Application of PARIT1 in enhancing protein translation efficiency
By using PARIT1's nucleotide sequence preparation reagents to promote the overexpression of PARIT1, the problem of low protein translation efficiency in gene editing technology is solved, and the effect of significantly improving the level of protein translation is achieved, with wide application prospects.
Patent Information
- Application Number
- CN202411310228.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-19
- Publication Date
- 2024-12-24
AI Technical Summary
Existing gene editing technologies such as CRISPR-dCas9-VP64 are difficult to effectively regulate gene expression during post-transcriptional modification, resulting in failure of gene overexpression, and lack of methods that can improve protein translation efficiency.
The reagent is prepared by using the nucleotide sequence of PARIT1 (such as SEQ ID NO:1) to promote the overexpression of PARIT1 through carriers, active peptides, protein microspheres, liposomes, etc., and enhance the intracellular or in vitro protein translation efficiency.
It significantly improves the translation level of proteins intracellular and in vitro, provides a new method to enhance protein translation efficiency, with broad application prospects.
Smart Images
Figure CN119177237A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biomedical technology, and in particular, relates to the application of PARIT1 in enhancing protein translation efficiency. Background Art
[0002] At present, the widespread application of CRISPR technology has made a qualitative leap in gene editing technology. Through the CRISPR-dCas9-VP64 plasmid, the gene promoter region can be targeted by gRNA to promote the transcription of the gene, and finally the gene is overexpressed. This method can effectively reduce the experimental cost, but it still has shortcomings in practical application. The post-transcriptional modification process will also regulate the expression of the target gene. Therefore, promoting the gene transcription process in the cell does not necessarily increase gene expression. By promoting the gene transcription process to produce more mRNA, the subsequent translation process is affected, which may still lead to the failure of gene overexpression.
[0003] Therefore, it is of great significance to develop a method or system that can promote the translation efficiency of proteins in cells at the translation level and thus promote protein expression. At present, there is no research or report on the application of PARIT1 in enhancing protein translation efficiency. Summary of the invention
[0004] In view of the problems existing in the above-mentioned prior art, the object of the present invention is to provide an application of PARIT1 in enhancing protein translation efficiency.
[0005] The above-mentioned object of the present invention is achieved through the following technical solutions:
[0006] The first aspect of the present invention provides use of PARIT1 in preparing a reagent for enhancing protein translation efficiency.
[0007] Furthermore, the nucleotide sequence of the PARIT1 is shown in SEQ ID NO:1.
[0008] Furthermore, the enhancement of protein translation efficiency includes enhancing protein translation efficiency in cells or enhancing protein translation efficiency in an in vitro protein expression system.
[0009] In some embodiments, the PARIT1 is a lncRNA, and the nucleotide sequence of the PARIT1 is as shown in SEQ ID NO: 1 or a derivative molecule thereof. In a specific embodiment of the present invention, the nucleotide sequence of the PARIT1 is as shown in SEQ ID NO: 1.
[0010] The second aspect of the present invention provides the use of an agent for overexpressing PARIT1 in promoting protein translation.
[0011] Furthermore, the nucleotide sequence of the PARIT1 is shown in SEQ ID NO:1.
[0012] Furthermore, the reagent includes a vector that overexpresses PARIT1, an active peptide that promotes PARIT1 expression, a protein that promotes PARIT1 expression, nanoparticles carrying PARIT1, protein microspheres that encapsulate PARIT1, liposomes that encapsulate PARIT1, small molecule compounds that promote PARIT1 expression and / or any combination thereof.
[0013] In some embodiments, the agent for overexpressing lncRNA PARIT1 refers to any substance capable of promoting the expression of lncRNA PARIT1, including but not limited to: natural purified substances, modified natural purified substances, semi-synthetic substances, chemically synthesized substances and / or any combination thereof capable of promoting the expression of lncRNA PARIT1.
[0014] In some embodiments, the agent for overexpressing lncRNA PARIT1 includes but is not limited to: a recombinant vector containing lncRNA PARIT1, nanoparticles containing lncRNA PARIT1, protein microspheres containing lncRNA PARIT1, liposomes containing lncRNA PARIT1, PEG-modified proteins containing lncRNA PARIT1, extracellular vesicles containing lncRNA PARIT1, active peptides that promote PARIT1 expression, proteins that promote PARIT1 expression, and / or any combination thereof.
[0015] In some embodiments, the vector is not particularly limited, as long as it can be used to deliver the lncRNA PARIT1 described in the present invention to overexpress lncRNA PARIT1, it is within the protection scope of the present invention, including but not limited to: lentiviral vectors, DNA plasmid vectors, retroviral vectors, poxvirus vectors, herpes simplex virus vectors, adenovirus vectors, adeno-associated virus vectors, liposomes bound to DNA plasmids, molecular couples bound to DNA plasmids and / or polymers bound to DNA plasmids, etc.
[0016] In some embodiments, the vector overexpressing lncRNA PARIT1 includes a lentiviral vector overexpressing lncRNA PARIT1. The lentiviral vector overexpressing lncRNA PARIT1 contains the lncRNA PARIT1 and can integrate the lncRNA PARIT1 described herein into the genome of the host cell. The lentivirus described herein can be prepared by methods well known in the art. For example, a lentiviral vector containing the lncRNA PARIT1 described herein is first prepared, and then the virus is packaged in a suitable host cell, and the desired lentivirus is isolated and purified. Reagents for lentiviral packaging are well known in the art, such as conventional lentiviral vector systems (Tronolab) including but not limited to: pRsv-REV, pMDlg-pRRE, pMD2G, etc.
[0017] In a specific embodiment of the present invention, the PARIT1 or the agent overexpressing PARIT1 can promote protein translation in cells or in vitro protein expression systems, and the cells include but are not limited to stem cells and differentiated cells.
[0018] In some embodiments, the stem cells include but are not limited to: iPSC, embryonic stem cells, mesenchymal stem cells, hematopoietic stem cells, neural stem cells, bone marrow stem cells, dental pulp stem cells, placental stem cells, umbilical cord stem cells, adipose stem cells or epidermal stem cells. Any stem cells that are not highly differentiated and have the potential to regenerate various tissues, organs and the human body (including but not limited to: totipotent stem cells, pluripotent stem cells and unipotent stem cells) are within the scope of protection of the present invention.
[0019] In some embodiments, the differentiated cells include but are not limited to: fibroblasts, macrophages, effector B cells, effector T cells, nerve cells, red blood cells, white blood cells, pancreatic cells, hepatocytes, intestinal cells, islet cells, adipocytes, monocytes, lymphocytes, stem cells, cardiomyocytes, kidney cells, and any currently known differentiated cells are within the scope of protection of the present invention.
[0020] A third aspect of the present invention provides an agent for enhancing protein translation efficiency.
[0021] Furthermore, the reagent includes PARIT1 or a reagent that overexpresses PARIT1.
[0022] Furthermore, the nucleotide sequence of PARIT1 is shown in SEQ ID NO: 1;
[0023] The reagents include vectors that overexpress PARIT1, active peptides that promote PARIT1 expression, proteins that promote PARIT1 expression, nanoparticles carrying PARIT1, protein microspheres that encapsulate PARIT1, liposomes that encapsulate PARIT1, small molecule compounds that promote PARIT1 expression, and / or any combination thereof.
[0024] The fourth aspect of the present invention provides use of the reagent described in the third aspect of the present invention in an in vitro protein expression system.
[0025] Furthermore, the agent is capable of promoting the translation of proteins in vitro.
[0026] In some embodiments, the in vitro protein expression system includes, but is not limited to, a prokaryotic expression system, a mammalian cell expression system, a yeast expression system, and an insect cell expression system.
[0027] In some embodiments, the prokaryotic expression system includes an Escherichia coli expression system, a Bacillus expression system, and a Streptomyces expression system, among which the most commonly used expression system is mainly an Escherichia coli expression system.
[0028] In some embodiments, in a mammalian cell expression system, commonly used mammalian cell lines include HeLa cells, human embryonic kidney cells (HEK293) and Chinese hamster ovary cells (CHO). Mammalian cells can express exogenous proteins when target proteins containing complex disulfide bonds or post-translational modifications cannot be expressed using other expression systems.
[0029] In some embodiments, in a yeast expression system, yeast is a eukaryotic microorganism whose cells have the ability to express foreign proteins and can reach a relatively high cell density. The foreign proteins expressed in yeast can be post-translationally modified, such as phosphorylation and glycosylation. Since yeast host cells combine the excellent properties of bacterial and higher-order biological host cell expression systems, yeast expression systems can be used when foreign proteins cannot be successfully expressed in Escherichia coli.
[0030] In some embodiments, in insect cell expression systems, membrane proteins, large molecular weight proteins and protein kinases, which are difficult to express using bacterial expression systems, are expressed in insect cells such as Sf9 or High-5. In most insect cell expression systems, foreign genes are transfected into host cells via baculovirus vectors, and the marker cassette containing the target gene is incorporated into the host genome via homologous recombination.
[0031] The fifth aspect of the present invention provides a method for enhancing protein translation efficiency in vitro.
[0032] Furthermore, the method comprises the following steps: introducing PARIT1 or an agent for overexpressing PARIT1 into an in vitro host cell system.
[0033] Furthermore, the nucleotide sequence of PARIT1 is shown in SEQ ID NO: 1;
[0034] The reagents include vectors that overexpress PARIT1, active peptides that promote PARIT1 expression, proteins that promote PARIT1 expression, nanoparticles carrying PARIT1, protein microspheres that encapsulate PARIT1, liposomes that encapsulate PARIT1, small molecule compounds that promote PARIT1 expression, and / or any combination thereof.
[0035] Compared with the prior art, the present invention has the following beneficial effects:
[0036] The present invention discovers for the first time a new use of PARIT1 in enhancing protein translation efficiency. The PARIT1 can not only significantly improve the translation level of intracellular proteins, but also promote the overall translation efficiency of proteins in an in vitro protein expression system by exogenous addition of PARIT1, providing a new method for enhancing protein translation efficiency in the art and having broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS
[0037] Figure 1 :The enrichment distribution of PARIT1 in the mono- and poly-ribosome fractions.
[0038] Figure 2 : Knockdown of PARIT1 resulted in decreased protein expression levels of stemness genes OCT4, SOX2, and NANOG in iPSCs and H9 cells.
[0039] Figure 3 : PARIT1 regulates ribosome translation function, among which, Figure A: Knockdown of PARIT1 shifts the ribosome distribution peak from polymerized to monomeric; Figure B: Puromycin incorporation experiments show that PARIT1 knockdown inhibits protein translation, while PARIT1 overexpression promotes protein translation; Figure C: PARIT1 knockdown changes the distribution of stemness gene proteins in ribosomes, and PARIT1 knockdown shifts the binding of IGF2BP1 to ribosomes toward monomers.
[0040] Figure 4: PARIT1 binds to IGF2BP1 and promotes the formation of phase separation structure of IGF2BP1, among which, Figure A: RNA-FISH-immunofluorescence shows that PARIT1 (green) and IGF2BP1 (red) in the cytoplasm have obvious co-localization; Figure B: PARIT1 knockdown significantly reduces the IGF2BP1-LLPS granular structure in the cytoplasm (white arrows indicate typical LLPS particles); Figure C: Quantitative analysis of the number of IGF2BP1-LLPS particles in the cytoplasm; Figure D: PARIT1 knockdown reduces the binding of IGF2BP1 to the 3'CRD sequence of stemness genes. *P<0.05, **P<0.01, ***P<0.005 vs. shCT.
[0041] Figure 5 : Map of PARIT1 overexpression lentiviral plasmid with puromycin resistance.
[0042] Figure 6 Puromycin incorporation was used to detect the level of nascent proteins. Puromycin was incorporated into 293T cells and H9 cells with PARIT1 overexpression or knockdown, respectively. Total protein was extracted 20 minutes later, and the amount of puromycin incorporation was detected by Western Blot to observe the effect of PARIT1 on protein translation.
[0043] Figure 7 :In vitro protein translation system (One-step human IVT kit, Thermo Scientific TM 88880), human OCT4 protein was expressed, 10ng OCT4 cDNA was used as the expression template, PARIT1 or control RNA was added to the translation system, and the effect on the expression of OCT4 target protein was observed, where: 1: H2O, 2: 20ng total RNA of cells that do not express PARIT1, 3: 20ng control RNA, 4: 20ng PARIT1, 5: 100ng PARIT1. DETAILED DESCRIPTION
[0044] The present invention is further described below in conjunction with specific examples. The specific examples are only used to explain the present invention and cannot be construed as limiting the present invention. It will be understood by those of ordinary skill in the art that various changes, modifications, substitutions and variations can be made to these embodiments without departing from the principles and purposes of the present invention, and the scope of the present invention is defined by the claims and their equivalents. The reagents and raw materials used in the present invention are easily available to those of ordinary skill in the art, and can be obtained from commercial sources unless otherwise specified. The experimental methods for which specific conditions are not specified in the present invention are usually implemented and detected under conventional conditions or according to the conditions recommended by the manufacturer. In particular, the following examples are only used to illustrate the present invention and should not limit the scope of the present invention in any way.
[0045] Example 1 Expression of lncRNA PARIT1 in pluripotent stem cell ribosomes
[0046] 1. Experimental Materials
[0047] The human embryonic stem cell line H9 and iPSC clones, and skin fibroblasts FBL used in this project were kindly donated by the research group of Professor Miguel A. Esteban of the Guangzhou Institutes of Biomedicine and Health, Chinese Academy of Sciences. The skin fibroblasts were originally purchased from the Coriell Institute (AG06299).
[0048] 2. Experimental methods
[0049] The cytoplasm of human embryonic stem cell lines H9, iPSC and fibroblasts FBL was extracted, and after sucrose density gradient centrifugation, different density gradient samples were separated, detected by spectrophotometer, and absorbance curves were drawn to distinguish ribosome mono-poly components. RNA in poly-ribosome components and total cell RNA were extracted, and lncRNAs differentially expressed in pluripotent cells and differentiated cells were analyzed by high-throughput sequencing (Ribo-seq). Nuclear RNA contamination in ribosome RNA samples was excluded by observing the expression of RNU6-1 in the extracted ribosomal RNA. CRIST-seq was used to analyze lncRNAs that interacted with the promoters and enhancers of pluripotent genes OCT4 and SOX2. The results of Ribo-seq and CRIST-seq were comprehensively analyzed to screen lncRNA transcript information that was differentially expressed in stem cells and fibroblasts, enriched in stem cell poly-ribosomes, and interacted with OCT4 and SOX2. After expression difference sorting and qPCR detection, the PARIT1 molecule was screened as the research object of this project.
[0050]
[0051] The expression abundance of PARIT1 in H9, iPSC and FBL was detected, and the ribosome monomeric and polymeric components were separated by sucrose density gradient centrifugation to analyze the enrichment distribution of PARIT1 on the ribosome.
[0052] 3. Experimental results
[0053] The ribosome monomeric and polymeric components were separated by sucrose density gradient centrifugation, and the enrichment distribution of PARIT1 on the ribosome was analyzed. The results are as follows Figure 1 As shown, PARIT1 is enriched in both mono- and poly-ribosomes.
[0054] Example 2 PARIT1 knockdown leads to cell pluripotency exit
[0055] 1. Experimental methods
[0056] A PARIT1 shRNA knockdown lentiviral plasmid with puromycin resistance was constructed, and the embryonic stem cell line H9 and iPSC clones were transfected after packaging the lentivirus. Positive transfected cell clones were screened by puromycin. Total RNA and protein of PARIT1 knockdown cells were extracted, and RT-qPCR and Western Blot were used to detect the regulatory effect of PARIT1 on the expression of pluripotent genes OCT4, SOX2 and NANOG. At the same time, the expression of pluripotent genes was detected by immunofluorescence on cell slides, and the changes in cell pluripotency were analyzed by alkaline phosphatase-SSEA4 staining to clarify the regulatory effect of PARIT1 on pluripotent genes and cell pluripotency. Among them, the sequences corresponding to shPARIT1-1 and shPARIT1-2 are as follows:
[0057] shPARIT1-1:TAGCTGTAGTCCAGGAATAGT (SEQ ID NO:2);
[0058] shPARIT1-2: GCTACATGTGCCGGAAATCTG (SEQ ID NO: 3).
[0059] 2. Experimental results
[0060] Two shRNA lentiviruses were used to knock down PARIT1 in human H9 cells and iPSCs to observe its regulatory effect on cell pluripotency. The results showed that knocking down PARIT1 reduced the protein expression levels of stemness genes OCT4, SOX2, and NANOG, especially in the shPARIT1-2 group, where the reduction in stemness gene protein expression was more obvious ( Figure 2 ).
[0061] Example 3 PARIT1 regulates ribosome translation function
[0062] 1. Experimental methods
[0063] This example further studies the regulatory effect of PARIT1 on ribosome function. First, the RNA-FISH-immunofluorescence method was used to clarify the co-localization of PARIT1 and ribosomal protein RPS3 in iPSCs. Secondly, sucrose density gradient centrifugation was used to separate the monomeric and polymeric components of ribosomes in cells with knockdown of PARIT1. Thirdly, the puromycin incorporation experiment was used to detect the efficiency of ribosomal protein translation. Finally, after shRNA knockdown of PARIT1, the distribution of stemness genes in ribosomal components and the protein distribution of IGF2BP1 were analyzed. A PARIT1 overexpression lentiviral plasmid with puromycin resistance was constructed ( Figure 5 ), packaged with lentivirus and transfected into embryonic stem cell line H9 and iPSC clones, and positive transfected cell clones were selected by puromycin.
[0064] 2. Experimental results
[0065] This example further studies the regulatory effect of PARIT1 on ribosome function. Sucrose density gradient centrifugation was used to separate the monomeric and polymeric components of ribosomes in cells with knockdown of PARIT1. OD260 detection revealed that knockdown of PARIT1 shifted the distribution peak of ribosome polymers toward monomeric components ( Figure 3 A). Puromycin incorporation assay was used to detect ribosomal protein translation efficiency, and it was found that knocking down PARIT1 reduced the overall protein translation efficiency, while overexpressing PARIT1 increased the protein translation efficiency ( Figure 3 B). After knocking down PARIT1 by shRNA, the distribution of stemness genes in ribosome components was analyzed. The results showed that compared with the shCT control cells, the protein distribution of stemness genes OCT4 and SOX2 shifted from multimerization to monomerization, and the total amount of protein synthesis was significantly reduced. The protein distribution of IGF2BP1 also shifted from multimerization to monomerization ( Figure 3 C). This indicates that PARIT1 knockdown inhibits the translation activity of ribosomes.
[0066] Example 4 PARIT1 interacts with IGF2BP1 and promotes the formation of its liquid-liquid phase separation structure 1. Experimental method
[0067] Fluorescence photobleaching recovery experiment (FRAP) clarified the fluidity of GFP-IGF2BP1 phase separation droplets: IGF2BP1 was labeled with green fluorescent protein GFP to construct a fusion protein expression lentiviral vector, which was packaged into lentivirus and co-transfected with PARIT1 overexpression or empty lentivirus into 293T cells. The liquid-liquid phase separation structure formed by GFP was observed using laser confocal microscopy. The fluidity of IGF2BP1 phase separation droplets in cells was verified using fluorescence photobleaching-recovery method, and the promoting effect of PARIT1 overexpression on the formation of IGF2BP1-LLPS structure was analyzed.
[0068] In vitro phase separation experiments confirmed that PARIT1-IGF2BP1-m 6 A. Formation of mRNA-ribosome LLPS: 293T cell cytoplasmic lysate (containing ribosomes and translated mRNA) was extracted by hypotonic lysis, exogenous GFP-IGF2BP1 protein and PARIT1 molecules synthesized by T7 enzyme were added to the lysate, and the interaction between GFP-IGF2BP1 and mRNA was observed by confocal microscopy. 6 A mRNA-ribosome binding and phase separation structure formation, observe the promotion effect of PARIT1 addition on IGF2BP1 phase separation formation, and clarify the "PARIT1-IGF2BP1-m 6 A. Formation of the "mRNA-ribosome" LLPS structure.
[0069] Disruption of phase separation to verify PARIT1-IGF2BP1-m 6 A. Effect of mRNA-ribosome LLPS formation on cell pluripotency: H9 and iPSC cells transfected with PARIT1 overexpression or empty vector were treated with 1,6-hexanediol to destroy the formation of phase separation structure inside cells. FISH-immunofluorescence staining and fluorescence microscopy were used to observe the destruction of the phase separation structure of IGF2BP1 in cells after 1,6-hexanediol treatment, and to analyze the binding of PARIT1 and IGF2BP1. Total RNA and total protein of cells before and after 1,6-hexanediol treatment were extracted, and the changes in stemness gene expression were analyzed to clarify the PARIT1-IGF2BP1-m 6 A. The effect of mRNA-ribosome LLPS formation on cell pluripotency.
[0070] 2. Experimental results
[0071] RNA-FISH-immunofluorescence method was used to study the positional relationship between PARIT1 and IGF2BP1 distributed in the cytoplasm. Laser confocal microscopy showed that PARIT1 (green) and IGF2BP1 (red) distributed in the cytoplasm of human iPSCs had obvious co-localization ( Figure 4 A).
[0072] IGF2BP1 relies on liquid-liquid phase separation (LLPS) mechanism to recognize m 6 A modification, we observed the effect of PARIT1 knockdown on the formation of IGF2BP1 LLPS structure. Figure 4As shown in B, compared with the control cells, PARIT1 knockdown significantly reduced the LLPS concentration structure of IGF2BP1 in the cytoplasm. Three fields of view of the same size were randomly selected from the shCT group and the PARIT1 knockdown group, and the LLPS particles in the cytoplasm were quantitatively analyzed using ImageJ software. The results showed that the number of LLPS particles in the cytoplasm after PARIT1 knockdown was significantly lower than that in the control group ( Figure 4 C), indicating that PARIT1 can promote the formation of IGF2BP1-LLPS structure, and PARIT1 may promote IGF2BP1 to m 6 A. Recognition of modifications.
[0073] In addition, we used RIP-qPCR to detect the regulatory effect of PARIT1 on IGF2BP1 binding to the 3'CRD sequence of stemness genes in cells with PARIT1 knockdown and found that PARIT1 knockdown resulted in a significant decrease in the binding of IGF2BP1 to the 3'CRD sequence of stemness genes ( Figure 4 D).
[0074] Example 5 In other cell types, PARIT1 overexpression can also promote protein translation 1. Experimental methods
[0075] Puromycin incorporation was used to detect the level of nascent proteins. Puromycin was incorporated into 293T cells and H9 cells with PARIT1 overexpression or knockdown, and total protein was extracted 20 minutes later. The amount of puromycin incorporation was detected by Western Blot to observe the effect of PARIT1 on protein translation.
[0076] 2. Experimental results
[0077] The results are as follows Figure 6 As shown, the results showed that compared with the control group, PARIT1 overexpression increased the synthesis of nascent proteins and enhanced the efficiency of protein translation, while PARIT1 knockdown reduced the synthesis of nascent proteins and decreased the efficiency of protein translation.
[0078] Example 6 PARIT1 can increase the protein translation level of the target protein OCT4
[0079] 1. Experimental methods
[0080] In vitro protein translation system (One-step Human IVT Kit, Thermo Scientific TM 88880) to express human OCT4 protein. Using 10 ng of OCT4 cDNA as the expression template, PARIT1 or control RNA was added to the translation system to observe the effect on the expression of OCT4 target protein.
[0081]
[0082] 2. Experimental results
[0083] The results are as follows Figure 7 As shown, the results showed that compared with each control group, the addition of 20ng and 100ng PARIT1 could increase the protein translation level of the target protein OCT4 (lanes 4 and 5).
Claims
1. The use of PARIT1 in the preparation of a reagent for enhancing protein translation efficiency, characterized in that: The nucleotide sequence of PARIT1 is shown in SEQ ID NO:
1.
2. The use according to claim 1, characterized in that: The enhancement of protein translation efficiency includes enhancing protein translation efficiency in cells or enhancing protein translation efficiency in an in vitro protein expression system.
3. Use of an agent for overexpressing PARIT1 in promoting protein translation, characterized in that: The nucleotide sequence of PARIT1 is shown in SEQ ID NO:
1.
4. The use according to claim 3, characterized in that: The reagents include vectors that overexpress PARIT1, active peptides that promote PARIT1 expression, proteins that promote PARIT1 expression, nanoparticles carrying PARIT1, protein microspheres that encapsulate PARIT1, liposomes that encapsulate PARIT1, small molecule compounds that promote PARIT1 expression, and / or any combination thereof.
5. A reagent for enhancing protein translation efficiency, characterized in that The reagent includes PARIT1 or a reagent that overexpresses PARIT1.
6. The reagent according to claim 5, characterized in that The nucleotide sequence of PARIT1 is shown in SEQ ID NO: 1; The reagents include vectors that overexpress PARIT1, active peptides that promote PARIT1 expression, proteins that promote PARIT1 expression, nanoparticles carrying PARIT1, protein microspheres that encapsulate PARIT1, liposomes that encapsulate PARIT1, small molecule compounds that promote PARIT1 expression, and / or any combination thereof.
7. Use of the reagent according to claim 5 or 6 in an in vitro protein expression system.
8. The use according to claim 7, characterized in that: The reagent is capable of promoting the translation of proteins in vitro.
9. A method for enhancing protein translation efficiency in vitro, characterized in that: The method comprises the following steps: introducing PARIT1 or an agent for overexpressing PARIT1 into an in vitro host cell system.
10. The method according to claim 9, characterized in that The nucleotide sequence of PARIT1 is shown in SEQ ID NO: 1; The reagents include vectors that overexpress PARIT1, active peptides that promote PARIT1 expression, proteins that promote PARIT1 expression, nanoparticles carrying PARIT1, protein microspheres that encapsulate PARIT1, liposomes that encapsulate PARIT1, small molecule compounds that promote PARIT1 expression, and / or any combination thereof.