Application of inhibitors targeting LRP6 in regulating residual feed intake in animals

By targeting the LRP6 inhibitor miRNA-96-5p to regulate the proliferation and apoptosis of duck primary hepatocytes, the problem of the unknown regulatory relationship between miRNA-96-5p and LRP6 was solved, effective regulation of the duck's residual feed intake was achieved, and the animal fat metabolism capacity was improved.

CN119185350BActive Publication Date: 2025-09-09ANHUI AGRICULTURAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411116962.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-08-15
Publication Date
2025-09-09
Estimated Expiration
2044-08-15

AI Technical Summary

Technical Problem

There is no report in the prior art on the regulatory relationship between miRNA-96-5p and LRP6 and its role in regulating poultry lipid metabolism and residual feed intake, and the molecular mechanism for duck primary hepatocytes is unclear, which affects the regulation of animal feed efficiency.

Method used

By targeting the LRP6 inhibitor miRNA-96-5p, the proliferation and apoptosis of duck primary hepatocytes were regulated, the animal fat metabolism capacity was improved, and thus the residual feed intake was adjusted.

Benefits of technology

miRNA-96-5p significantly reduced the residual feed intake of ducks by targeting and inhibiting the expression of LRP6 gene, providing a reference for regulating lipid metabolism and residual feed intake in poultry.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119185350B_ABST
    Figure CN119185350B_ABST
Patent Text Reader

Abstract

The present invention discloses an application of an inhibitor targeting LRP6 in regulating the residual feed intake of animals, relating to the field of biotechnology. The inhibitor is miRNA-96-5p, and the sequence of miRNA-96-5p is shown in SEQ ID No. 1. The present invention discloses the mechanism of action of miRNA-96-5p targeting LRP6 to inhibit the proliferation of duck primary cells and promote apoptosis. miRNA-96-5p inhibits the expression of LRP6 by targeting, thereby inhibiting the proliferation of animal primary hepatocytes, promoting the apoptosis of animal primary hepatocytes, improving the animal's fat metabolism capacity, and reducing the animal's residual feed intake, thereby providing a reference basis for exploring the function of miRNA in regulating poultry fat metabolism and residual feed intake.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to application of an inhibitor targeting LRP6 in regulating residual feed intake of animals. Background Art

[0002] Residual feed intake (RFI) is a measure of animal feed efficiency, reflecting the differences in feed requirements for animals with the same production performance. In livestock and poultry, RFI is influenced by multiple biological processes and plays a key role in regulating feed utilization efficiency. Factors such as adipose tissue growth, extracellular matrix formation, inflammation, and immune response are all important factors influencing RFI. The liver is the core organ for poultry lipid metabolism, responsible for approximately 90% of lipid metabolic activity. The growth status of hepatocytes directly determines the efficiency and capacity of lipid metabolism in poultry. In vitro cultured hepatocyte cell lines or primary hepatocytes isolated directly from poultry livers can exhibit most of the physiological functions of the liver.

[0003] MicroRNAs (miRNAs) are small, noncoding RNAs (19-24 nt) in length. They are a class of small, endogenous, evolutionarily conserved RNAs. MiRNAs primarily function by binding to complementary target sequences within messenger RNA (mRNA) and interfering with the translational machinery, thereby preventing or altering protein production. They broadly regulate gene expression in animals, plants, and protozoa. MiRNAs play key roles in lipid processes, including adipocyte differentiation, lipid metabolism, cholesterol metabolism, insulin resistance, and immune responses. Currently, research on miRNA-96-5p has primarily focused on its role in tumorigenesis and progression. Regarding lipid metabolism, Kang et al. found that miR-96-5p promotes adipogenesis by specifically inhibiting Smad7 expression. Desgagné V et al. found that miR-96-5p negatively correlated with intracellular lipid and cholesterol levels by selectively regulating SREBP2. Furthermore, a high-fat diet (HFD) reduced miR-96-5p expression, suggesting that miRNA-96-5p may promote lipid metabolism. Currently, the molecular mechanism by which miRNA-96-5p regulates duck primary hepatocytes is still unclear.

[0004] Low-density lipoprotein receptor-related protein 6 (LRP6), a member of the low-density lipoprotein receptor (LDLR) family, possesses a unique structure and ligand-binding function, playing a crucial role in lipoprotein endocytosis. Tomaszewski et al., while investigating whether common genetic variants in LRP6 are associated with low-density lipoprotein cholesterol, identified LRP6 as a potential regulator of lipid metabolism and a novel target for drug intervention. LRP6 plays a key role in activating the canonical WNT signaling pathway, inhibiting adipogenesis and stimulating osteoblastogenesis. Related studies have also shown that LRP6 can attenuate GSK3β activity, a negative regulator of mTOR signaling, a key pathway regulating adipogenesis. This suggests that LRP6 also plays a role in lipid production. These findings suggest that LRP6 and signaling pathways jointly regulate adipocyte formation and metabolism. However, the regulatory relationship between miRNA-96-5p and LRP6 has not been reported.

[0005] Therefore, the present invention aims to analyze the molecular mechanism of miRNA-96-5p regulating duck primary hepatocytes and its regulatory relationship with LRP6 at the cellular level through the study of the molecular mechanism of proliferation and apoptosis of duck primary hepatocytes, so as to provide a reference for exploring the function of miRNA in regulating poultry lipid metabolism and residual feed intake. Summary of the Invention

[0006] The purpose of the present invention is to provide an application of an inhibitor targeting LRP6 in regulating the residual feed intake of animals, aiming to provide a reference for exploring the function of miRNA in regulating poultry lipid metabolism and residual feed intake.

[0007] The present invention achieves the above-mentioned purpose through the following technical solutions:

[0008] As a first aspect of the present invention, provided is the use of an inhibitor targeting LRP6 in regulating the residual feed intake of animals. The inhibitor is miRNA-96-5p, and the sequence of miRNA-96-5p is shown in SEQ ID No. 1.

[0009] As a further optimization scheme of the present invention, the miRNA-96-5p inhibits the expression of LRP6 gene through targeted inhibition, thereby inhibiting the proliferation of primary hepatocytes of animals, promoting the apoptosis of primary hepatocytes of animals, and improving the fat metabolism capacity of animals, thereby reducing the residual feed intake of animals.

[0010] As a further optimized solution of the present invention, the animal is poultry.

[0011] As a further optimized solution of the present invention, the animal is a duck.

[0012] In a second aspect, the present invention further provides a composition for regulating residual feed intake of animals, comprising miRNA-96-5p, the sequence of which is shown in SEQ ID No. 1.

[0013] The third aspect of the present invention further provides a kit for regulating the residual feed intake of animals, wherein the kit comprises the composition as described above.

[0014] First, the present invention conducted a conservation analysis on miRNA-96-5p from duck and miRNA-96-5p from other species. It was found that miRNA-96-5p is relatively conserved in species such as humans, zebrafish, pigs, and rabbits, while the sequence of miRNA-96-5p from duck showed obvious differences. Subsequently, through miRNA-96-5p target gene prediction and screening, the LRP6 gene was selected as the target gene of miRNA-96-5p for subsequent experiments.

[0015] Next, the present invention discovered that miRNA-96-5p and LRP6 were expressed to varying degrees in the livers of ducks fed high and low residual feed intake (HRFI, LRFI). The expression of miRNA-96-5p in liver tissues fed low residual feed intake was significantly higher than that in liver tissues fed high residual feed intake, while the expression of LRP6 in liver tissues fed high residual feed intake was significantly higher than that in liver tissues fed low residual feed intake. The expression of miRNA-96-5p in liver tissue was negatively correlated with that of LRP6. The liver is an important site for lipid metabolism, and LRP6 plays a crucial role in lipoprotein endocytosis, suggesting a connection between miRNA-96-5p, LRP6, and lipid metabolism regulation.

[0016] Next, the present invention constructed LRP6-WT (wild-type plasmid) and LRP6-MT (mutant plasmid) and co-transfected them with miRNA-96-5p mimics (overexpression plasmid) and mimics NC into 293T cells respectively to identify the targeting relationship between miRNA-96-5p and LRP63′-UTR. It was found that transfection of miRNA-96-5p overexpression plasmid significantly reduced the luciferase activity of LRP6-WT, indicating that miRNA-96-5p exerts its physiological effects by targeting LRP63′-UTR.

[0017] Next, the present invention transfected duck primary hepatocytes with miRNA-96-5p mimics and miRNA-96-5p inhibitor, and detected the expression level of LRP6 gene mRNA in duck primary hepatocytes. It was found that miRNA-96-5p mimics extremely significantly inhibited the expression of LRP6 gene, and miRNA-96-5p inhibitor extremely significantly increased the expression of LRP6 gene. Western blotting was used to detect the expression level of LRP6 protein. The results showed that when miRNA-96-5p mimics was used, the translation of LRP6 protein was inhibited and the protein content was relatively reduced, while when miRNA-96-5p inhibitor was used, the expression of LRP6 protein was increased, indicating that miRNA-96-5p targetedly regulated the expression of LRP6.

[0018] Next, the present invention co-transfected miRNA-96-5p mimics, miRNA-96-5p inhibitor, and LRP6 siRNA, and examined changes in duck primary hepatocyte proliferation using the CCK-8 assay. The miRNA-96-5p mimics significantly inhibited duck primary hepatocyte proliferation, while the miRNA-96-5p inhibitor significantly promoted duck primary hepatocyte proliferation. The results demonstrated that miRNA-96-5p regulated duck primary hepatocyte proliferation, while LRP6 siRNA significantly inhibited cell proliferation. Flow cytometry was used to examine cell apoptosis. The miRNA-96-5p mimics significantly promoted duck primary hepatocyte apoptosis, while the miRNA-96-5p inhibitor significantly inhibited duck primary hepatocyte apoptosis. This suggests that miRNA-96-5p can inhibit duck primary hepatocyte proliferation and promote apoptosis by targeting LRP6.

[0019] Finally, the present invention found that after overexpression of miRNA-96-5p in duck primary hepatocytes, the expression levels of TC and TG decreased extremely significantly (P<0.01); after inhibition of miRNA-96-5p, the expression level of TC increased extremely significantly (P<0.01), and the expression level of TG increased significantly (P<0.05); after knocking down LRP6, the expression levels of TC and TG decreased extremely significantly (P<0.01). Overexpression of miRNA-96-5p in duck primary hepatocytes significantly decreased the expression levels of SREBP1c, FASN, and ACC1 (P<0.01), while inhibition of miRNA-96-5p significantly increased the expression of SREBP1c (P<0.05), and the expression levels of FASN and ACC1 significantly increased (P<0.01). Overexpression of miRNA-96-5p significantly increased the expression levels of FOXO1 and PPARγ (P<0.01), while inhibition of miRNA-96-5p significantly decreased the expression levels of FOXO1 and PPARγ (P<0.01). Knockdown of LRP6 significantly decreased the expression levels of SREBP1c, FASN, and ACC1 (P<0.01), while FOXO1 expression significantly increased (P<0.01), and PPARγ expression significantly increased (P<0.05).

[0020] In summary, the beneficial effects of the present invention are:

[0021] The present invention discovered that miRNA-96-5p targets the expression of LRP6 at the level of duck primary hepatocytes, providing a reference for exploring the function of miRNA in regulating poultry lipid metabolism and residual feed intake. Specifically, miRNA-96-5p inhibits the expression of the LRP6 gene by targeting, thereby inhibiting the proliferation of duck primary hepatocytes, promoting apoptosis of duck primary hepatocytes, and reducing the residual feed intake of ducks. Since the growth state of poultry primary hepatocytes directly determines the lipid metabolism capacity of the livestock and poultry body, and the level of lipid metabolism capacity directly reflects the level of residual feed intake of poultry, it can be concluded that miRNA-96-5p regulates the lipid metabolism capacity of ducks by targeting the expression of LRP6, and can achieve the regulation of the residual feed intake of ducks, providing a reference for the regulatory function of miRNA in the residual feed intake of livestock and poultry. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is the conservation analysis of miRNA-96-5p in different species in Example 1;

[0023] Figure 2 The expression of miRNA-96-5p and LRP6 in the livers of ducks with high and low residual feed intake in Example 2 (in the figure, (a) is miRNA-96-5p; (b) is LRP6);

[0024] Figure 3The relative expression of miRNA-96-5p in different tissues provided in Example 2 of the present invention;

[0025] Figure 4 is the plasmid map of psiCHECK-2 in Example 3;

[0026] Figure 5 are the wild-type and mutant binding sites in Example 3;

[0027] Figure 6 The sequencing results of the wild-type plasmid and mutant plasmid in Example 3 (in the figure, (a) target gene mutant type; (b) target gene wild type);

[0028] Figure 7 For the dual luciferase activity detection in Example 3;

[0029] Figure 8 The duck primary hepatocytes (100×) in Example 4 (in the figure, (a) to (f) are duck primary hepatocytes cultured for 0 days, 1 day, 2 days, 3 days, 4 days, and 5 days);

[0030] Figure 9 The effect of miRNA-96-5p on LRP6 expression in Example 5 (in the figure, (a) miRNA-96-5p expression level after overexpression of miRNA-96-5p; (b) miRNA-96-5p expression level after inhibition of miRNA-96-5p; (c) LRP6 expression level after overexpression and inhibition of miRNA-96-5p; (d) LRP6 protein expression level after overexpression and inhibition of miRNA-96-5p);

[0031] Figure 10 This is the screening of siRNA knockdown efficiency in Example 6 (in the figure, (a) untransfected duck primary hepatocytes; (b) transfected duck primary hepatocytes);

[0032] Figure 11 For identification of siRNA in Example 6 (100×);

[0033] Figure 12 The effect of miRNA-96-5p on the proliferation of duck primary hepatocytes in Example 6;

[0034] Figure 13 The effect of LRP6 on the proliferation of duck primary hepatocytes in Example 6;

[0035] Figure 14 The effect of miRNA-96-5p on apoptosis of duck primary hepatocytes in Example 6 (Figure, (a) effect of overexpression of miRNA-96-5p on apoptosis of duck primary hepatocytes; (b) effect of inhibition of miRNA-96-5p on apoptosis of duck primary hepatocytes);

[0036] Figure 15 The effect of miRNA-96-5p on lipid indicators TC and TG in Example 7 (in the figure, (a) is TC; (b) is TG);

[0037] Figure 16 The effect of miRNA-96-5p on lipid-related gene expression in Example 7 (in the figure, (a) is the SR EBP1c gene; (b) is the FASN gene; (c) is the ACC1 gene; (d) is the FOXO1 gene; and (e) is the PPARγ gene);

[0038] Figure 17 The effect of knocking down LRP6 on the lipid indicators TC and TG in Example 7 (in the figure, (a) is TC; (b) is TG);

[0039] Figure 18 The effect of knocking down LRP6 on the expression of lipid-related genes in Example 7 (in the figure, (a) is the SREBP 1c gene; (b) is the FASN gene; (c) is the ACC1 gene; (d) is the FOXO1 gene; and (e) is the PP ARγ gene);

[0040] Note: In the above figures, * indicates significant difference at P < 0.05, and ** indicates extremely significant difference at P < 0.01. DETAILED DESCRIPTION

[0041] The present application is described in further detail below in conjunction with the accompanying drawings. It is necessary to point out that the following specific implementation methods are only used to further illustrate the present application and cannot be understood as limiting the scope of protection of the present application. Technicians in this field can make some non-essential improvements and adjustments to the present application based on the above application content.

[0042] 1. Materials and Methods

[0043] The meat duck tissues used in the following examples were collected from the National Core Breeding Farm of Huangshan Qiangying Duck Industry Co., Ltd. The meat ducks were collected at 42 days of age and had complete pedigree records.

[0044] The primary duck hepatocytes used are isolated and cultured from 15-day-old duck embryos by the Poultry Biobreeding and Health Farming Team of the College of Animal Science and Technology at Anhui Agricultural University. Before hatching, the embryos are first wiped with 75% alcohol and cotton, placed in a clean egg tray to dry, and then incubated at a constant temperature of 37.8% and 65% relative humidity. After 15 days of incubation, duck embryos with normal embryonic development are selected for the isolation and culture of primary duck hepatocytes.

[0045] The experimental animal sampling and related experimental procedures were carried out in strict accordance with the experimental animal license and ethical requirements of Anhui Agricultural University (SYXK 2016-007).

[0046] Unless otherwise specified, the experimental methods in the following examples can be carried out according to conventional methods. The materials and reagents used can be obtained through commercial channels.

[0047] Example 1 Conservation Analysis of miRNA-96-5p and Prediction of Binding Sites with Target Gene LRP6

[0048] 1.1 Conservation analysis of miRNA-96-5p in different species

[0049] The sequences of miRNA-96-5p from different species, including human (Homo sapiens), zebrafish (D anio rerio), pig (Sus scrofa), and chicken (Gallus gallus), were searched in the RNAcentral (https: / / rnacentral.org / ) database. Based on the sequence of miRNA-96-5p (as shown in SEQ ID No. 1), the conservation of miRNA-96-5p among different species was observed.

[0050] Sequence comparison revealed that miRNA-96-5p is relatively conserved in species such as humans, zebrafish, pigs, and rabbits. Figure 1 The mature sequence is TTGGCACTAGCACATTTTTG, while in duck the conserved sequence is TTGGCACT, showing obvious differences.

[0051] 1.2 Prediction of binding sites between miRNA-96-5p and target gene LRP6

[0052] To evaluate the targeting relationship between miRNA-96-5p and its target gene, LRP6, we accessed the NCBI website (www.ncbi.nim.nih.gov) and obtained its sequence information using its GenBank accession number (XM_038172428.1). Based on the miRNA-96-5p sequence (shown in SEQ ID No. 1), we used RNAhybrid software to predict and analyze the binding sites between miRNA-96-5p and its target gene, LRP6. Analysis of the RNAhybrid predictions revealed the specific binding sites between miRNA-96-5p and LRP6, as well as the binding energies and complementarity of these sites.

[0053] Table 1 Binding sites of miRNA-96-5p and target genes

[0054]

[0055] As shown in Table 1 , the lower the binding energy, the higher the degree of complementarity, indicating that the binding between miRNA and target gene is more stable and the targeting relationship is more likely to be established. Therefore, LRP6 gene was selected as the target gene of miRNA-96-5p for subsequent experiments.

[0056] Example 2 Expression Analysis of miRNA-96-5p and LRP6 in Liver Tissues of High and Low RFI Meat Ducks

[0057] 2.1 Total RNA extraction

[0058] Six liver tissue samples were randomly selected from 42-day-old high and low RFI broiler ducks, and six liver, thymus, breast muscle and spleen tissue samples were randomly selected from 42-day-old broiler ducks (healthy and strong individuals with similar weight) for total RNA extraction. The total RNA was extracted using the Kangwei Century Ultrapure RNA Kit (DNase I) and the quality of the extracted total RNA was detected by agarose gel electrophoresis and Nanodrop spectrophotometer.

[0059] 2.2 Design of primers for miRNA-96-5p and target genes

[0060] Primer sequences were designed based on the miRNA-96-5p sequence, using the internal reference gene U6. The target gene LRP6 sequence was retrieved from the NCBI website (www.ncbi.nim.nih.gov). Primers were designed using Primer 5.0 software, using the internal reference gene β-actin. All primers were synthesized by Sangon Biotech Co., Ltd. (Shanghai). The sequence design is shown in Table 2.

[0061] Table 2 Reverse transcription primers

[0062]

[0063] 2.3 cDNA Synthesis

[0064] The EasyScript One-Step gDNA Removal and cDNA Synthesis SuperMix (Cat. No. AE-311) gold reverse transcription kit was used in a 20 μL system. The components are shown in Table 3. After mixing, the mixture was incubated in a 42°C water bath for 1 hour to generate first-strand cDNA. The reverse-transcribed cDNA was diluted 2.5-5.0 times with H2O before subsequent fluorescent quantitative PCR reactions.

[0065] Table 3 Reverse transcription system

[0066]

[0067] 2.4 Fluorescence quantitative PCR

[0068] Expression analysis was performed using SYBR Green I real-time fluorescence quantitative PCR using the TransStart Green qPCR SuperMix (Cat. No. AQ131-01) in a 20 μL reaction volume. Three replicates were performed for each sample. The specific reaction system and amplification procedures are shown in Tables 4 and 5.

[0069] Table 4 Reaction system

[0070]

[0071] Table 5 Real-time fluorescence quantitative PCR amplification program

[0072]

[0073] 2.5 Statistical analysis

[0074] The results of fluorescence quantification in the experiment were preprocessed and sorted using Excel 2021. According to the Ct value of the target gene and the Ct value of the internal reference gene obtained in the experiment, 2 -ΔΔCt Statistical analysis was performed using the calculation method. Data analysis and graphics were performed using GraphPad Prism 6 software. * indicates a significant difference (P < 0.05), and ** indicates an extremely significant difference (P < 0.01).

[0075] The results are as follows Figure 2 As shown in the data, miRNA-96-5p and LRP6 were expressed in the liver tissues of ducks with high and low RFI. The expression of miRNA-96-5p in low RFI (calculated as LRFI) was higher than that in high RFI (calculated as HRFI), and the difference was extremely significant (P<0.01). The expression of LRP6 in the liver tissue of ducks with high RFI was higher than that in the liver tissue of ducks with low RFI, and the difference was extremely significant (P<0.01).

[0076] The relative expression of miRNA-96-5p in liver, thymus, spleen and pectoral muscle was also detected. Figure 3 The relative expression level of miRNA-96-5p in the liver was higher, and the difference was extremely significant (P<0.01). The results showed that hepatocytes could be used for subsequent experiments.

[0077] Example 3 Dual luciferase assay

[0078] 3.1 Construction of dual luciferase expression vector for miRNA and target gene

[0079] (1) Select psiCHECK-2 plasmid as the vector. Figure 4, according to the sequences on both sides of the binding site of miRNA-96-5p and the target gene LRP6 wild type and mutant types, such as Figure 5 , and the primer sequences for the restriction sites at both ends are shown in Table 6;

[0080] (2) PCR amplification was used to obtain fragment PCR products. The wild-type (WT) and mutant (MT) target fragments were recombined into the target vector psiCHECK-2 (XhoI-NotI enzyme-digested vector) by multi-segment recombination. The resulting products were recovered and purified by 0.8% agarose gel electrophoresis.

[0081] (3) Digest the vector with restriction endonucleases. The entire experimental process should be performed on ice. The double enzyme digestion reaction system is shown in Table 7; the ligation system is shown in Table 8. After adding the relevant reagents, mix thoroughly and place in a constant temperature environment at 52°C for 30 minutes.

[0082] (4) Recombinant plasmid transformation: Pipette 1-3 μL of plasmid with a concentration of about 100 ng / μL into 100 μL of competent cells, gently shake and rotate to mix, place on ice for 3 minutes, then place in a 42°C water bath for 90 seconds, place in an ice bath for about 3 minutes, add 500-800 μL of 37°C pre-warmed LB medium to each tube, and gently shake at 37°C at 200 rpm for 40 minutes;

[0083] (5) Screening and identification of positive clones: Prepare agar plates containing the corresponding resistance, take 100 μL of bacterial solution and spread it on the agar plate containing the corresponding resistance. Use a sterile glass spreader to gently spread the bacteria on the surface of the plate. Place the plate at 37℃ for 15 minutes. Invert the plate and incubate at 37℃ for 12-16 hours until colonies appear. Shake the plate at 37℃ at 250 rpm for 14 hours. Use the bacterial solution for PCR identification, 0.5 μL of primers, 2 μL of template bacterial solution, 0.5 μL of polymerase buffer, 3 μL of buffer, and 14 μL of ddH2O. Cycling parameters: 96℃ initial denaturation for 3 minutes; 95℃ for 15 seconds, 58℃ for 15 seconds, and 72℃ for 20 seconds, 23 cycles; final extension at 72℃ for 1 minute. Send the positive clone bacterial solution to a biological company for sequencing.

[0084] (6) Use the instructions of the plasmid mini-extraction kit of General Biotechnology (Anhui) Co., Ltd. to extract the plasmid and determine whether the plasmid is successfully constructed based on the sequencing results. The results are as follows: Figure 6 The designed sequence was consistent with the sequencing results, and the results showed that the wild-type and mutant recombinant plasmids of the target gene were successfully constructed.

[0085] Table 6 Target gene primer sequences

[0086]

[0087]

[0088] Table 7 Double enzyme digestion system

[0089]

[0090] Table 8 Connection system

[0091]

[0092] 3.2293T cell transfection

[0093] 293T cells were routinely cultured in DMEM medium containing 10% fetal bovine serum (BI) at 37°C in a humidified incubator with 5% CO2. After culturing the 293T cells, the miRNA-96-5p sequence was obtained, and miRNA-96-5p mimics, inhibitors, mimics NC, and inhibitor NC were designed. The sequences are shown in Table 9. These sequences were synthesized by Shanghai Jima Pharmaceutical Technology Co., Ltd. When the 293T cells reached 80%-90% confluency, they were transfected with the psiCHECK-2, LRP6-WT, and LRP6-MT vectors, along with the miRNA-96-5p mimics and mimics NC, respectively.

[0094] Table 9 miRNA-96-5p mimics and inhibitor sequence information

[0095]

[0096]

[0097] 3.3 Dual luciferase activity analysis

[0098] Discard any remaining medium from the cell culture plate, wash twice with PBS, and discard the supernatant. Add 100 μL of 1× Cell Lysis Buffer to the culture wells for passive cell lysis. Gently shake the plate at room temperature for 5-10 minutes. Centrifuge at 12,000 rpm for 2 minutes. Transfer the supernatant to a 96-well black microplate, 20 μL per well, with three replicates per sample. Start the multi-function microplate reader, set the parameters and sensitivity, and read the plate for 5 seconds. The assay is complete within 5 minutes. Add 100 μL of LRB II reagent to each well to measure firefly luciferase activity (Firefly value). Remove the assay plate and add 100 μL of Renilla reagent to each well to measure Renilla luciferase activity (Renilla value). Determine relative luciferase activity based on the ratio of firefly luciferase activity to Renilla luciferase activity.

[0099] The results are as follows Figure 7Under the condition that the overall experimental system of 293T cells was stable and reliable, after the introduction of miRNA-96-5p mimics, the LRP6 wild-type plasmid (LRP6-WT) significantly inhibited the expression of luciferase due to the binding of LRP6 to miRNA-96-5p (P<0.05). The results showed that there was a targeting relationship between miRNA-96-5p and LRP6.

[0100] Example 4 Isolation and culture of duck primary cells

[0101] Duck embryos hatched to 15 days old were used to isolate and culture duck primary hepatocytes using type IV collagenase, and then cultured in a cell culture incubator at 37°C and 5% CO2. The morphology of duck primary hepatocytes was observed and photographed. Figure 8 In the early stages of culture, duck primary hepatocytes were translucent, spherical or elliptical in shape, with clear boundaries and large nuclei. Over time, the cells began to adhere to the wall. After 48 hours of culture, the number of adherent cells increased, taking on a typical epithelial-like polygonal morphology. The cells became flatter and thinner, their volume increased, and island-like connections began to form between the cells.

[0102] Example 5 Effect of miRNA-96-5p on LRP6

[0103] 5.1 Transfection of duck primary hepatocytes

[0104] Duck primary hepatocytes were seeded in 12-well cell culture plates at a cell density of 5×10 5 cells / well. When the cell confluency reached 70%, transfection was performed using Lipofectamine 2000. Experimental groups: miRNA-96-5p mimics NC and miRNA-96-5p mimics; miRNA-96-5p inhibitor NC and miRNA-96-5p inhibitor. Specific steps are as follows:

[0105] (1) Dilute 2.5 μL of mimics (final concentration 50 nM) and 5 μL of inhibitor (final concentration 100 nM) in 100 μL Opti-MEM, and mix thoroughly by pipetting 3–5 times.

[0106] (2) Gently invert to mix the transfection reagent. Dilute 2.5 μL Lipofectamine 2000 with 100 μL Opti-MEM, pipette gently 3-5 times to mix, and let stand at room temperature for 5 minutes.

[0107] (3) Separately mix the transfection reagent dilution and each group of mimics and inhibitor dilutions, pipette gently 3-5 times to mix, and let stand at room temperature for 15 minutes;

[0108] (4) Add the transfection complex to each well (207.5 μL / well), add 800 μL of Opti-ME M to each well, and gently shake the cell culture plate back and forth to mix evenly. After 6-8 hours, change the medium and add 1 mL of complete culture medium to each well;

[0109] (5) The cell culture plate was placed in a 37°C, 5% CO2 incubator and the cells were collected after 48 hours for fluorescence quantitative PCR detection.

[0110] 5.2 Fluorescence quantitative PCR

[0111] Forty-eight hours after transfection with each miRNA-96-5p mimic and inhibitor, the culture medium was discarded from primary duck hepatocytes. 500 μL of trypsin was added to each well for 2 minutes. Digestion was terminated by adding 500 μL of complete culture medium to each well. The cells were centrifuged at 2000 rpm for 5 minutes, and the supernatant was discarded. The cell pellet was washed twice with PBS and finally resuspended in 100 μL of PBS. 1 mL of Trizol was added to each cell aliquot, and the fluorescence quantitative PCR procedure was performed as in 2.4.

[0112] 5.3 Western blotting to detect LRP6 protein expression after transfection of miRNA-96-5p mimics and inhibitor

[0113] (1) Sample collection and processing: The cell density was 1×10 6 cells / well, 5 μL of mimics and 10 μL of inhibitor of each group were diluted with 200 μL Opti-MEM, and the cells were plated in 6-well plates. The number of inoculated cells, transfection reagent and transfected RNA dose were all ×2 times.

[0114] (2) Protein electrophoresis PAGE gel preparation: Protein electrophoresis was performed using 8% separation gel and 5% stacking gel. The 8% separation gel consisted of 1.3 mL 30% acrylamide, 1.3 mL 1.5 M Tris-HCl (Ph 8.8), 0.05 mL 10% SDS, 0.05 mL 10% ammonium persulfate, 0.003 mL TEMED, and 2.3 mL H2O. The 5% stacking gel consisted of 0.33 mL 30% acrylamide, 0.25 mL 1.5 M Tris-HCl (Ph 6.8), 0.02 mL 10% SDS, 0.02 mL 10% ammonium persulfate, 0.002 mL TEMED, and 1.4 mL H2O.

[0115] (3) SDS-PAGE protein electrophoresis and transfer: After boiling and cooling, the protein sample is centrifuged instantaneously. The liquid on the tube wall is centrifuged to the bottom of the tube. About 25 μL of the sample is added to the sample loading well. The stacking gel is run at 80V constant voltage for 20 minutes. The voltage is adjusted to 120V and the run is continued until all the loading buffer has run out of the PAGE gel. After the electrophoresis is completed, the PAGE gel is removed and cut according to the molecular weight of the target protein and the internal reference. At the same time, the PVDF membrane is cut to the same size as the PAGE gel. Before transfer, the PVDF membrane is soaked in 100% formaldehyde for about 20-30 seconds to activate the membrane. This experiment uses a PVDF membrane with a pore size of 0.45μm. From cathode to anode, a transfer tank is prepared in the following order: filter paper (3 to 5 layers of 3M filter paper) --- PAGE gel --- PVDF membrane --- filter paper (3 to 5 layers of 3M filter paper). The transfer tank is placed in the transfer tank, transfer buffer is added, and a wet transfer system (semi-dry transfer equipment) is used. The transfer time is 300mA constant current for 35-40min. The transfer time of different proteins is related to their molecular weight. The larger the molecular weight, the longer the transfer time. The transferred membrane is taken out to observe whether the transfer is complete (observed according to the pre-stained color protein mark), and rinsed twice with 0.5‰ TBST to block the transferred membrane.

[0116] (4) Western blotting and ECL exposure photography: Place the transferred PVDF membrane in blocking solution and block overnight at 4℃ or 1-2h at 37℃. The blocking solution is 2%-5% BSA solution prepared in TBST (mass volume ratio, 5g BSA + 100mL TBST). Both TBST and PBST can be used, as above and below; Incubate the primary antibody: Use blocking solution to dilute the target protein primary antibody Anti-LRP6 (rabbit polyclonal antibody: 180KD) to 1:2000, and the internal reference GAPDH (rabbit polyclonal antibody: 36KD) to 1:5000, and incubate at 4℃ overnight; Wash: Wash 5 times with TBST, and wash vigorously on a horizontal shaker for 3min / time; Incubate the secondary antibody: Use blocking solution to dilute the HRP-labeled secondary antibody (goat anti-rabbit IgG antibody) to 1:3000, and incubate at room temperature for 1-2h; Wash: Wash 5 times with TBST, and wash vigorously on a horizontal shaker for 3min n / times; Mix 500 μL of ECL Luminescent Solution A and 500 μL of ECL Luminescent Solution B. Pipette the mixture dropwise onto the PVDF membrane parallel to the protein. Allow to react for about 20 seconds. Place the PVDF membrane in a chemiluminescent instrument, adjust the exposure time, and take a photo.

[0117] The results are as follows Figure 9, indicating that when miRNA-96-5p mimics were transfected into duck primary hepatocytes, the expression of miRNA-96-5p was extremely significantly increased after overexpression of miRNA-96-5p (P<0.01); when miRNA-96-5 inhibitor was transfected into duck primary hepatocytes, the expression of miRNA-96-5p was significantly decreased after inhibition of miRNA-96-5p (P<0.05); overexpression of miRNA-96-5p extremely significantly inhibited the expression of LRP6 (P<0.01), while inhibition of miRNA-96-5p extremely significantly promoted the expression of LRP6 (P<0.01);

[0118] Western blotting was used to detect the expression of LRP6 protein. After overexpression of miRNA-96-5p, LRP6 protein translation was inhibited and the protein content was relatively reduced. After inhibition of miRNA-96-5p, LRP6 protein expression was increased, which was consistent with the trend of fluorescence quantitative PCR, indicating that miRNA-96-5p targets LRP6 at the level of duck primary hepatocytes.

[0119] Example 6 Effects of miRNA-96-5p and LRP6 on primary duck hepatocytes

[0120] 6.1 siRNA efficiency detection and identification

[0121] Based on the LRP6 sequence information, siRNA sequences were designed and synthesized, named siRNA-1, siRNA-2, and siRNA-3, respectively. The sequence information is shown in Table 10. There were two control groups: a negative control siRNA, named siRNA NC, and a control group siRNA with a FAM fluorescent label, named FAM-siRNA. Both sequences were synthesized by Shanghai Jima Pharmaceutical Technology Co., Ltd. Duck primary hepatocytes were seeded in 12-well cell culture plates at a cell density of 5×10 5 cells / well. When the cell confluency reaches 70%, transfection is performed using lipofectamine 2000. The transfection steps are as follows:

[0122] (1) Dilute 10 μL of each siRNA with 100 μL Opti-MEM (final concentration 200 nM), pipette gently 3-5 times to mix, gently invert to mix the transfection reagent, dilute 2.5 μL Lipofectamine 2000 with 100 μL Opti-MEM, pipette gently 3-5 times to mix, and let stand at room temperature for 5 minutes;

[0123] (2) Mix the transfection reagent dilution and each siRNA dilution separately, pipette gently 3-5 times to mix, and let stand at room temperature for 15 minutes;

[0124] (3) Add the transfection complex to each well (212.5 μL / well), then add 800 μL of Opti-ME M to each well. Gently shake the cell culture plate back and forth to mix evenly. After 6-8 hours, replace the medium and add 1 mL of complete culture medium to each well. Place the cell culture plate in a 37°C, 5% CO2 incubator. After 48 hours, collect the cells and use fluorescent quantitative PCR to detect the interference efficiency of each siRNA.

[0125] Fluorescence quantitative PCR was used to detect the knockdown efficiency of each siRNA. The steps of fluorescence PCR detection were the same as those in 2.4. The results were as follows: Figure 10 , the proportion of duck primary hepatocytes emitting green fluorescence accounted for more than 80%. The results showed that the transfection efficiency was good and subsequent experiments could be carried out. siRNA-1 and siRNA-2 significantly reduced the expression of LRP6 (P<0.01), and siRNA-3 significantly reduced the expression of LRP6 (P<0.05). Among them, the expression levels of siRNA-1, siRNA-2 and siRNA-3 were 82%, 46% and 84% respectively. The knockdown efficiency of the three siRNA test groups was calculated to be 18%, 54% and 16% respectively. Figure 11 The results showed that siRNA-2 was the best interference sequence.

[0126] Table 10 siRNA sequence information

[0127]

[0128] 6.2 Detection of duck primary cell proliferation by CCK-8 assay

[0129] In this study, CCK-8 assay was used to detect the changes in the proliferation capacity of duck primary hepatocytes after transfection of miRNA-96-5p mimics, inhibitors and siRNAs. The cells were seeded in 96-well culture plates at 2-3×10 4 cells / well. Transfection was performed when the cell confluency reached 70%. The specific steps are as follows:

[0130] (1) Dilute mimics NC, mimics, inhibitor NC, and inhibitor with Opti-MEM, i.e., mimics group: 35 μL Opti-MEM + 1.75 μL mimics RNA, final concentration is 50 nM; inhibitor group: 35 μL Opti-MEM + 3.5 μL inhibitor RNA, final concentration is 100 nM;

[0131] (2) Gently invert the transfection reagent and dilute 1.75 μL of Lipofectamine 2000 with 35 μL of Opti-MEM for each group. Gently pipette 3 to 5 times to mix thoroughly. Let stand at room temperature for 5 minutes. Prepare a total of 4 tubes of the same reagent.

[0132] (3) Mix the transfection reagent dilution and each group of dilutions separately to form a transfection complex, pipette gently 3 to 5 times to mix, and let it stand at room temperature for 15 minutes;

[0133] (4) First, add 90 μL / well of fresh DMEM medium (containing 10% FBS) to each well, then add the transfection complex to each well at 10 μL / well. Gently shake the cell culture plate back and forth to mix evenly. Place the cell culture plate in a 37°C, 5% CO2 incubator and culture for 48 h.

[0134] (5) 48 h after transfection, add 10 μL of CCK-8 reagent to each well (including 6 blank control wells), gently tap the culture dish to mix it, place it in a 37°C incubator, continue to culture for 1 h, read the results at a wavelength of 450 nm on a microplate reader, and save the data.

[0135] The results are as follows Figure 12 Overexpression of miRNA-96-5p significantly inhibited the proliferation of duck primary hepatocytes (P<0.01), while inhibition of miRNA-96-5p significantly promoted the proliferation of duck primary hepatocytes (P<0.01). Figure 13 The results showed that knockdown of LRP6 significantly inhibited cell proliferation (P<0.01).

[0136] 6.3 Detection of apoptosis in primary duck hepatocytes by flow cytometry

[0137] The cell inoculation and transfection process are the same as 6.2. The cell density is 5×10 5 Cells were plated at 400 μL per well. 2.5 μL of mimics and 5 μL of inhibitor were diluted in 100 μL of Opti-MEM. Cells were plated in 12-well plates. 48 hours after transfection, cells were harvested by trypsinization. Flow cytometry was performed using the Annexin V-FITC / PI Apoptosis Detection Kit (Lianke Biotechnology, AP101-100) to detect changes in apoptosis in duck primary hepatocytes following transfection with mimics and inhibitors. The steps were as follows:

[0138] (1) 48 h after transfection, aspirate the cell culture medium into a suitable centrifuge tube, wash the cells once with PBS, and digest the cells with an appropriate amount of trypsin;

[0139] (2) After cell digestion, add the collected cell culture medium and mix briefly, transfer to a centrifuge tube, centrifuge at 1000g for 5 minutes, discard the supernatant, collect the cells, gently resuspend the cells in PBS and count;

[0140] (3) Take 1~5×10 5 The resuspended cells were centrifuged at 1000 g for 5 min, the supernatant was discarded, and 500 μL of 1× Binding Buffer (the stock solution was 5×, which was diluted to 1× with deionized water before use) was added and the cells were gently resuspended;

[0141] (4) Add 5 μL Annexin V-FITC and 10 μL PI to each group and mix gently;

[0142] (5) Incubate at room temperature (20-25°C) in the dark for 10 min;

[0143] (6) Flow cytometry was then performed. Annexin V-FITC was detected using the FITC detection channel (Ex = 488 nm; Em = 530 nm) and PI was detected using the PI detection channel (Ex = 535 nm; Em = 615 nm).

[0144] The results are as follows Figure 14 Overexpression of miRNA-96-5p significantly promoted apoptosis of duck primary hepatocytes (P<0.01), while inhibition of miRNA-96-5p significantly inhibited apoptosis of duck primary hepatocytes (P<0.05).

[0145] 6.4 Data analysis and significance tests were performed using SPSS 19.0 software to ensure the accuracy and reliability of the results. Graphs were generated using GraphPad Prism 6. * indicates a significant difference (P < 0.05), and ** indicates an extremely significant difference (P < 0.01).

[0146] Example 7

[0147] 7.1 Detection of the Effect of miRNA-96-5p on Lipid Indicators TC and TG and Lipid-Related Genes

[0148] 7.1.1 Detection of the Effect of miRNA-96-5p on Lipid Indicators TC and TG

[0149] The cell seeding and transfection procedures were the same as described in 6.2. At a cell density of 1 × 106 cells / well, 5 μL of each mimic and 10 μL of the inhibitor were diluted in 200 μL of Opti-MEM and plated into 6-well plates. Forty-eight hours after transfection, cells were trypsinized and washed with PBS. The cell pellet was collected and assayed for total cholesterol (TC) and triglyceride (TG) according to the instructions of the assay kits (Nanjing Jiancheng Bioengineering Institute).

[0150] like Figure 15As shown in the results, the expression levels of TC and TG in duck primary hepatocytes decreased extremely significantly after overexpression of miRNA-96-5p (P<0.01), while the expression levels of TC and TG in duck primary hepatocytes increased extremely significantly (P<0.01) and significantly increased (P<0.05) after inhibition of miRNA-96-5p. The results indicated that miRNA-96-5p promoted lipid metabolism.

[0151] 7.1.2 Detection of the Effect of miRNA-96-5p on Lipid-Related Genes

[0152] The cell inoculation and transfection process were the same as in 5.1. The cell density was 5×10 5 Cells were plated at 400 μL per well. 2.5 μL of mimics and 5 μL of inhibitor were diluted in 100 μL of Opti-MEM and plated into 12-well plates. 48 hours after transfection, cells were harvested by trypsinization and analyzed by quantitative fluorescence PCR for SREBP1c, ACC1, FASN, PPARγ, and FOXO1, using β-actin as an internal control. Primer sequences are shown in Table 11. The quantitative fluorescence PCR procedure was the same as in Section 5.2.

[0153] Table 11 Primer sequence information

[0154]

[0155]

[0156] like Figure 16 As shown in the results, overexpression of miRNA-96-5p in duck primary hepatocytes significantly decreased the expression levels of SREBP1c, FASN and ACC1 (P<0.01), while inhibition of miRNA-96-5p significantly increased the expression levels of SREBP1c (P<0.05), and extremely significantly increased the expression levels of FASN and ACC1 (P<0.01); overexpression of miRNA-96-5p in duck primary hepatocytes significantly increased the expression levels of FOXO1 and PPARγ (P<0.01), while inhibition of miRNA-96-5p significantly decreased the expression levels of FOXO1 and PPARγ (P<0.01). These results again indicated that miRNA-96-5p promoted lipid metabolism.

[0157] 7.2 Detection of the Effect of LRP6 on Lipid Indicators TC and TG and Lipid-Related Genes

[0158] 7.2.1 Detection of the Effect of LRP6 on Lipid Indices TC and TG

[0159] Duck primary hepatocytes were seeded in 6-well cell culture plates at a cell density of 1×10 6cells / well. When the cell confluency reaches 70%, transfection is performed using lipofectamine 2000. The specific steps are as follows:

[0160] (a) Dilute siRNA-220 μL with 200 μL Opti-MEM to a final concentration of 200 nM and mix thoroughly by pipetting gently 3-5 times.

[0161] (b) Gently invert the tube to mix the transfection reagent. Dilute 5 μL of Lipofectamine 2000 with 200 μL of Opti-MEM. Gently pipette 3–5 times to mix thoroughly. Let stand at room temperature for 5 min.

[0162] (c) Mix the transfection reagent dilution and each siRNA dilution separately, pipette gently 3-5 times to mix thoroughly, and let stand at room temperature for 15 minutes;

[0163] (d) Add the transfection complex to each well (425 μL / well), then add 1600 μL of Opti-ME M to each well. Gently shake the cell culture plate back and forth to mix thoroughly. After 6-8 h, replace the medium with 2 mL of complete medium per well.

[0164] (e) The cell culture plate was placed in a 37°C, 5% CO2 incubator. 48 h after transfection, the cells were trypsinized and washed with PBS. Finally, the cell pellet was collected and assayed according to the instructions of the TC and TG detection kits (Nanjing Jiancheng Bioengineering Institute).

[0165] like Figure 17 As shown in the results, the expression levels of TC and TG in duck primary hepatocytes were extremely significantly decreased after knocking down LRP6 (P<0.01), which was consistent with the expression trend of TC and TG in duck primary hepatocytes after overexpression of miRNA-96-5p, indicating that miRNA-96-5p can promote lipid metabolism by targeting LRP6.

[0166] 7.2.2 Detection of the Effect of LRP6 on Lipid Indices TC and TG

[0167] The transfection steps are the same as 6.1, and the detection steps of lipid-related genes are the same as 7.1.2.

[0168] like Figure 18 As shown in the results, after knockdown of LRP6, the expression levels of SREBP1c, FASN and ACC1 were extremely significantly decreased (P<0.01), the expression level of FOXO1 was extremely significantly increased (P<0.01) and the expression level of PPARγ was significantly increased (P<0.05), which was consistent with the expression trend of SREBP1c, FASN, ACC1, FOXO1 and PPARγ in duck primary hepatocytes after overexpression of miRNA-96-5p, once again indicating that miRNA-96-5p can promote lipid metabolism by targeting LRP6.

[0169] The above-described embodiments merely illustrate several implementations of the present invention. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, and all such variations and improvements fall within the scope of protection of the present invention.

Claims

1. Targeting LRP6 The use of an inhibitor in regulating the residual feed intake of animals is characterized by: The animal is a duck, the inhibitor is miRNA-96-5p, and the sequence of miRNA-96-5p is shown as SEQ ID No.

1.

2. The use according to claim 1, characterized in that miRNA-96-5p inhibits LRP6 The expression of the gene can inhibit the proliferation of duck primary hepatocytes, promote the apoptosis of duck primary hepatocytes, enhance the fat metabolism ability of ducks and reduce the residual feed intake of ducks.

Citation Information

Patent Citations

  • MicroRNA molecular marker related to residual feed intake of ducks and application of microRNA molecular marker

    CN114196763A

  • Gene expression regulator, prophylactic drug or therapeutic drug for alzheimer's disease, and method for improving dementia

    JP2023139438A