherein the execution part comprises a nucleic acid sequence that interacts with the transcriptional regulatory domain of the signal processing protein.

[0083] 18. A method for RNA-dependent expression of a protein of interest in a mammalian cell, the method comprising transfecting the mammalian cell with a plasmid comprising the following sequence:

[0084] An identification part expression cassette, wherein the identification part expression cassette is composed of a DiCas7-11 gene expression cassette, a Csx29 gene expression cassette and a crRNA expression cassette, wherein the spacer region of the crRNA comprises a sequence complementary to the target RNA molecule;

[0085] A signal processing protein expression cassette, wherein the signal processing protein comprises a localization domain, a Csx30 domain, a transcriptional regulatory domain and a transcriptional activation domain, wherein the transcriptional activation domain is selected from RTa, P65, VP16, VP64, VTR1, VTR2, VTR3, VPR or a combination of the above domains; and

[0086] An execution part expression cassette, wherein the execution part comprises a nucleic acid sequence that interacts with the transcriptional regulatory domain of the signal processing protein.

[0087] 19. The method of paragraph 17 or 18, wherein the DiCas7-11 protein of the recognition portion has a D429A / D654A mutation.

[0088] 20. A method as described in paragraphs 17 or 18, wherein the crRNA spacer region of the recognition portion is 23-31 nt.

[0089] 21. A method as described in paragraph 17 or 18, wherein the spacer region of the crRNA has a point mutation recognition site, and the point mutation recognition site is selected from any of the following positions of the crRNA spacer region: position 2, position 3, position 5, position 7, position 9 and position 21.

[0090] 22. The method of paragraph 21, wherein the spacer region of the crRNA has a point mutation recognition site and an auxiliary site, and the point mutation site and the auxiliary site are selected from any of the following position combinations of the crRNA spacer region: position 2 and position 5, position 2 and position 7, position 3 and position 5, position 3 and position 7, position 3 and position 9, position 5 and position 2, position 5 and position 3, position 7 and position 2, position 7 and position 3, and position 9 and position 3.

[0091] 23. A method as described in paragraph 22, wherein the spacer region of the crRNA has a point mutation recognition site and an auxiliary site, and the point mutation site and the auxiliary site are selected from any of the following position combinations of the crRNA spacer region: position 3 and position 7, position 7 and position 3, or position 3 and position 9.

[0092] 24. The method of paragraph 17 or 18, wherein the Csx30 domain is a truncated Csx30 having amino acids 366-565 of Csx30.

[0093] 25. The method of paragraph 17, wherein the localization domain of the signal processing protein is AcrIIA4, and the transcriptional regulatory domain is dSpCas9; the execution part expression cassette comprises an sgRNA expression cassette and an output gene expression cassette, wherein the spacer region of the sgRNA is complementary to the promoter of the output gene.

[0094] 26. The method of paragraph 18, wherein the localization domain of the signal processing protein is AcrIIA4, and the transcriptional regulatory domain is dSpCas9; the execution portion comprises sgRNA, and the spacer region of the sgRNA is complementary to the promoter of the protein of interest.

[0095] 27. The method of paragraph 25 or 26, wherein the signal processing protein further comprises a NES sequence at the C-terminus of the AcrIIA4 domain and further comprises a NLS sequence at the N-terminus of the transcription activation domain.

[0096] 28. The method of paragraph 25 or 26, wherein the signal processing protein further comprises a Degron domain at the N-terminus of the AcrIIA4 domain.

[0097] 29. The method of paragraph 25 or 26, wherein the AcrIIA4 domain of the signal processing protein comprises D14A, Y15A and / or N39A mutations.

[0098] 30. The method of paragraph 17, wherein the localization domain of the signal processing protein is a cell membrane localization domain, and the transcriptional regulatory domain is an allosteric transcription factor; the execution portion is an export gene expression cassette, wherein the export gene expression cassette comprises an export protein coding sequence and an inducible promoter that controls the transcription of the export protein; wherein the inducible promoter comprises an operator site that interacts with the allosteric transcription factor.

[0099] 31. A method as described in paragraph 18, wherein the localization domain of the signal processing protein is a cell membrane localization domain, and the transcriptional regulatory domain is an allosteric transcription factor; the execution part is an expression cassette of a protein of interest, wherein the expression cassette of the protein of interest comprises a coding sequence of the protein of interest and an inducible promoter that controls the transcription of the protein of interest; wherein the inducible promoter comprises an operator site that interacts with the allosteric transcription factor.

[0100] 32. The method of paragraph 30 or 31, wherein the cell membrane localization domain is N-MTS or C-MTS.

[0101] 33. The method of paragraph 30 or 31, wherein the allosteric transcription factor is selected from RpaR, BraR, BjaR, TetR, CI434, Phlf, HKCl, LmrA, Bm3R, TP901CI, CymR, TtgR and LexA.

[0102] 34. The method of paragraph 30 or 31, wherein the inducible promoter has 1-4 pairs of operator sites.

[0103] 35. Use of the system of any one of paragraphs 1-16 or the method of any one of paragraphs 17-34 in disease diagnosis or treatment.

[0104] 36. The use according to paragraph 34, wherein the disease is cancer.

[0105] Example

[0106] Example 1

[0107] 1. Sensor Design and Characterization

[0108] The programmable RNA sensor is constructed by adopting the strategy of "binding to target RNA-signal generation", which can dynamically respond to RNA in mammalian cells in a quantitative manner. The recognition part of the sensor uses the natural mechanism of crRNA guiding Cas7-11 protein to recognize the target RNA sequence; through the cleavage of Csx29 protein on Csx30 protein, the signal of crRNA binding to target RNA is transmitted to the signal processing protein, and finally the expression of output protein / protein of interest is initiated by releasing the transcriptional regulatory domain-transcriptional activation domain.

[0109] Since the crRNA sequence is short and can be designed according to the target RNA sequence, the sensor of the present invention has programmability, that is, it can recognize any sequence. Figure 2 As shown in a, the recognition part of the sensor is composed of DiCas7-11 protein, Csx29 protein and crRNA. DiCas7-11 protein is the type III-E Cas protein Cas7-11 from Desulfonema ishimotonii. When the target RNA is present in the cell, the complementary pairing of the target RNA and crRNA activates the protease activity of Csx29, enabling it to cut the Csx30 domain in the signal processing protein MTS-Csx30-CI434-VP64 and release the chimeric transcription factor CI434-VP64 from the cell membrane. Free CI434-VP64 can bind to the operator site OR434 of the inducible promoter in the mCherry expression cassette to drive the expression of the reporter gene mCherry.

[0110] The sensor system includes four plasmids: BB1-I plasmid with CMV promoter-DiCas7-11 coding sequence, BB1-II plasmid with CMV promoter-Csx29 coding sequence, BB2-I plasmid with CMV promoter-MTS-Csx30-CI434-VP64 fusion protein coding sequence and OR434-TRE3G promoter-mCherry coding sequence, and BB2-II plasmid with U6 promoter-crRNA coding sequence. According to the target RNA to be detected, the crRNA spacer can be designed to complement the target RNA, so that the level of the target RNA can be judged by the fluorescence intensity of mCherry.

[0111] To characterize the sensor, Gluc was used as the target sequence, and crRNA (Gluc) for the target sequence was designed (for Gluc 178-208bp). To heterologously express Gluc, the CMV promoter-Gluc sequence was inserted downstream of the U6 promoter-crRNA (Gluc) sequence of the BB2-II plasmid to construct the BB2-III plasmid. For the experimental group, the BB1-I plasmid, BB1-II plasmid, BB2-I plasmid, and the BB2-III plasmid with the U6 promoter-crRNA (Gluc) sequence and the CMV promoter-Gluc sequence were co-transfected into the human embryonic kidney cell line HEK293T. In the control group, the BB2-III plasmid was a U6 promoter-crRNA (Gluc) sequence and a CMV promoter-Gluc (mut) sequence. The Gluc (mut) sequence is a Gluc sequence with bases 177-208 deleted. The cells in the experimental group (Target RNA(+)) expressed Gluc, and the signal from the binding of Gluc to crRNA(Gluc) activated the expression of mCherry through the sensor system. In the control group (Target RNA(-)), Gluc(mut) did not complementarily pair with crRNA(Gluc), and the DiCas7-11 protein / Csx29 protein / crRNA ternary complex was not activated. Quantitatively, the fluorescence intensity of the experimental group was 12.1 times that of the control group ( Figure 2 b). Collect at least 10,000 Target RNA(+) and Target RNA(-) cells for flow cytometry analysis. It can be found that the fluorescence distribution of the Target RNA(+) cell population is clearly distinguishable from that of the Target RNA(-) cells ( Figure 2 c), indicating that the sensor has excellent switching performance and low background in the detection of target RNA in mammalian cells.

[0112] 2. Optimization of DiCas7-11 Protein

[0113] It is known in the art that DiCas7-11 protein / Csx29 protein / crRNA binds to the target RNA to form a quaternary complex, which will activate the activity of the Csx29 protease. However, once the target RNA is degraded by the DiCas7-11 protein, the protease activity of Csx29 will be inhibited. Based on this, we speculate that replacing the wild-type DiCas7-11 with a mutant DiCas7-11 that loses ribonuclease activity may make the protease activity of Csx29 in the complex more persistent. To verify this hypothesis, we constructed the D429A / D654A mutant DiCas7-11 (mut) of DiCas7-11 and designed corresponding crRNAs for a variety of endogenous or exogenous target genes. Among them, for the target gene Gluc expressed by the plasmid, we designed 6 crRNAs for its different positions: Gluc crRNA (i.e. crRNA (Gluc), complementary pairing with Gluc 178-208bp), Gluc crRNA3 (complementary pairing with Gluc 63-93bp), Gluc crRNA7 (complementary pairing with Gluc 187-217bp), Gluc crRNA10 (complementary pairing with Gluc 280-310bp), Gluc crRNA13 (complementary pairing with Gluc 373-403bp), and Gluc crRNA16 (complementary pairing with Gluc 466-496bp). In addition, we also designed corresponding crRNAs for the endogenous genes CKB (NCBI gene ID: 1152), FBL (NCBI gene ID: 2091), CANX (NCBI gene ID: 821), RAN (NCBI gene ID: 5901), HSP90AB1 (NCBI gene ID: 3326), RPS16 (NCBI gene ID: 6217), RPS18 (NCBI gene ID: 6222), and GADPH (NCBI gene ID: 2597) of HEK293T (Table 1). The BB1-I plasmid with CMV promoter-DiCas7-11 coding sequence or CMV promoter-DiCas7-11 (mut) coding sequence, the BB1-II plasmid with CMV promoter-Csx29 coding sequence, the BB2-III plasmid with U6 promoter-crRNA coding sequence and CMV promoter-each target gene, the BB2-I plasmid with CMV promoter-MTS-Csx30-CI434-VP64 fusion protein coding sequence and OR434-TRE3G promoter-mCherry coding sequence was co-transfected into the human embryonic kidney cell line HEK293T. In the control group, the BB2-III plasmid had a U6 promoter-crRNA (NT) (SEQ ID NO.: 3) sequence and expressed random crRNA.The fluorescence intensity of the cells in the experimental group and the control group was measured by flow cytometry, and the ratio of the fluorescence intensity of the experimental group and the control group (ie, the fold change of crRNA (+) cells and crRNA (-) cells) was used as the sensor output. Figure 3 As shown in a, for most target RNAs, the recognition portion containing DiCas7-11(mut) will produce a higher sensor output, indicating that the sensor containing DiCas7-11(mut) has a higher signal-to-noise ratio and higher sensitivity.

[0114] The dose response curve of the sensor containing DiCas7-11 (wt) or DiCas7-11 (mut) in the recognition part can be obtained by measuring the sensor output at different substrate concentrations. BB1-I plasmid with CMV promoter-DiCas7-11 coding sequence or CMV promoter-DiCas7-11 (mut) coding sequence, BB1-II plasmid with CMV promoter-Csx29 coding sequence, BB2-III plasmid with U6 promoter-crRNA (Gluc) sequence and CMV promoter-Gluc sequence, BB2-V plasmid with CMV promoter-MTS-Csx30-CI434-VTR3 fusion protein coding sequence, BB2-IV plasmid with OR434-TRE3G promoter-mCherry coding sequence and BB2-II plasmid with U6 promoter-crRNA (Gluc) sequence were co-transfected into HEK293T cells. For the control group, the BB2-III plasmid contained the U6 promoter-crRNA (Gluc) sequence and the CMV promoter-Gluc (mut) sequence. The transfection amount of the BB2-II plasmid was controlled, and the fluorescence intensity of the experimental group and the control group was measured, and the ratio of the fluorescence intensity of the two (i.e., the fold change) was used as the sensor output. Figure 3 As shown in Figure b, when DiCas7-11 (ie, DiCas7-11(wt)) or DiCas7-11(mut) is used in the recognition part, the dynamic range of the sensor output is roughly the same. When the transfection amount of BB2-II plasmid is 0.1 ng, the sensor output (fold change) is 1.3 times; when the transfection amount of BB2-II plasmid is greater than 500 ng, the sensor output reaches saturation, which is 173 times. The Hill equation is used to fit the dose response curve, and the half-maximum effective concentration (ie, EC50 value) can be calculated. The smaller the EC50 value, the higher the sensitivity of the sensor. When DiCas7-11(wt) is used in the recognition part, the EC50 value is 279.4 ng; when DiCas7-11(mut) is used in the recognition part, the EC50 value is 14.73 ng; indicating that ribonuclease inactivation can significantly improve the sensitivity of the sensor.

[0115] In order to verify the universality of the sensor, the BB1-I plasmid with CMV promoter-DiCas7-11 (mut) coding sequence, the BB1-II plasmid with CMV promoter-Csx29 coding sequence, the BB2-III plasmid with U6 promoter-crRNA (Gluc) sequence and CMV promoter-Gluc sequence, the BB2-V plasmid with CMV promoter-MTS-Csx30-CI434-VTR3 fusion protein coding sequence, and the BB2-IV plasmid with OR434-TRE3G promoter-mCherry coding sequence were used as the primers. The following host cells were co-transfected: pancreatic cancer cell line (PANC1), gallbladder adenocarcinoma cell line (NOZ), gastric adenocarcinoma cell line (AGS), liver cancer cell line (HuH7), brain glioma cell line (HS683), endometrial cancer cell line (RL952), breast invasive ductal carcinoma cell line (T47D), colon adenocarcinoma cell line (SW48), pancreatic cancer cell line (MIAPaCa2), colorectal adenocarcinoma cell line (NCIH508), melanoma cell line (WM115), invasive breast cancer cell line (MCF7) and brain glioma cell line (SF126). In the control group, the BB2-III plasmid was a plasmid with U6 promoter-crRNA (Gluc) sequence and CMV promoter-Gluc (mut) sequence. The fluorescence intensity of the experimental group and the control group was measured by flow cytometry, and the ratio of the fluorescence intensity of the two (fold change) was used as the sensor output. Figure 3 As shown in Figure c, in different host cells, the sensor of the present invention can detect the expression of the reporter gene mCherry, and the SEM detected in each experiment is small, indicating that the system error of the sensor of the present invention is small.

[0116] In order to quantitatively evaluate the detection performance of the sensor, we selected 20 endogenous mRNAs with expression levels ranging from 1 TPM (CACNA1G) to 3104 TPM (RSP2) from HEK293T cells as target RNAs based on transcriptome data. The TPM is transcript per million. For each target RNA, 2 or 3 crRNAs targeting different positions of the target RNA were designed (Table 1). The BB1-I plasmid with CMV promoter-DiCas7-11 (wt) coding sequence, the BB1-II plasmid with CMV promoter-Csx29 coding sequence, the BB2-II plasmid with U6 promoter-each crRNA coding sequence, the BB2-I plasmid with CMV promoter-MTS-Csx30-CI434-VP64 fusion protein coding sequence and the OR434-TRE3G promoter-mCherry coding sequence were co-transfected into the human embryonic kidney cell line HEK293T; in the control group, the BB2-II plasmid carried U6 promoter-crRNA (NT) to express non-targeted crRNA. The fluorescence intensity of the experimental group and the control group was measured by flow cytometry, and the ratio of the fluorescence intensity of the two (fold change) was used as the sensor output. Figure 3 As shown in Figure d, the sensor has very high sensitivity to endogenous mRNAs with different expression intensities. The sensor output conforms to the sigmoid function in double logarithmic coordinates as the target mRNA expression level changes. For target RNAs with higher expression levels, the sensor output can reach about 80 times. Even when the expression level of the target mRNA is only 8TPM (KTI12), a 1.5-fold change can still be detected. These results show that the sensor of the present invention has great potential in identifying cell types and states, biosensing, drug screening, and intracellular RNA imaging.

[0117] 3. Synergistic effect when detecting target sequences containing point mutations

[0118] Gene mutations and abnormal RNA expression are important causes of cancer, neurological diseases, etc. In fact, point mutations or single nucleotide variants (SNVs) can cause cancer. Due to cellular heterogeneity, it is often necessary to detect point mutations at the single-cell level and formulate treatment plans based on the test results. However, since the difference between sequences carrying mutations (especially point mutations) and wild sequences is extremely small, the sensor needs to have extremely high specificity to distinguish the target RNA carrying SNV from the wild-type sequence. How to detect changes in only one base on the target RNA is still a difficult problem facing this field.

[0119] In order to explore the design space of the sensor of the present invention in terms of specificity, we studied the changes in sensor output when the mutation site to be detected was set at different positions in the crRNA spacer based on the constructed Gluc detection system. Specifically, for crRNA (Gluc), point mutation recognition sites were introduced one by one from the 1st position (+1 position) to the 31st position (+31 position) in the spacer, so that the crRNA of the sensor does not pair with the wild-type Gluc at the point mutation recognition site; but pairs with the target sequence after base transition (transition) at the point mutation recognition site ( Figure 4 a). In this way, the sequence containing specific point mutations can be distinguished from the proto-oncogene sequence in application scenarios such as cancer detection. For the Gluc detection system, as mentioned above, the 178-208th position of the Gluc sequence is completely complementary to the crRNA (Gluc) spacer. Take the point mutation recognition site located at the +1 position of crRNA as an example ( Figure 4 b), when the target sequence is a Gluc sequence with a conversion (A→T) at position 208, the +1 position of the crRNA(Gluc)-1 sequence that is completely complementary to the target sequence is A, and the 2nd to 31st positions of the spacer are exactly the same as the crRNA(Gluc). In other words, the crRNA in the sensor is completely complementary to the target sequence, but not paired with the wild-type sequence at the point mutation recognition site. Similarly, when the target sequence is a Gluc sequence with a conversion (C→G) at position 207, the 2nd position of the crRNA(Gluc)-2 sequence that is completely complementary to the target sequence is C, and the 1st and 3rd to 31st positions of the spacer are exactly the same as the crRNA(Gluc). crRNA(Gluc)-2 is completely complementary to the target sequence, but not paired with the wild-type sequence at the point mutation recognition site.

[0120] HEK293T cells were co-transfected with BB1-I plasmids with CMV promoter-DiCas7-11 (mut) coding sequence, BB1-II plasmids with CMV promoter-Csx29 coding sequence, BB2-III plasmids with U6 promoter-crRNA coding sequence and CMV promoter-target sequence, BB2-V plasmids with CMV promoter-MTS-Csx30-CI434-VP64 fusion protein coding sequence, and BB2-IV plasmids with OR434-TRE3G promoter-mCherry coding sequence to detect target RNA with mutations at different positions. In the control group, BB2-III plasmids carried U6 promoter-crRNA coding sequence and CMV promoter-wild-type Gluc coding sequence. The fluorescence intensity of host cells in the experimental group and the control group was measured by flow cytometry, and the fluorescence intensity value ratio (fold change) of the experimental group and the control group was used as the output of the sensor. Although existing studies have shown that complete pairing of the detected RNA with the crRNA spacer at positions +1 to +12 is essential for the activation of Csx29 [6] , however, Figure 4 As shown in Figure b, when the point mutation recognition site is set at the 2nd, 3rd, 5th, 7th, 9th or 21st position of the crRNA spacer, the sensor output is greater; that is, compared with the target sequence, the fluorescence intensity reduction caused by the wild-type Gluc sequence is more obvious, which indicates that the complementary pairing of crRNA and the sequence to be detected at the above site is more important for activating Csx29. Among them, when the point mutation recognition site is at the 21st position of the crRNA spacer, the fluorescence intensity reduction caused by a single base mismatch is 2.5 times. Further experiments have shown that the specificity of the sensor can be improved when the point mutation recognition site is located at positions 21-23 of the crRNA spacer. Existing studies have shown that these positions are located in the 3' seed region of crRNA and may be involved in the regulation of RNA cleavage activity by the DiCas7-11 / Csx29 / crRNA complex.

[10] .

[0121] Considering that the fluorescence intensity fold change caused by a single position mismatch is low, we tried to introduce auxiliary sites at other positions so that the crRNA mismatches with both the target sequence and the wild-type sequence at the auxiliary sites, thereby further improving the signal-to-noise ratio of the sensor. Figure 4As shown in c, on the basis of setting the 21st position of the crRNA spacer region as the point mutation recognition site (the target sequence is the wild-type Gluc sequence with an A→T transition at position 188), we introduced auxiliary sites one by one at positions 1-20 and 22-31 of crRNA (Gluc)-21, so that the sequence at the auxiliary site undergoes base conversion, so that the crRNA at this position cannot complementarily pair with the target sequence and the wild-type sequence ( Figure 4 c schematic diagram). For example, when position 1 is set as an auxiliary site, compared with crRNA (Gluc), crRNA (Gluc) -21-1 contains a T→A transition at position 1 in addition to a T→A transition at position 21; thus, crRNA (Gluc) -21-1 mismatches with the wild-type Gluc sequence at positions 188 and 208; and mismatches with the target sequence only at position 188.

[0122] In with Figure 4 b. Flow cytometry detection was performed under the same Gluc detection system (only crRNA was added to the auxiliary site), and the ratio of the fluorescence intensity of the target RNA sequence to the wild-type sequence (fold change) was used as the sensor output. Figure 4 As shown in Figure c, when the auxiliary site is located at position 17 or 18, the fold change can be increased to 4 times, indicating that the introduction of auxiliary sites in the crRNA helix pairing region (positions 14-31 of the crRNA spacer region) can improve the specificity of the sensor for point mutation detection.

[0123] In order to study whether the introduction of auxiliary sites in the parallel pairing region (positions 1-13 of the crRNA spacer) can also improve the specificity of detection, we set the point mutation recognition site to be located at position 3 of the spacer (i.e., the target sequence is a wild-type Gluc sequence with a G→C transition at position 206), and set auxiliary sites for single-base transitions at other positions of the crRNA one by one. For example, compared with crRNA (Gluc), crRNA (Gluc) -3-1 contains a T→A transition at position 1 in addition to a C→G transition at position 3; thus, crRNA (Gluc) -3-1 cannot complementarily pair with the wild-type Gluc sequence at positions 206 and 208; and it does not complementarily pair with the target sequence (mutant sequence) only at position 206.

[0124] In with Figure 4 c) was used for flow cytometry detection under a Gluc detection system similar to that of Figure 3 (only crRNA and target RNA were different), and the ratio of the fluorescence intensity when the sequence to be detected was the target RNA sequence and when the target to be detected was the wild-type sequence (fold change) was used as the sensor output. Figure 4As shown in Figure d, when the point mutation recognition site is located at position 3 of the crRNA spacer, the introduction of auxiliary sites at positions 1, 2, 5, 6, 7, 8, 9, 11, 12 or 13 can significantly increase the fold change, while the contribution of positions 4, 10 or 14 as auxiliary sites to the fold change is low. Based on this, we divided the crRNA spacer into four sub-regions, the first sub-region is positions 1-3; the second sub-region is positions 5-9; the third sub-region is positions 11-13; and the fourth sub-region is positions 15-31.

[0125] In further studies, we replaced the weak activation domain VP64 in the signal processing protein with the strong activation domain VTR3. Compared with the use of VP64 as the transcriptional activation domain, the sensor output (fold change) when the strong activation domain is used and the auxiliary site is located in the first sub-region, the second sub-region and the third sub-region is significantly improved. In particular, when the auxiliary site is located at the 7th or 9th position of the second sub-region, the fold change is as high as 30-40 times, indicating that when the point mutation recognition site is located at the 3rd position, the synergistic effect of the point mutation recognition site and the auxiliary site located in the first sub-region to the third sub-region is amplified, and the above phenomenon is almost non-existent when the auxiliary site is located in the fourth sub-region, indicating that for the protease activity of Csx29, the synergistic effect of crRNA and the RNA to be detected in the base complementarity of the first sub-region and the fourth sub-region of crRNA is weak.

[0126] The biological significance of our partitioning can also be explained by the cryo-EM structure analysis of the DiCas7-11 / crRNA complex: the 15-base handle region (-15U to -1C) at the 5' end of the crRNA is tightly bound to the Cas7.1 and Cas7.2 domains of the DiCas7-11 protein; while the 23-base spacer is recognized by the Cas7.2-Cas7.4 domain. In the natural state, except for the +4 and +10 positions, the crRNA spacer hybridizes with the tgRNA to form a guide RNA-target RNA dimer in the tgRNA binding region. The reason is that the Cas7.1, Cas7.2, Cas7.3, and Cas7.4 domains contain RRM motifs (β1α1β2β3α2β4 topological structure), and the β2β3 thumb-like hairpin structure of Cas7.1 / 7.2 / 7.3 extends outward and inserts into the adjacent domain, causing the bases at positions -3 (handle region), +4, and +10 of the crRNA to flip out from the outside of the backbone, and the crRNA at positions +4 and +10 is not paired with the tgRNA ( Figure 4d schematic diagram). Therefore, the combination of the point mutation recognition site and the auxiliary site at position 4 or 10 is an ineffective combination for Cas protein activity. For position +14, since the RRM motif of the Cas7.4 domain is significantly different from that of Cas7.1 / 7.2 / 7.3, β2β3 is not a thumb-like hairpin structure, but forms a lasso structure to wrap crRNA positions 13-14. [9] .

[0127] The above results indicate that there is a synergistic effect between the base pairing of the point mutation recognition site and the auxiliary site in a specific region, and this synergistic effect will significantly affect the activity of the DiCas7-11 / crRNA / Csx29 complex. In order to systematically study this synergistic effect, we conducted experiments on various combinations of point mutation recognition site-auxiliary site positions based on the Gluc detection system. Figure 4 c- Figure 4 d. When the point mutation recognition site is located in the first subregion, the auxiliary sites located in the second and third subregions show strong synergy; and when the point mutation is located in the fourth subregion, the auxiliary site also located in the fourth subregion will show strong synergy.

[0128] We systematically measured the sensor fluorescence intensity under all position combinations from the first to the third sub-regions and some position combinations before position 23 in the fourth sub-region. First, HEK293T cells were co-transfected with BB1-I plasmids with CMV promoter-DiCas7-11 (mut) coding sequence, BB1-II plasmids with CMV promoter-Csx29 coding sequence, BB2-III plasmids with CMV promoter-Gluc coding sequence and U6 promoter-each crRNA, BB2-V plasmids with CMV promoter-MTS-Csx30-CI434-VP64 fusion protein coding sequence, and BB2-IV plasmids with OR434-TRE3G promoter-mCherry coding sequence; among them, crRNA had point mutation recognition sites or different point mutation recognition site / auxiliary site combinations. The fluorescence intensity of the host cell when the crRNA in the sensor is crRNA (Gluc) and the sequence to be detected is Gluc (i.e., there is no mismatch site) is set to 100%, and the fluorescence intensity of the host cell in each experiment is normalized using the fluorescence intensity under the complete pairing condition. The relative fluorescence intensity is obtained. Figure 4 Displayed in g. Figure 4The diagonal line of g shows the case where the sensor crRNA contains only point mutation recognition sites. It can be seen that the mismatch of a single site has little effect on the fluorescence intensity of the sensor (darker color); while there are two mismatch sites between crRNA and the RNA to be detected (non-diagonal area) in the first sub-area, most combinations of the second sub-area, and some combinations of the third sub-area all lead to a significant decrease in relative fluorescence intensity (lighter color), indicating that the mismatch of the above site combination has a greater impact on the protease activity of DiCas7-11 / crRNA / Csx29, and the above site combination has the potential to serve as a point mutation recognition site-auxiliary site.

[0129] Given that in actual clinical application scenarios, it is necessary to distinguish between sequences containing SNVs and wild-type sequences, we calculated Figure 4 The value of each point in g is divided by the value at the focus of the row and diagonal line where the point is located. The reciprocal of the calculated value shows the multiple change of the sensor fluorescence intensity when the target RNA is used as the sequence to be detected compared with the wild-type RNA as the sequence to be detected under the specific point mutation recognition site-auxiliary site combination. Figure 4 h. This figure directly shows the effect of the point mutation recognition site-auxiliary site combination on the specificity of the sensor. The darker the color, the stronger the synergistic effect of the two sites. Figure 4 As shown in Figure 3, by setting the point mutation recognition site-auxiliary site at the following position combinations, the signal-to-noise ratio of the sensor can be significantly improved: +3 position / +7 position, +7 position / +3 position, +3 position / +9 position, +9 position / +3 position, +3 position / +5 position, +5 position / +3 position, +2 position / +7 position, +7 position / +2 position, +2 position / +5 position, +5 position / +2 position. Among them, even in the case of using the weak activation domain VP64, the combination of +3 position / +7 position and +3 position / +9 position can increase the fold change to 10 times. In subsequent studies, unless otherwise specified, we set the point mutation recognition site and auxiliary site at +3 position and +7 position, respectively.

[0130] from Figure 4 g and Figure 4 h, it can be seen that the relative fluorescence intensity and fold change trends with site combinations are not the same. For example, when the point mutation site / auxiliary site is set to +21 / +3, although the mismatch between the two sites on the crRNA and the RNA to be detected causes a significant decrease in the relative fluorescence intensity, according to Figure 4From the g diagonal data, it can be seen that the decrease in fluorescence intensity is largely attributed to the mismatch at position +21, so the additional mismatch at position +3 does not contribute much to the signal-to-noise ratio, so the fold change is not large under this design, indicating that the recognition specificity of this site combination for point mutations is relatively poor. In addition, although existing studies have shown that complete pairing from position +1 to position +12 is crucial for the binding of crRNA to tgRNA [9] However, the mismatches at positions 11, 12, and 13 had little effect on the activity of DiCas7-11 / crRNA / Csx29, whether from the relative fluorescence intensity or the fold change. As for the fourth subregion, although this subregion belongs to the crRNA seed region, our experimental results show that only the mismatch between the crRNA near position +21 and the RNA to be detected has a greater effect on the activity of DiCas7-11 / crRNA / Csx29, and the specificity of the sensor containing only the point mutation recognition site designed based on this mismatch is lower than that of the sensor containing the point mutation recognition site-auxiliary site in the first, second, or third subregions of crRNA.

[0131] In summary, we can design the point mutation of the sequence we want to detect as a point mutation recognition site located at the crRNA for a point mutation site-auxiliary site combination with a synergistic effect, and set an auxiliary site at a specific position of the crRNA to achieve RNA detection with single-base resolution.

[0132] In addition to using Gluc as the target sequence, we also used different cancer driver genes as detection targets to test the general applicability of the sensor. First, we selected seven common pathogenic point mutations in four proto-oncogenes: KRAS c.35G>T (G12V) mutation, c.35G>A (G12D) mutation, c.182A>G (Q61R) mutation

[13] TP53 c.742C>T(R248W) mutation, c.818G>A(R273H) mutation

[14] ; BRAF c.1799T>A(V600D) mutation

[15] ; and c.3145G>C(G1049R) mutation of PIK3CA

[16] The above mutations are common mutations in human pancreatic cancer, bladder epithelial cancer, melanoma and breast cancer (Table 2). The cancer driver gene is used as the sequence to be detected, and 4 types of crRNA are used as crRNA in the sensor: crRNA that is completely paired with the sequence to be detected; crRNA that is not paired with the sequence to be detected at position +3 (completely matching the proto-oncogene); crRNA that is not paired with the sequence to be detected at positions +3 and +7; and crRNA with a random sequence (NT). The above crRNAs have no mismatch sites, a single mismatch site, two mismatch sites, and a complete mismatch with the sequence to be detected.

[0133] For each target sequence, HEK293T cells were co-transfected with BB1-I plasmid with CMV promoter-DiCas7-11 (mut) coding sequence, BB1-II plasmid with CMV promoter-Csx29 coding sequence, BB2-III plasmid with CMV promoter-sequence to be detected and U6 promoter-crRNA coding sequence, BB2-V plasmid with CMV promoter-MTS-Csx30-CI434-VTR3 fusion protein coding sequence, and BB2-IV plasmid with OR434-TRE3G promoter-mCherry coding sequence. The ratio (fold change) of the fluorescence intensity of the host cells under each configuration to the fluorescence intensity of the host cells when crRNA is crRNA (NT) was used as the sensor output.

[0134] like Figure 4 f, for 8 target sequences, when the number of mismatch sites increases from 0 (matched) to 1 (point-mutated), the change in sensor output does not exceed 2.2 times; when the number of mismatch sites increases from 2 (dual-mutated) to 31, the sensor output is almost unchanged; and when the number of mismatch sites increases from 1 to 2, the sensor output can produce a 10-38-fold change. The above results show that in terms of identifying point mutations in sequences, the best setting is: for sequences to be detected that contain / do not contain point mutations, they and the sensor crRNA sequence should have 1 and 2 mismatch sites, respectively, so that the signal intensity generated when the sequence to be detected contains / does not contain point mutations is the highest. The results confirm the synergistic effect of crRNA+3 and +7 complementarity, and the effective identification of cancer driver genes by sensors containing the crRNA. Therefore, normal cells and tumor cells can be distinguished by means of the sensor of the present invention, and this distinction is necessary for precision treatment.

[0135] 4 Further optimization of sensors

[0136] First, we selected two of the most commonly used cell membrane localization motifs (PM-locating motif or PM-targeting motif) [19-20] Based on the Gluc detection system, the effect of the cell membrane localization motif located at the C-terminus or N-terminus of the fusion protein on the sensor output was tested. Figure 2 b, using DiCas7-11 / Csx29 / crRNA (Gluc) as the recognition element, N'-[N-MTS]-Csx30-CI434-VP64-C' or N'-CI434-VP64-Csx30-[C-MTS]-C' as the signal processing protein, the reporter gene is mCherry, the inducible promoter driving the expression of mCherry contains a pair of OR434 operator sites, and the target gene is Gluc. Among them, N'-[N-MTS]-Csx30-CI434-VP64-C' is obtained by operably linking the N-MTS cell membrane localization motif to the N-terminus of Csx30-CI434-VP64; N'-CI434-VP64-Csx30-[C-MTS]-C' is obtained by operably linking the C-MTS cell membrane localization motif to the C-terminus of CI434-VP64-Csx30. In the control group, the sequence to be detected was replaced from the target gene Gluc to Gluc(mut)( Figure 5 a) crRNA(+) / target RNA(-)), or crRNA(Gluc) is replaced by random sequence crRNA(NT) ( Figure 5 a) crRNA(-) / target RNA(+)). Compared with the control in which the host cell does not express the target gene or expresses non-target crRNA, the sensor can produce twice the fluorescence intensity of the control when the cell membrane localization motif is located at the C-terminus of the signal processing protein; and it can produce 7 times the fluorescence intensity of the control when the cell membrane localization motif is located at the N-terminus of the signal processing protein. In addition, we found that under the premise that the cell membrane localization motif is N-MTS, the transcription activation domain located at the C-terminus of the regulatory domain can more effectively bind to the operator site and activate the reporter gene. The possible reason is that when the transcription activation domain (such as VP64) is located at the N-terminus of the regulatory domain, after Csx29 cuts Csx30, the N-terminus of the chimeric allosteric transcription regulatory domain also carries some residues of the C-terminus of Csx30, so that the Csx30 residues at the N-terminus of the transcription activation domain and the transcription regulatory domain CI434 will cause greater steric hindrance to the binding of the transcription activation domain to the operator site, affecting the transmission of the sensor signal from the signal processing protein to mCherry. Therefore, unless otherwise specified, all signal processing proteins in the embodiments of the present invention adopt the design of N'-MTS-Csx30-transcriptional regulatory domain-transcriptional activation domain-C', and the MTS is N-MTS.

[0137] We then optimized the domains in the fusion protein. Figure 4 As shown in Figure d, replacing a weak activation domain (e.g., VP64) with a strong activation domain (e.g., VTR3) can significantly increase the sensor output signal. Figure 4 d's Gluc detection system uses DiCas7-11(mut) / Csx29 / crRNA(Gluc)-3-7 as the recognition element, N'-MTS-Csx30-CI434-each transcription activation domain-C' as the signal processing protein, the reporter gene is mCherry, the inducible promoter driving the expression of mCherry contains a pair of OR434 operator sites, and the target gene is a Gluc sequence with a G→C transition at position 206. In the experimental group, the host cells expressed the target RNA; in the control group, the host cells expressed the wild-type Gluc sequence. The ratio of the fluorescence intensity of the host cells in the experimental group and the control group (fold change) was used as the sensor output. Figure 5 As shown in Figure b, replacing VP64 with a stronger transcriptional activation domain VP64-P65, P65-Rta, VTR3 or VRP can achieve a higher fold change, indicating that a stronger transcriptional activation domain has a better amplification effect on the binding signal of crRNA to the RNA to be detected. Among the tested transcriptional activation domains, VRP can achieve the highest fold change (about 40 times), which we will use for subsequent cancer cell treatment experiments.

[0138] Considering that in the prokaryotic transcription regulation system, the synergistic effect of transcription factors can be achieved by adding operator sites to make the transcription factors multimerize, thereby reducing the background expression of the inducible promoter, we adjusted the number of operator sites in the output gene expression cassette in the sensor and observed its effect on the sensor output. The Gluc detection system used is similar to Figure 5 b, using DiCas7-11(mut) / Csx29 / crRNA(Gluc)-3-7 as the recognition element, N'-MTS-Csx30-CI434-VP64-C' as the signal processing protein, the reporter gene is mCherry, and the inducible promoter driving mCherry expression contains 1 pair (2XTFBS), 3 pairs (6XTFBS) or 4 pairs of OR434 operator sites (8XTFBS). Figure 5 As shown in Figure c, as the number of transcription factor binding sites increases, the sensor output reaches saturation. The optimal number of transcription factor binding sites is 3 pairs, which we used in subsequent cancer cell treatment experiments.

[0139] In vitro experiments showed that the Cas7-11 / crRNA / Csx29 complex can cleave Csx30 into two fragments: the N-terminal fragment is about 50KD and the C-terminal fragment is about 15KD. The cleavage site is located at amino acids 427 / 428 of Csx30.

[18] Based on this, we speculate that signal processing proteins may not need to use the full-length wild-type Csx30 to achieve signal transmission. Figure 5 b Gluc detection system, using DiCas7-11 (mut) / Csx29 / crRNA (Gluc) -3-7 as the recognition element, N'-MTS-each Csx30 fragment-CI434-VP64-C' as the signal processing protein, the reporter gene is mCherry, and the target gene is a Gluc sequence with a G→C transition at position 206. In the experimental group, the host cells expressed the target gene; in the control group, the host cells expressed the wild-type Gluc sequence. The ratio of the fluorescence intensity of the host cells in the experimental group and the control group (fold change) was used as the sensor output. Figure 5 As shown in Figure d, the C-terminal truncated fragment of Csx30 can improve the output of the sensor compared with the full-length Csx30. This may be because the shorter Csx30 fragment makes it easier for the cleavage site to be exposed to the outside rather than encapsulated in the fusion protein without interfering with the recognition of Csx30 by Csx29.

[0140] Furthermore, in order to study the background signal intensity of the sensor under different Csx30 fragments, host cells expressing Gluc (mut) were used as the control group of the sequence to be detected, and the ratio of the fluorescence intensity of the host cells in the experimental group and the control group (fold change) was used as the sensor output. The lower the fold change, the higher the background signal under this sensor setting. Figure 5 As shown in d, when only amino acids 427-565 of Csx30 are included, the fold change is significantly reduced, indicating that the binding signal of crRNA and the RNA to be detected is difficult to be transmitted to the downstream output protein. According to previous studies, the cleavage of Csx30 by Csx29 should be located at position 428 of Csx30, so the truncated fragment of Csx30 containing only amino acids 427-565 interferes with the cleavage of Csx30 by Csx29. In comparison, the truncated fragment containing amino acids 407-565 of Csx30 almost retains the function of the full-length Csx30, indicating that the Csx30 fragment that can be used in the present invention may contain only amino acids 407-565 of Csx30, or longer. In addition, we studied the recognition of point mutations using truncated Csx30. Using a similar Figure 5 d, the experimental group expressed the Gluc sequence with a G→C transition at position 206, the control group expressed the wild-type Gluc sequence, and the crRNA was crRNA (Gluc)-3-7. Figure 5 As shown in Figure e, compared with the wild-type Csx30, the truncated fragment Csx30(276-565) containing amino acids 276-565 of Csx30 or the truncated fragment Csx30(366-565) containing amino acids 366-565 of Csx30 can achieve better point mutation recognition effect.

[0141] It has been reported in the art that a protease cleavage site is added to a fluorescent protein, and a dihydrofolate reductase (DHFR) degradation factor Degron is connected to one end of the fluorescent protein, and a reporter is connected to the other end of the fluorescent protein. Since trimethoprim (TMP) can stabilize the stabilizing effect of the DHFR degradation factor, more complex logic gates can be constructed in this way. The inventors found that after the signal processing protein is translated and transported to the cell membrane, it is still possible to bind to the inducible promoter in the output gene expression cassette, resulting in leakage of the output protein, thereby generating a background signal of the sensor. Therefore, we use a similar Figure 5 In the system of b, the DHFR degradation factor is added to the N-terminus of Csx30, so that DHFR can cut the signal processing protein that is not localized to the cell membrane, reducing the background expression of the output protein. On the other hand, after the crRNA and tgRNA complementarily bind to activate Csx29 and cut Csx30, the allosteric transcription factor is separated from the N-terminus of the signal processing protein and cannot be cut by DHFR, so it can still activate the expression of the output protein. Figure 5 As shown in f-5g, after adding the DHFR degradation factor, the total concentration of the signal processing protein decreased, resulting in a decrease in the fluorescence signal of both the experimental group and the control group. However, this method can increase the multiple change of the sensor output and still improve the signal-to-noise ratio of the sensor. On the other hand, if the DHFR degradation factor is added to the C-terminus of the signal processing protein, DHFR will be able to simultaneously degrade the full-length signal processing protein that is not localized to the cell membrane and the cleaved Csx30(428-565)-CI434-VP64, so that the allosteric transcription factor will not be able to activate the expression of downstream output proteins ( Figure 5 f).

[0142] Based on the effect of adding a DHFR degradation factor, we speculated that reducing the amount of signal-processing proteins by other means might also improve the sensor's signal-to-noise ratio. Figure 5 b) Sensor settings, and the transfection amount of BB2-V plasmid (signal processing protein expression plasmid) was optimized. Figure 5 As shown in h, the sensor output can be increased by about 8 times by reducing the transfection amount of BB2-V plasmid from 250 ng to 50 ng.

[0143] Finally, we combine the results of the above single variable optimization. Figure 5As shown in Figure 1, by using the strongest transcription activation domain VPR and the optimal signal processing protein transfection concentration, a 94-fold change can be achieved. This output is sufficient to detect a single base difference.

[0144] 5. Identification and treatment of tumor cells

[0145] It is generally believed that cancer is abnormal and uncontrolled cell growth caused by specific gene mutations. These mutations are called "drivers" because they drive tumorigenesis, giving mutant cells a selective advantage over nearby normal cells. Genes containing the above mutations are called cancer driver genes. The main goals of cancer research include discovering cancer driver genes present in various tumors, so as to implement targeted treatment for such genes. In order to study the clinical practicality of the sensor of the present invention, we selected TP53 containing R273H mutation and TP53 containing Y220C mutation as target genes. The above cancer driver genes are involved in the onset and development of pancreatic cancer, liver cancer, lung cancer and colorectal cancer. Since the above cancer driver genes lack CCA sites, they are difficult to detect using existing ADAR sensors. In addition, due to the lack of surface antigens, it is difficult to kill cancer cells with specific mutations.

[0146] First, we used DiCas7-11(mut) / Csx29 / crRNA as the recognition element, MTS-Csx30-CI434-VPR fusion protein as the signal processing protein (plasmid transfection amount was 50ng), mCherry as the output protein, and TP53 c.818G>A in the pancreatic cancer cell line PANC1 as the target sequence. DiCas7-11(mut) / Csx29 / crRNA was used as the recognition element, MTS-Csx30-CI434-VPR fusion protein was used as the signal processing protein, mCherry as the output protein, and the TP53 c.659A>G sequence in the liver cancer cell line HuH7 was used as the target sequence. The crRNA in the experimental group was a crRNA targeting the cancer driver gene and mismatched at the 7th position of the spacer region; the crRNA in the control group was a crRNA targeting the wild type (mismatched with the cancer driver gene at the 3rd and 7th positions of the crRNA spacer region) and a random sequence crRNA (NT) (Table 2). Figure 6 As shown in a-6b, the fluorescence intensity of the host cells is significantly different when using crRNA targeting the target sequence (crRNA for mutant) and crRNA targeting the proto-oncogene (crRNA for wild type), indicating that the sensor of the present invention can effectively detect cancer driver genes containing point mutations.

[0147] We then replaced the reporter gene mCherry with the herpes simplex virus thymidine kinase (HSV-tk) coding sequence. HSV-tk is a suicide gene commonly used in tumor gene therapy research, which can convert some non-toxic or low-toxic precursors into strong cytotoxic substances to kill tumor cells. According to our design, if the host cell has a cancer driver gene, the binding of its transcribed RNA to the sensor crRNA will activate the cleavage activity of Csx29 in the DiCas7-11 / Csx29 / crRNA complex, thereby releasing CI434-VPR from the signal processing protein MTS-Csx30-CI434-VPR. This chimeric allosteric transcription factor activates the expression of HSV-tk and induces host cell apoptosis. If the host cell is a normal cell, the binding of the RNA transcribed by the proto-oncogene to the sensor crRNA cannot trigger the cleavage activity of Csx29 and will not cause cell apoptosis. In this way, tumor cells can be effectively identified and killed, especially tumor cells that lack specific surface antigens can be identified and processed. In the experiment, we used HEK293T as a control and used CCK8

[11] The kit was used to evaluate the cell viability 48 hours after transfection. Figure 6 As shown in Figure c, when non-targeted crRNA (NT) was used as the sensor crRNA, none of the three host cells had the corresponding target gene, so the cells did not show obvious apoptosis. When the sensor used crRNA targeting TP53 Y220C, the target sequence was TP53c.659A>G, and the HuH9 host cells showed obvious apoptosis, while HEK293T and PANC1 did not have this mutation, and the host cells did not apoptosis. Similarly, when the sensor used crRNA targeting TP53 R273H, the target sequence was TP53 c.818G>A, and the PANC1 host cells showed obvious apoptosis, while HEK293T and HuH7 did not show apoptosis because they did not have this mutation. In addition, compared with the host cells with a single mismatch crRNA in the recognition part ( Figure 6 Compared with point-mutation CASP in d, the double-mismatched crRNA ( Figure 6 d) caused a higher relative death rate of target cells and lower killing of non-target cells, indicating its better recognition effect.

[0148] The above results indicate that the sensor of the present invention can accurately distinguish cells with point mutation types from normal cells and eliminate pathological cells in a targeted manner, which is beneficial in tumor treatment in the absence of available targeted drugs.

[0149] 6 Dynamic monitoring of changes in cell state during cell differentiation and transdifferentiation

[0150] During cell differentiation and transdifferentiation, the dynamic changes of RNAomic features play a key role in distinguishing closely related cell states / types. Monitoring cell differentiation and transdifferentiation processes through RNA-based sensor-response circuits can provide constructive guidance for manipulating cell fate. In the experiment, we monitored the adipogenic differentiation of mesenchymal stem cells (MSCs) and the epithelial-mesenchymal transition (EMT) of keratinocytes (HaCat) ( Figure 6 d, i), demonstrating that the sensor of the present invention has the ability to monitor cell differentiation and transdifferentiation processes.

[0151] Mesenchymal stem cells can differentiate into adipocytes under specific induction medium ( Figure 6 d), whose differentiation potential is of great significance for stem cell therapy. Figure 5 h sensor, wherein the recognition part is crRNA (SEQ ID NO.: 61-69) for adipocyte-related genes Adipoq, Fabp4 and PPARG. The sensor system was transfected into mesenchymal stem cells. By culturing in a medium that induces adipocyte differentiation, it can be observed that the cells express red fluorescence ( Figure 6 e-8f). RT-PCR analysis also confirmed the upregulation of Adipoq, Fabp4 and PPARG expression ( Figure 6 g). These results indicate that adipogenic differentiation is closely related to the upregulation of Adipoq, Fabp4 and PPARG, and the sensor of the present invention can dynamically monitor the process ( Figure 6 h).

[0152] The EMT process of HaCat plays a key role in wound healing, skin regeneration, and tumor invasion and metastasis. Figure 5 h sensor, the crRNA is directed against fibronectin or vimentin (SEQ ID NO.: 70-81). Figure 6 As shown in Figure 1, after induction with TGFβ in vitro, changes in cell morphology were observed, and the expression of mCherry was activated under the fluorescence field. RT-PCR analysis found that the expression of fibronectin and vimentin was upregulated ( Figure 6 k), indicating that the increased transcription of fibronectin and vimentin is correlated with changes in cell status, and the sensor of the present invention can dynamically monitor this process ( Figure 6 l).

[0153] These examples demonstrate the potential of sensors to effectively sense and respond to transcriptional changes in cell types and states, providing valuable tools for monitoring cellular differentiation and transdifferentiation processes.

[0154] 7 Discussions

[0155] With the help of the protease activity activated after the Cas7-11 / crRNA / Csx29 complex binds to the target RNA, the output protein is activated by releasing the allosteric transcription factor domain in the signal processing protein, converting the information of whether the target RNA exists into an output protein signal, and activating functional proteins based on the binding of the target RNA to crRNA, thereby achieving RNA-dependent regulation of the host cell.

[0156] Furthermore, we found that specific sites in the parallel pairing region of the crRNA spacer (positions 1 to 13) showed synergy in binding to the target RNA. The seed region (positions 18-23) did not show this feature. This finding is consistent with the conclusions of the structural analysis of the DiCas7-11 / Csx29 / crRNA / tgRNA complex, explaining the biological rationality of binding synergy. By setting one of the synergistic sites as a point mutation recognition site and the other as an auxiliary site, the signal output of the sensor in single-base mutation detection can be increased by 94 times.

[0157] In exemplary applications, we demonstrated the application of sensors in mammalian cell state monitoring and fate regulation. In terms of RNA-dependent expression, we also demonstrated that sensors can detect point mutations in tumor driver genes and target and kill tumor cells carrying mutations based on the results of the detection. The sensor of the present invention has great application potential in inducing cell differentiation, inducing cell apoptosis, tracking, inducing cell reverse differentiation and other situations due to its programmability, robustness and low off-target effect. In addition, the excellent point mutation detection ability of the sensor enables it to be advantageously used to type the infected virus subtypes. Accurate identification of viral subtypes enables people to fully understand their prevalence and pathogenicity, thereby formulating more effective diagnosis, treatment and prevention strategies. In general, sensors have great application potential in fields including basic biological research, epidemiology and precision medicine. Its versatility and reliability can promote the research of genetic diseases, cancers and infectious diseases caused by mutations.

[0158] 8 Materials and methods

[0159] (1) Sensor construction

[0160] All plasmids in the embodiment are constructed by standard molecular cloning methods. Utilize PrimeSTAR Max DNA polymerase (TAKARA) to amplify the DNA fragments to be inserted from plasmids, and connect (NEB) with standard Gibson assembly (New England Biolabs, NEB) and T4 to build two basic vector skeletons. Wherein, plasmid skeleton BB1 is designed to include the EGFP coding sequence driven by PGK promoter, and inserts two SapI restriction enzyme sites downstream of CMV promoter to insert gene of interest, ampicillin resistance and ColE1 replicon. Plasmid skeleton BB2 is designed to include the BFP coding sequence driven by SV40 promoter as marker gene, and includes ampicillin resistance and ColE1 replicon.

[0161] For the protein of the recognition part, by means of the Golden Gate method, the DiCas7-11 coding sequence (NCBI protein ID: WP_124327589.1), DiCas7-11 (mut) coding sequence (DiCas7-11 sequence containing D429A / D654A mutation) or Csx29 coding sequence (NCBI protein ID: WP_124327588.1) was connected to the downstream of the BB1 ​​plasmid CMV promoter using the SapI enzyme (NEB) to construct the DiCas7-11 expression plasmid, the DiCas7-11 (mut) expression plasmid and the Csx29 expression plasmid. In the embodiment, for the convenience of description, the DiCas7-11 expression plasmid or the DiCas7-11 (mut) expression plasmid is referred to as the BB1-I plasmid; the Csx29 expression plasmid is referred to as the BB1-II plasmid.

[0162] For the signal processing protein MTS-Csx30-CI434-VP64 fusion protein, the N-MTS coding sequence (SEQ ID NO.: 4), Csx30 (NCBI protein ID: WP_124329907.1), CI434 [9]And VP64 is operably connected and connected to the downstream of the CMV promoter in the BB2 plasmid backbone. For the signal processing protein CI434-VP64-Csx30-C-MTS fusion protein, the CI434, VP64, Csx30, C-MTS coding sequence (SEQ ID NO.: 5) is operably connected to the downstream of the CMV promoter using a connecting peptide. In terms of the optimization of the transcriptional activation domain, P65 (sequence see patent application 202111150967.4) is connected to the downstream of VP64 using a connecting peptide to construct a VP64-P65 transcriptional activation domain. Rta is connected to the downstream of P65 using a connecting peptide to construct a P65-Rta transcriptional activation domain. For the sequences of VP64, P65, Rta and VTR3, see Chinese patent application 202111150967.4. The sequence of VPR is SEQ ID NO.: 7. The VP64 coding sequence is replaced by the above-mentioned transcriptional activator protein coding sequence to construct a signal processing protein containing each transcriptional activator protein. The NCBI protein ID of the DHFR degradation factor Degron is WP_137511757.1. Degron was operably connected to the downstream of N-MTS and the upstream of Csx30-CI434-VP64 using a connecting peptide to construct a signal processing protein containing Degron. In the examples, for the convenience of description, the signal processing protein expression plasmid is referred to as BB2-V plasmid. For truncated Csx30, the NCBI protein ID: WP_124329907.1 full-length sequence was replaced with each truncated Csx30 to construct a fusion protein.

[0163] For the export gene expression cassette, OR434-TRE 3G promoter (SEQ ID NO.: 6) was operably linked to the mCherry coding sequence

[12] Upstream, construct an mCherry expression cassette and connect it to the BB2 plasmid backbone by the Golden Gate method. Among them, the OR434 sequence of the CI434 operator site is from the 1st to the 16th position of the OR434-TRE3G sequence. 6XOR434-TRE3G and 8XOR434-TRE3G have 3 pairs and 4 pairs of OR434 operator sites upstream of the TRE3G promoter, respectively. The OR434-TRE 3G promoter sequence is operably connected to the upstream of the HSV-tk coding sequence (NCBI protein ID: AAA45811.1), construct an HSV-tk expression cassette, and connect it to the BB2 plasmid backbone by the Golden Gate method. In the embodiments, for the convenience of description, the export protein expression plasmid is referred to as the BB2-IV plasmid. In some ways, the signal processing protein and the export protein are expressed on the same plasmid, and we name the plasmid BB2-I.

[0164] For crRNA, crRNA is operably connected to the downstream of U6 promoter, crRNA expression cassette is constructed, and connected to BB2 plasmid backbone, named as BB2-II plasmid. In the test, for the target sequence or sequence to be detected (such as Gluc) of exogenous expression, the target sequence is operably connected to the downstream of CMV promoter, the target gene expression cassette or the gene expression cassette to be detected is constructed, and the crRNA expression cassette is connected to the target gene expression cassette or the gene expression cassette to be detected upstream by the method of Golden Gate, and connected to the BB2 plasmid backbone. We named the plasmid BB2-III.

[0165] The plasmid was transformed into Trans10 chemically competent cells (TransGen Biotech), positive clones were selected in LB medium supplemented with 100 μg / ml ampicillin, and the plasmid was extracted from the cells using QIAprep Spin Miniprep.

[0166] (2) Mammalian cell culture

[0167] The human cell lines used in the examples include human embryonic kidney cells (HEK293T, ATCC), human pancreatic cancer cells (PANC1, ATCC), human hepatoma cells (HuH7, ATCC), diffuse glioma cell lines (HS683, ATCC), intracholecystic papillary neoplasm cell lines (NOZ, ATCC), esophagogastric adenocarcinoma cell lines (AGS, ATCC), endometrial carcinoma cell lines (RL952, ATCC), invasive breast carcinoma cell lines (T47D, ATCC), colorectal adenocarcinoma cell lines (SW48, ATCC), pancreatic cancer cell lines (PANC1, ATCC), and pancreatic cancer cell lines. lines, MIAPaCa2, ATCC), colorectal adenocarcinoma cell lines, NCIH508, ATCC), melanoma cell lines, WM115, ATCC, invasive breast carcinoma cell lines, MCF7, ATCC, and diffuse glioma cell lines, SF126, ATCC. The above host cells were cultured in high glucose DMEM medium (Hyclone) supplemented with 10% fetal bovine serum (Gibco) and 1% penicillin-streptomycin (Hyclone) at 5% CO2 and 37°C.

[0168] (3) Transfection

[0169] The cells were cultured at 2×10 5Cells were seeded on poly-D-lysine coated 12-well plates at 100 cells / well. When the cells were cultured to a confluence of about 70-90%, transfection was performed using Lipofectamine 3000 (Invitrogen) or Lipo8000 (Beyotime) according to the manufacturer's instructions. Unless otherwise specified, the transfection amount of each plasmid was 250 ng. Figure 5 h and Figure 5 i, the transfection amount of BB2-V plasmid is as indicated in the figure, and the transfection amount of BB1-I, BB1-II, BB2-II and BB2-IV plasmids is 250ng. Figure 6 In the experiments shown, the transfection amount of BB2-V plasmid was 50 ng, and the transfection amount of BB1-I, BB1-II, BB2-II and BB2-IV plasmids was 250 ng.

[0170] For Lipofectamine 3000 transfection, we diluted 2 μl of P3000 reagent into 50 μl Opti-MEM (GIBCO), and 1.5 μl of Lipofectamine 3000 and all plasmids into 50 μl Opti-MEM. For Lipo8000 transfection, we diluted 2 μl of Lipo8000 reagent and all plasmids into 50 μl Opti-MEM per well. We analyzed cells 72 hours after transfection.

[0171] (4) Microscopic imaging

[0172] 72 hours after transfection, the plate was taken out of the incubator and each well was imaged at room temperature using the EVOS M7000 imaging system (Thermofisher) with a 10x objective lens for bright field and fluorescence imaging under GFP, RFP, and BFP filters. Quantitative analysis and image analysis were performed using M7000 software.

[0173] (5) Flow cytometry and data analysis

[0174] 72h after transfection, cells were collected, the medium was aspirated and the cells were washed with 100μl PBS, then 60μl 0.25% trypsin-EDTA (GIBCO) was added to digest the cells, the cells were collected by centrifugation and resuspended with flow buffer (HBSS + 2.5mg / ml bovine serum albumin). The cells were analyzed using LSRFortessaTM flow cytometer (BD Biosciences) and FACSDiva software, and data were processed using FlowJo (V10) software.

[0175] (6) Systematic analysis of point mutation recognition sites

[0176] For the recognition of the wild-type Gluc sequence (SEQ ID NO.: 1), the crRNA (Gluc) sequence spacer is TGCAGC CAGCTTTCCGGGCATTGGCTTCCAT (SEQ ID NO.: 2). In order to study the effect of the location of the point mutation on the recognition sensitivity, we changed the bases of each site of the crRNA (Gluc) spacer one by one according to the principle of A→T / T→A / C→G / G→C (i.e., conversion mutation), and named them crRNA (Gluc) -1 to crRNA (Gluc) -31. crRNA (Gluc) -1 to crRNA (Gluc) -31 are not paired with positions 208 to 177 of the Gluc sequence, respectively. For example, the crRNA (Gluc) -1 sequence is A GCAGCCAGCTTTCCGGGCATTGGCTTCCAT; crRNA(Gluc)-2 sequence is T C CAGCCAGCTTTCGGGCATTGGCTTCCAT.

[0177] (7) Systematic analysis of double mismatches at crRNA +21 and +3 sites

[0178] First, the point mutation recognition site is fixed at crRNA+21, and then the bases at positions 1 to 20 and 22 to 31 in the crRNA(Gluc)-21 spacer are changed one by one according to the principle of A→T / T→A / C→G / G→C, and named crRNA(Gluc)-21-1 to crRNA(Gluc)-21-31. When the Gluc sequence is used as the sequence to be detected, crRNA(Gluc)-21-1 to crRNA(Gluc)-21-31 have two mismatch sites with the sequence to be detected, one of which is located at position 166 of the Gluc sequence. For example, crRNA(Gluc)-21-1 is A GCAGCCAGCTTTCCGGGCA A TGG CTTCCAT, crRNA(Gluc)-21-31 is TGCAGCCAGCTTTCCGGGCA A TGGCTTCCA A Similarly, a systematic double mismatch analysis was performed on crRNA(Gluc)-3. Based on the above rules, the spacer sequence of crRNA(Gluc)-3-7 is TG G AGC G AGCTTTCCGGGCATTGGCTTCCAT.

[0179] (8) Systematic analysis of double mismatch in each sub-region

[0180] Based on the results of the systematic analysis of double mismatches at crRNA +21 and +3 sites, we divided the crRNA spacer into four subregions: the first subregion is +1 to +3, the second subregion is +5 to +9, the third subregion is +11 to +13, and the fourth subregion is +14 to +31. For the first to third subregions, we studied all double mismatch site combinations. We believe that these regions are key regions for complementary binding synergy. In the fourth region, only some combinations of +15, +18 and +21 with other sites were analyzed.

[0181] (9) Total RNA extraction

[0182] TRIzol reagent (Invitrogen) was added to the cells grown in the 12-well plate, mixed with 200 μl of chloroform, incubated at room temperature for 15 min, and then centrifuged at 13,000 rpm for 15 min at 4°C. 0.5 mL of isopropanol was added to the aqueous phase, incubated for 10 min, and then centrifuged at 13,000 rpm for 15 min at 4°C. The white gel-like particles precipitated at the bottom of the test tube were washed with 75% ethanol and then dissolved with 30 μl of water to obtain total RNA.

[0183] (10) Transcriptome sequencing and analysis

[0184] Non-ribosomal RNA was isolated from 1 μg of total RNA using the TrueLib Poly(A) mRNA Magnetic Separation Module, and sequencing libraries were prepared using the TrueLib mRNA Library Prep Kit for Illumina for transcriptomic analysis. Sequencing was performed by Annoroad (Beijing, China) on a NovaSeq 6000 (Illumina Inc, San Diego, CA).

[0185] (11) Cell viability determination

[0186] In the embodiment where the output protein is HSV-tk, HEK293T, PANC1, and HuH7 cells are co-transfected with each sensor plasmid. After 48 hours of transfection, the successfully transfected cells are sorted by flow cytometry. The sorted cells are inoculated in a 96-well plate at 20,000 cells / well, and 500 μg / ml ganciclovir (Cayman) is added for induction after 6 hours. After another 48 hours of culture, the survival rate of the cells is determined using the CCK8 assay (Livning) according to the manufacturer's instructions. The absorbance at 450 nm is measured, and the control group is transfected with an empty BB2-IV plasmid that does not express HSV-tk, and the survival rate of the cells is calculated by comparison with the control group.

[0187] (13) Inducing adipogenic differentiation

[0188] Mesenchymal stem cells were cultured at 2-3×10 4 Pieces / cm 2 The cells were inoculated into 6-well plates at a density of 100 μg / mL, and 2 mL of complete medium (containing 10% fetal bovine serum and 1% penicillin-streptomycin) was added to each well and cultured until the cell confluence reached 100%. Adipogenic induction medium ADP1 and ADP2 medium were used alternately for induction, wherein ADP1 (added with 10% fetal bovine serum, 1% glutamine, 1% antibiotics, 2‰ insulin, 1‰ IBMX, 1‰ rosiglitazone, and 1‰ dexamethasone) was induced for 3 days, and ADP2 (added with 10% fetal bovine serum, 1% glutamine, 1% antibiotics, 2‰ insulin) was induced for 1 day. After 6-7 days of induction, cell morphology and lipid droplet formation were observed by staining with Oil Red O. RT-PCR was used to analyze the expression level of the target RNA. The mesenchymal stem cells in the control group were cultured with complete medium.

[0189] (14) Induction of EMT

[0190] Human keratinocyte cell line (HaCat) and human hepatoma cell line (HuH7) were cultured at 1×10 5 Cells were seeded into 12-well plates at a density of 100 cells / well. 1 mL of complete medium (containing 10% fetal bovine serum and 1% penicillin-streptomycin) was added to each well. After culturing the cells for 8-12 hours, the medium was replaced with starvation medium (without fetal bovine serum and supplemented with 1% penicillin-streptomycin) for starvation treatment. After 24 hours, it was replaced with induction medium (without fetal bovine serum and supplemented with 1% penicillin-streptomycin, 10 ng / ml TGFβ, 100 ng / ml EGF or HGF). After 3 days of induction, the cell morphology was observed and samples were collected for RT-PCR analysis. The cells in the control group were cultured for adhesion using starvation medium.

[0191] (15) Statistical analysis

[0192] The data of all experiments are the average of at least two independent experiments and at least three biological replicates. GraphPad prism was used for data processing and plotting. The P value is the significance level determined by a two-tailed t-test.

[0193] Example 2

[0194] 1 Sensor design and characterization

[0195] In the case where the execution part is an output gene expression cassette, it is necessary to add an operation site at the promoter of the output gene expression cassette, which is feasible for input (tgRNA) as endogenous RNA and output as exogenous protein. However, if the desired input and output are both endogenous sequences, that is, the endogenous gene circuit is rewired by the sensor system, dSpCas9 / sgRNA interaction can be used, so that there is no need to add an operation site at the promoter endogenous to the eukaryotic cell. In this embodiment, by setting the regulatory domain in the signal processing protein to dSpCas9, the localization domain is set to AcrIIA4 protein, and the execution part is designed to sgRNA, so that Csx29 releases the dSpCas9-transcription activation domain into the nucleus after the cutting of Csx30, and the transcription of the endogenous gene of interest is activated by the dSpCas9-transcription activation domain / sgRNA complex.

[0196] Specifically, the recognition part of the sensor in this embodiment is the same as that in Example 1, which is a ternary complex of DiCas7-11 protein, Csx29 protein and crRNA; the signal processing protein is N'-AcrIIA4-NES-Csx30-dSpCas9-NLS-VPR-C' fusion protein; and the execution part is sgRNA. By connecting Csx30 and dSpCas9 repressor protein AcrIIA4 in series to the N-terminus of dSpCas9 protein, AcrIIA4 can interact with the DNA binding pocket of dSpCas9 / sgRNA with high specificity, preventing it from recognizing DNA (i.e., the promoter region of the protein of interest). When tgRNA is present, the binding of DiCas7-11 protein / Csx29 protein / crRNA to tgRNA activates the protease activity of Csx29, cleaving the Csx30 domain of the signal processing protein, thereby releasing dSpCas9-VPR from the inhibition of AcrIIA4. dSpCas9-VPR / sgRNA can bind to the promoter region of the protein of interest, thereby activating the expression of the protein of interest. In this way, the expression of the protein of interest is activated by the tgRNA signal ( Figure 7 a).

[0197] In order to verify the effect of the sensor, we designed and constructed three sensors, RPS2 sensor, HSP90AB1 sensor and CANX sensor, and used the above three endogenous RNAs as tgRNAs, respectively. The corresponding sgRNAs targeted the promoters of MIAT, NEUROD1 or TTN genes, respectively, thereby activating the expression of MIAT, NEUROD1 or TTN in the host. The inventors found that the three sensors can only be activated by the tgRNA paired with them. Due to the lack of pairing with the crRNA of the other two sensors, it is difficult to activate the other two genes of interest. In the blank control of the sensor-free system, there is no activation pathway for RPS2-MIAT, HSP90AB1-NEUROD1 and CANX-TTN. These results indicate that the localization domain AcrIIA4 inhibits the transcriptional activity of dSpCas9-VPR, and can activate another unrelated RNA using any tgRNA as a signal through the sensor of the present invention. Figure 7 As shown in b, the RPS2 sensor increased the expression of MIAT by nearly 10-fold compared with the blank control.

[0198] However, compared with free dSpCas9-VPR / gRNA, the activation of the gene of interest using the sensor is still low, indicating that the cleaved AcrIIA4 may still bind to dSpCas9 and inhibit its activity. In response to this, we further optimized the signal processing protein. The first optimization strategy is to add the dihydrofolate reductase (DHFR) degradation protein Degron to the N-terminus of AcrII4A to reduce the concentration of AcrII4A ( Figure 7 c) The second strategy is to use the D14A / Y15A or N39A mutants of AcrIIA4 to reduce the binding affinity between AcrIIA4 and dSpCas9 based on the addition of Degron ( Figure 7 d). The above optimization can further increase the relative expression of RNA, but the fold change does not change significantly compared with the negative control group (the recognition part uses crRNA (NT)).

[0199] Below, different types of cells are used as the chassis to demonstrate the various applications of sensor fine channels.

[0200] 2 Temperature Sensor

[0201] The sensor of the present invention can be used to achieve temperature-responsive expression of proteins. It is known in the art that when the temperature rises or there are other environmental stresses, the expression of heat shock proteins increases, thereby helping the normal folding of proteins under high temperature environments. We designed crRNA for the heat shock protein HSP70 transcript (Table 1), and sgRNA for the promoter of the MIAT gene, so that HEK293T cells can express the MIAT gene in response to the increase in temperature ( Figure 7 e). When the culture temperature increased from 37°C to 42°C, the expression level of endogenous HSP70 in the host cells increased by about 6 times ( Figure 7 f); while the expression of activated MIAT increased by about 25 times ( Figure 7 g). The crRNA in the control group was a random sequence crRNA (NT), which could not transmit the signal of HSP70 mRNA to the MIAT expression box, so the expression level of MIAT in the control group did not change significantly at different temperatures.

[0202] It can be seen that the sensor of the present invention can realize the programmable reconnection ability in the RNA regulatory network, and can use any endogenous RNA as input to change the expression of another RNA. The expression can be inducible (e.g., temperature-induced) or constitutive expression.

[0203] 3. Engineered progesterone production pathway

[0204] By rewiring, we constructed a steroidogenic pathway in human HEKT cells to biosynthesize progesterone from cholesterol ( Figure 8 a). Specifically, three crRNAs targeting RPS2, HSP90AB1 and CANX genes (Table 1) and sgRNAs targeting STAR, CYP11A1 and HSD3B2 genes were designed to construct STAR sensors, CYP11A1 sensors and CANX sensors with RPS2, HSP90AB1 or CANX mRNA as input, respectively. Figure 8 As shown in b, the relative mRNA expression of STAR, CYP11A1, and HSD3B2 are positively correlated with the input RNA (RPS2, HSP90AB1, or CANX), indicating that the sensor can respond to changes in the stoichiometry of tgRNA. In addition, by transfecting the host cells with a recognition part containing crRNA that recognizes one of the tgRNAs, a signal processing protein, and an execution part containing all three sgRNAs, a single-input-three-output sensor system was constructed, which can use the input to drive the production of progesterone. Figure 8c shows that the progesterone production of the host cell also depends on the concentration of the input RNA, which is consistent with the expression levels of the three genes of interest. In this scheme, the quantitative sensing and response capabilities of the sensor indicate its potential application prospects in realizing more complex biological regulation functions of cell networks.

[0205] 5 Discussions

[0206] In this study, sensors using protease-responsive dSpCas9-VPR / sgRNA were used to sense exogenous, endogenous or dynamically changing RNA signals to regulate the expression of specific genes in cells or monitor the morphology and function of cells. In order to demonstrate the programmability of RNA-based circuits, several sensors were designed to sense different endogenous RNA signals and activate the expression of unrelated mRNAs, highlighting that expression control based on RNA signals has broad application prospects in biology, biotechnology and medicine. The programmable high-resolution CASP sensor developed in living cells can be used as an efficient and versatile technology platform, which is expected to be used to study the entire RNA regulatory network of mammalian cells and is widely used in gene therapy, biosensing and the design of synthetic regulatory networks.

[0207] 6 Materials and methods

[0208] (1) Sensor construction

[0209] The recognition part was constructed by a method similar to that of Example 1. For the signal processing protein N'-AcrIIA4-NES-Csx30-dSpCas9-NLS-VPR-C' fusion protein, AcrIIA4 (NCBI protein ID: WP_003723290.1), NES (SEQ ID NO.: 89), Csx30 (NCBI protein ID: WP_124329907.1), dSpCas9 (NCBI protein ID: WP_011285506.1), VPR and NLS (SEQ ID NO.: 90) were operably linked using the connecting peptide GSSSS and connected to the downstream of the CMV promoter in the BB2 plasmid backbone. For the signal processing protein containing Degron, Degron was operably linked to the upstream of AcrIIA4 using a connecting peptide. In addition, the AcrIIA4 mutants include D14A and Y15A mutations based on NCBI protein ID: WP_003723290.1, or include N39A mutations based on NCBI protein ID: WP_003723290.1. The in vivo expression levels of RPS2, HSP90AB1 and CANX and the crRNA spacers for the above target sequences are given in Table 1. The sgRNAs for MIAT, STAR, CYP11A1 and HSD3B2 are SEQ ID NOs.: 82-88.

[0210] (2) Temperature sensor testing

[0211] The HSP70-MIAT sensor was transfected into HEK293T cells and cultured at 37°C for 24 hours. The experimental group cells were cultured at 42°C for 24 hours and the control group cells were cultured at 37°C for 24 hours. The cells were then collected for RNA extraction and RT-PCR analysis. The crRNA spacer sequence for HSP70 is SEQ ID NO.: 8-9.

[0212] (3) ELISA test for progesterone production

[0213] Progesterone was measured according to the standard instructions of the progesterone ELISA kit (Beyotime.no.SEKSM-0002). The control sgRNA (random sequence) or the sensor sgRNA series was transfected into the HEK293T cell line transfected with the recognition part and the signal processing protein, and the cell culture supernatant was collected after 48h. According to the manufacturer's instructions, 90μl of the cell culture supernatant was used for ELISA detection. The absorbance was measured at a wavelength of 450nm using an ELISA reader. A standard curve was drawn based on the standard samples provided, and the progesterone content was calculated based on the absorbance.

[0214] Table 1 Endogenous expression levels and spacer sequences for the above crRNA

[0215]

[0216]

[0217] Table 2 crRNA targeting cancer driver genes

[0218]

[0219] References

[0220] 1Megason,SG,https: / / doi.org / 10.1007 / 978-1-60327-977-2_19,MethodsMol Biol 546,317-332(2009).2Morsut,L.,et al.,Cell 164,780-791(2016).

[0221] 3Bisaria,A.,et.al.,Science 368,1205-1210(2020).

[0222] 4van Unen,J.et al.BMC Cell Biol 19,6(2018).

[0223] 5Chavez, A. et al. Nat Methods 12, 326-328 (2015).

[0224] 6Huo,Y.,et al.Nat Microbiol 8,522–532(2023).

[0225] 7Ma D.,et.al.,ACS Synth.Biol.2018,7,978-985.

[0226] 8Gilbert L.,et.al.,Cell 2013;154:442-451.

[0227] 9Zong,Y.,et al.Nat Commun 8,52(2017).

[0228] 10 Strecker, J. et al. Science 378, 874-881 (2022).

[0229] 11Fan,Y.et al.,Mol Cancer 20,25,doi:10.1186 / s12943-446 021-01321-x(2021)

[0230] 12Shaner NC.,et.al.,Nat Biotechnol.2004;22(12):1567-72.

[0231] 13Hu,LF,et.al.,.Wiley Interdiscip Rev RNA 14,e1731(2023).

[0232] 14Luo,J.,et.al.,Semin Oncol 48,10-18(2021).

[0233] 15 Olivier,M.,et.al.,Cold Spring Harb Perspect Biol 2,a001008(2010).

[0234] 16 Ritterhouse,LL&Barletta,JASemin Diagn Pathol 32,400-408(2015).17 Lei Q.,et.al,Cell,2013,152(5):1173-1183

[0235] 18 Kazuki K.et.al.,Science,2022,Vol 378,Issue 6622,pp.882-889

[0236] 19 Peck, SH, et.al., Chem Biol 18,619-630 (2011).

[0237] 20 Gramespacher, JA, et.al., J Am Chem Soc 141, 13708-13712 (2019).

Claims

1. A system for detecting a target RNA molecule in a mammalian cell, the system comprising: A recognition portion, the recognition portion consisting of DiCas7-11 protein, Csx29 protein and crRNA, wherein the spacer region of the crRNA contains a sequence complementary to the target RNA molecule; A signal processing protein, the signal processing protein comprising a localization domain, a Csx30 domain, a transcriptional regulatory domain and a transcriptional activation domain, wherein the transcriptional activation domain is selected from RTa, P65, VP16, VP64, VTR1, VTR2, VTR3, VPR or a combination of the above domains; and An executive portion, the executive portion comprising a nucleic acid sequence that interacts with the transcriptional regulatory domain of the signal processing protein.

2. The system of claim 1, wherein: The DiCas7-11 protein of the recognition portion has a D429A / D654A mutation; Preferably, the crRNA spacer region of the recognition portion is 23-31 nt. Preferably, the crRNA spacer has a point mutation recognition site, and the point mutation recognition site is selected from any of the following positions of the crRNA spacer: the 2nd, 3rd, 5th, 7th, 9th and 21st; More preferably, the crRNA spacer has a point mutation recognition site and an auxiliary site, and the point mutation site and the auxiliary site are selected from any combination of the following positions of the crRNA spacer: the 2nd and 5th, the 2nd and 7th, the 3rd and 5th, the 3rd and 7th, the 3rd and 9th, the 5th and the 2nd, the 5th and the 3rd, the 7th and the 2nd, the 7th and the 3rd, and the 9th and the 3rd; More preferably, the crRNA spacer has a point mutation recognition site and an auxiliary site, and the point mutation site and the auxiliary site are selected from any combination of the following positions of the crRNA spacer: the 3rd and the 7th, the 7th and the 3rd, or the 3rd and the 9th; Preferably, the Csx30 domain is a truncated Csx30 having amino acids 366-565 of Csx30.

3. The system of claim 1 or 2, wherein: The localization domain of the signal processing protein is AcrIIA4, the transcriptional regulatory domain is dSpCas9; the execution part comprises sgRNA; Preferably, the signal processing protein further comprises a NES sequence at the C-terminus of the AcrIIA4 domain and further comprises a NLS sequence at the N-terminus of the transcription activation domain. Preferably, the signal processing protein further comprises a Degron domain at the N-terminus of the AcrIIA4 domain. Preferably, the AcrIIA4 domain of the signal processing protein comprises D14A, Y15A and / or N39A mutations. Preferably, the execution part comprises sgRNA and an output gene expression cassette, wherein the sgRNA is complementary to a promoter region in the output gene expression cassette.

4. The system of claim 1 or 2, wherein: The localization domain of the signal processing protein is a cell membrane localization domain, and the transcriptional regulatory domain is an allosteric transcription factor; the execution part is an output gene expression cassette, wherein the output gene expression cassette comprises an output protein coding sequence and an inducible promoter for controlling the transcription of the output protein; wherein the inducible promoter comprises an operator site for interacting with the allosteric transcription factor; Preferably, the cell membrane localization domain is N-MTS or C-MTS; Preferably, the allosteric transcription factor is selected from RpaR, BraR, BjaR, TetR, CI434, Phlf, HKCl, LmrA, Bm3R, TP901CI, CymR, TtgR and LexA; Preferably, the inducible promoter in the export gene expression cassette has 1-4 pairs, more preferably 3 pairs of operator sites.

5. A method for detecting a target RNA molecule in a mammalian cell, the method comprising transfecting the mammalian cell with a plasmid comprising the following sequence: The recognition part expression cassette is composed of a DiCas7-11 gene expression cassette, a Csx29 gene expression cassette and a crRNA expression cassette, wherein: The spacer region of the crRNA comprises a sequence complementary to the target RNA molecule; A signal processing protein expression cassette, wherein the signal processing protein comprises a localization domain, a Csx30 domain, a transcriptional regulatory domain and a transcriptional activation domain, wherein the transcriptional activation domain is selected from RTa, P65, VP16, VP64, VTR1, VTR2, VTR3, VPR or a combination of the above domains; and An execution part expression cassette, wherein the execution part comprises a nucleic acid sequence that interacts with the transcriptional regulatory domain of the signal processing protein.

6. The method of claim 5, wherein: The localization domain of the signal processing protein is AcrIIA4, and the transcriptional regulatory domain is dSpCas9; the execution part expression cassette comprises an sgRNA expression cassette and an output gene expression cassette, wherein the spacer region of the sgRNA is complementary to the promoter of the output gene; Preferably, the signal processing protein further comprises a NES sequence at the C-terminus of the AcrIIA4 domain and further comprises a NLS sequence at the N-terminus of the transcription activation domain. Preferably, the signal processing protein further comprises a Degron domain at the N-terminus of the AcrIIA4 domain. Preferably, the AcrIIA4 domain of the signal processing protein comprises D14A, Y15A and / or N39A mutations; Preferably, the crRNA spacer has a point mutation recognition site, and the point mutation recognition site is selected from any of the following positions of the crRNA spacer: the 2nd, 3rd, 5th, 7th, 9th and 21st; More preferably, the crRNA spacer has a point mutation recognition site and an auxiliary site, and the point mutation site and the auxiliary site are selected from any combination of the following positions of the crRNA spacer: the 2nd and 5th, the 2nd and 7th, the 3rd and 5th, the 3rd and 7th, the 3rd and 9th, the 5th and the 2nd, the 5th and the 3rd, the 7th and the 2nd, the 7th and the 3rd, and the 9th and the 3rd; More preferably, the crRNA spacer has a point mutation recognition site and an auxiliary site, and the point mutation site and the auxiliary site are selected from any combination of the following positions of the crRNA spacer: the 3rd and the 7th, the 7th and the 3rd, or the 3rd and the 9th; Preferably, the DiCas7-11 protein of the recognition portion has a D429A / D654A mutation; Preferably, the crRNA spacer of the recognition portion is 23-31 nt; Preferably, the Csx30 domain is a truncated Csx30 having amino acids 366-565 of Csx30.

7. The method of claim 5, wherein: The localization domain of the signal processing protein is a cell membrane localization domain, and the transcriptional regulatory domain is an allosteric transcription factor; the execution part is an output gene expression cassette, wherein the output gene expression cassette comprises an output protein coding sequence and an inducible promoter for controlling the transcription of the output protein; wherein the inducible promoter comprises an operator site for interacting with the allosteric transcription factor; Preferably, the cell membrane localization domain is N-MTS or C-MTS; Preferably, the allosteric transcription factor is selected from RpaR, BraR, BjaR, TetR, CI434, Phlf, HKCl, LmrA, Bm3R, TP901CI, CymR, TtgR and LexA; Preferably, the inducible promoter in the export gene expression cassette has 1-4 pairs, more preferably 3 pairs of operator sites; Preferably, the crRNA spacer has a point mutation recognition site, and the point mutation recognition site is selected from any of the following positions of the crRNA spacer: the 2nd, 3rd, 5th, 7th, 9th and 21st; More preferably, the crRNA spacer has a point mutation recognition site and an auxiliary site, and the point mutation site and the auxiliary site are selected from any combination of the following positions of the crRNA spacer: the 2nd and 5th, the 2nd and 7th, the 3rd and 5th, the 3rd and 7th, the 3rd and 9th, the 5th and the 2nd, the 5th and the 3rd, the 7th and the 2nd, the 7th and the 3rd, and the 9th and the 3rd; More preferably, the crRNA spacer has a point mutation recognition site and an auxiliary site, and the point mutation site and the auxiliary site are selected from any combination of the following positions of the crRNA spacer: the 3rd and the 7th, the 7th and the 3rd, or the 3rd and the 9th; Preferably, the DiCas7-11 protein of the recognition portion has a D429A / D654A mutation; Preferably, the crRNA spacer of the recognition portion is 23-31 nt; Preferably, the Csx30 domain is a truncated Csx30 having amino acids 366-565 of Csx30.

8. A method for RNA-dependent expression of a protein of interest in a mammalian cell, the method comprising transfecting the mammalian cell with a plasmid comprising the following sequence: The recognition part expression cassette is composed of a DiCas7-11 gene expression cassette, a Csx29 gene expression cassette and a crRNA expression cassette, wherein: The spacer region of the crRNA comprises a sequence complementary to the target RNA molecule; A signal processing protein expression cassette, wherein the signal processing protein comprises a localization domain, a Csx30 domain, a transcriptional regulatory domain and a transcriptional activation domain, wherein the transcriptional activation domain is selected from RTa, P65, VP16, VP64, VTR1, VTR2, VTR3, VPR or a combination of the above domains; and An execution part expression cassette, wherein the execution part comprises a nucleic acid sequence that interacts with the transcriptional regulatory domain of the signal processing protein.

9. The method of claim 8, wherein: The localization domain of the signal processing protein is AcrIIA4, and the transcriptional regulatory domain is dSpCas9; the execution part comprises sgRNA, and the spacer region of the sgRNA is complementary to the promoter of the protein of interest; Preferably, the signal processing protein further comprises a NES sequence at the C-terminus of the AcrIIA4 domain and further comprises a NLS sequence at the N-terminus of the transcription activation domain. Preferably, the signal processing protein further comprises a Degron domain at the N-terminus of the AcrIIA4 domain. Preferably, the AcrIIA4 domain of the signal processing protein comprises D14A, Y15A and / or N39A mutations; Preferably, the crRNA spacer has a point mutation recognition site, and the point mutation recognition site is selected from any of the following positions of the crRNA spacer: the 2nd, 3rd, 5th, 7th, 9th and 21st; More preferably, the crRNA spacer has a point mutation recognition site and an auxiliary site, and the point mutation site and the auxiliary site are selected from any combination of the following positions of the crRNA spacer: the 2nd and 5th, the 2nd and 7th, the 3rd and 5th, the 3rd and 7th, the 3rd and 9th, the 5th and the 2nd, the 5th and the 3rd, the 7th and the 2nd, the 7th and the 3rd, and the 9th and the 3rd; More preferably, the crRNA spacer has a point mutation recognition site and an auxiliary site, and the point mutation site and the auxiliary site are selected from any combination of the following positions of the crRNA spacer: the 3rd and the 7th, the 7th and the 3rd, or the 3rd and the 9th; Preferably, the DiCas7-11 protein of the recognition portion has a D429A / D654A mutation; Preferably, the crRNA spacer of the recognition portion is 23-31 nt; Preferably, the Csx30 domain is a truncated Csx30 having amino acids 366-565 of Csx30.

10. The method of claim 8, wherein: The localization domain of the signal processing protein is a cell membrane localization domain, and the transcriptional regulatory domain is an allosteric transcription factor; the execution part is an expression cassette of a protein of interest, wherein the expression cassette of the protein of interest comprises a coding sequence of the protein of interest and an inducible promoter that controls the transcription of the protein of interest; wherein the inducible promoter comprises an operator site that interacts with the allosteric transcription factor. Preferably, the cell membrane localization domain is N-MTS or C-MTS; Preferably, the allosteric transcription factor is selected from RpaR, BraR, BjaR, TetR, CI434, Phlf, HKCl, LmrA, Bm3R, TP901CI, CymR, TtgR and LexA; Preferably, the inducible promoter in the export gene expression cassette has 1-4 pairs, more preferably 3 pairs of operator sites; Preferably, the crRNA spacer has a point mutation recognition site, and the point mutation recognition site is selected from any of the following positions of the crRNA spacer: the 2nd, 3rd, 5th, 7th, 9th and 21st; More preferably, the crRNA spacer has a point mutation recognition site and an auxiliary site, and the point mutation site and the auxiliary site are selected from any combination of the following positions of the crRNA spacer: the 2nd and 5th, the 2nd and 7th, the 3rd and 5th, the 3rd and 7th, the 3rd and 9th, the 5th and the 2nd, the 5th and the 3rd, the 7th and the 2nd, the 7th and the 3rd, and the 9th and the 3rd; More preferably, the crRNA spacer has a point mutation recognition site and an auxiliary site, and the point mutation site and the auxiliary site are selected from any combination of the following positions of the crRNA spacer: the 3rd and the 7th, the 7th and the 3rd, or the 3rd and the 9th; Preferably, the DiCas7-11 protein of the recognition portion has a D429A / D654A mutation; Preferably, the crRNA spacer of the recognition portion is 23-31 nt; Preferably, the Csx30 domain is a truncated Csx30 having amino acids 366-565 of Csx30.

11. Use of the system according to any one of claims 1 to 4 or the method according to any one of claims 5 to 10 in disease diagnosis or treatment; Preferably, the disease is cancer.

Images