Sunflower disc extract, composite liposome and application of sunflower disc extract and composite liposome in preparation of drugs for reducing inflammatory response and uric acid

Abstract

The invention relates to the technical field of sunflower disc related raw materials, in particular to sunflower disc lipidosome and application thereof in preparation of products for reducing uric acid and dissolving tophus. The sunflower disc lipidosome is formed by self-assembling ferrocene sunflower disc peptide, alkaloid and flavone as raw materials, and can reduce uric acid, dissolve ventilation stone, balance in-vivo acid-base balance, inhibit synthesis of uric acid by xanthine oxidase, promote in-vivo uric acid excretion and intestinal tract movement, repair damaged liver and kidney cells, diminish swelling, resist inflammation, relieve pain and prevent and treat hyperuricemia. Gout inflammation is relieved, blood pressure is reduced, and immunity is improved.

Description

Technical Field

[0001] The invention relates to the technical field of sunflower disk-related raw materials, and in particular to a sunflower disk peptide, a composite liposome and applications thereof in the preparation of a preparation for reducing inflammatory response and uric acid. Background Art

[0002] Sunflower is an annual plant of the genus Helianthus in the Asteraceae family. It is a medicinal plant worth developing and utilizing. It is sweet, warm in nature, and non-toxic. Its functions and indications include clearing away heat, promoting diuresis, promoting urination, and treating gastric cancer. The chemical components of sunflower are diverse, including sesquiterpenoid lactones, diterpenoids, sesquiterpenoids, monoterpenoids, flavonoids, coumarins, and sterols, among which sesquiterpenoid lactones and diterpenoids are the most common. Sesquiterpenoids, flavonoids, and alkane components are mostly concentrated in the leaves, while aromatic components are mostly concentrated in the seeds. The variable structural types and spatial configurations of the compounds in sunflowers make them present a wide range of biological activities. Sunflower seeds have significant therapeutic effects in terms of anthelmintics, anti-tumor, and anti-aging; sunflower discs have multiple effects such as anti-tumor, anti-angina, antibacterial, analgesic, and lowering blood pressure; sunflower leaves have antihypertensive, antibacterial, and hypoglycemic effects; sunflower stems have anti-tumor and laxative effects; and sunflower roots have significant therapeutic effects in terms of antibacterial. However, there is still great potential to fully develop sunflower-related active ingredients to provide further assistance in drug development and application. Summary of the invention

[0003] In view of this, the present invention provides sunflower disc liposomes and their use in the preparation of products for reducing uric acid and dissolving tophi. The sunflower disc liposomes are self-assembled with ferrocene sunflower disc peptide, alkaloids and flavonoids as raw materials, and can reduce uric acid, dissolve tophi, balance the acid-base balance in the body, inhibit xanthine oxidase from synthesizing uric acid, promote uric acid excretion and intestinal peristalsis in the body, repair damaged liver and kidney cells, reduce swelling, anti-inflammatory and analgesic, prevent and treat hyperuricemia, relieve gout inflammation, lower blood pressure, and improve immunity. To this end, the present invention discloses the following technical solutions:

[0004] In a first aspect, the present invention provides a method for modifying a sunflower disk peptide, comprising: protecting the amino group of the sunflower disk peptide; reacting aminoferrocene with the amino-protected sunflower disk peptide to form tert-butyloxy-sunflower disk peptide-ferrocene, and then performing acid hydrolysis to obtain a ferrocene-modified sunflower disk peptide; wherein the sunflower disk peptide is PDP-9, whose amino acid sequence is shown in SEQ ID NO.1, or PDP-17, whose amino acid sequence is shown in SEQ ID NO.2.

[0005] Furthermore, the step of "protecting the amino group of sunflower peptide" specifically includes:

[0006] A saturated solution of sodium bicarbonate is prepared and mixed with a dioxane solution containing di-tert-butyl dicarbonate; then the sunflower peptide is added to the mixture in small amounts and multiple times, and the reaction progress is tracked by TLC;

[0007] After reacting overnight, wash with ethyl acetate 2-3 times;

[0008] The aqueous phase was washed twice with ethyl acetate; the oil phase was washed twice with saturated sodium bicarbonate;

[0009] Then all the aqueous phases were mixed and the pH of the aqueous phase was adjusted to 1 with 10% hydrochloric acid, and then the aqueous phase was washed twice with ethyl acetate; the above oil phases were concentrated, dried with anhydrous sodium sulfate, filtered, and evaporated to obtain a crystalline product.

[0010] Further, the step of "reacting aminoferrocene with amino-protected sunflower peptide to form tert-butyloxy-sunflower peptide-ferrocene" comprises:

[0011] The amino-protected sunflower peptide obtained above was dissolved in anhydrous dichloromethane in a dry round-bottom flask, triethylamine was added at 0°C, and then benzotriazole-1-tetramethyl hexafluorophosphate was added to react for 1 hour;

[0012] Add amino-ferrocene, react for 2 hours, then move to room temperature for overnight reaction, and monitor the reaction progress by TLC;

[0013] After the reaction is completed, the mixture is washed with saturated sodium bicarbonate solution, 0.5 M hydrochloric acid, 0.5 M sodium bicarbonate solution and water in sequence, and the oil phase is dried over anhydrous sodium sulfate, filtered and evaporated to obtain a solid;

[0014] The solid was dissolved in dichloromethane and ethanol, and passed through a chromatography column with a mixed solution of dichloromethane and ethanol (mixed volume ratio 95:5) as an eluent, and the components were collected and dried to obtain a purified tert-butyloxy-sunflower peptide-ferrocene solid.

[0015] Furthermore, the step of "acid hydrolyzing the ferrocene-modified sunflower peptide" specifically includes:

[0016] Dissolve tert-butyloxy-sunflower peptide-ferrocene in ethyl acetate solution, then pass dry HCl gas at 0℃ for 1h, then react at room temperature for 0.5h, and finally evaporate to dryness;

[0017] The solid was dissolved in methanol and recrystallized repeatedly with ether to obtain a relatively pure product, sunflower peptide.

[0018] In a second aspect, the present invention provides a method for preparing sunflower disc liposomes, comprising:

[0019] Weigh soybean lecithin, cholesterol and distearoylphosphatidylethanolamine methoxypolyethylene glycol into a 250 mL single-necked round-bottom flask, and add dichloromethane to dissolve all the solids;

[0020] Then, a methanol solution containing ferrocene sunflower disk peptide, total sunflower disk alkaloids and total sunflower disk flavonoids was added, and ultrasonicated for 30 seconds to mix evenly;

[0021] Subsequently, the flask was connected to a rotary evaporator, and the dichloromethane-methanol solution was completely evaporated in a 42° C. water bath under vacuum to form a uniform yellow phospholipid film with refractive index on the wall of the flask; and

[0022] Remove the flask, add 8 mL of sterile PBS solution of pH 7.4, separate the phospholipid film in an ultrasonic cleaner, and then transfer the flask to an ultrasonic cell disruptor and use 300W ultrasound for 10 min to allow the phospholipid film to self-assemble into sunflower disc liposomes;

[0023] Wherein, the ferrocene sunflower peptide is prepared by the method described in claims 1 to 4.

[0024] Furthermore, the method for extracting total alkaloids and total flavonoids from sunflower discs comprises:

[0025] Take the sunflower disk powder particles and extract them once with 10 times the mass of 50% ethanol for 15 minutes, filter, and concentrate the filtrate under reduced pressure to 0.5 times the mass of the sunflower disk powder to obtain the alcohol extract;

[0026] 1000 mL of the pretreated D001 macroporous resin was loaded into a glass column with an inner diameter of 60 mm and a height of 1200 mm, and the alcohol extract obtained by the above extraction was added. After slow and sufficient adsorption, water-soluble impurities were washed away with distilled water of about 5 times the column volume at a flow rate of 4 BV / h;

[0027] Then use 5BV of 50% ethanol at a flow rate of 1BV / h to elute, and collect eluent I. Then use 5BV of 50% ethanol with 1% ammonia content at a flow rate of 1BV / h to elute, and collect eluent II;

[0028] The total flavonoids of sunflower disc are obtained by concentrating and drying the eluate I, and the total alkaloids of sunflower disc are obtained by concentrating and drying the eluate II.

[0029] In a third aspect, the present invention provides a ferrocenyl sunflower peptide prepared by the method described in the first aspect.

[0030] In a fourth aspect, the present invention provides sunflower disc liposomes prepared by the method described in the second aspect.

[0031] In a fifth aspect, the present invention provides the use of sunflower disc liposomes prepared by the method described in the second aspect in the preparation of products for reducing uric acid and dissolving tophi.

[0032] Compared with the prior art, the present invention has at least one of the following beneficial effects:

[0033] The liposome involved in the present invention can reduce the uric acid content of the supernatant of the hyperuricemia model cells to the minimum. Not only ferrocene sunflower disk peptide and alkaloids and flavonoids extracted from sunflower disks are selected as raw materials to form liposomes through self-assembly, but also Fc-PDP-9 and Fc-PDP-17 instead of Fc-SFTI-1 are selected as raw materials, so that a preparation that can obviously intervene in the uric acid metabolism of liver cells and significantly reduce the uric acid metabolism amount can be obtained.

[0034] Compared with liposomes obtained from PDP-9, PDP-17 and SFTI-1 as raw materials and Fc-PDP-9, Fc-PDP-17 and Fc-SFTI-1 as preparations to intervene in small intestinal mucosal epithelial cells, liposomes obtained from Fc-PDP-9, Fc-PDP-17 and Fc-SFTI-1 as raw materials can not only promote the transport of uric acid, but also reduce the occurrence of inflammatory response.

[0035] The liposomes and ferrocene sunflower disc peptide involved in the present invention have good therapeutic effects on hyperuricemia, and the therapeutic effect is achieved based on the regulation of the PI3K / AKT signaling pathway. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 The Fc-PDP-9 ( Figure 1 A), Fc-PDP-17 ( Figure 1 B) and Fc-SFTI-1 ( Figure 1 C) infrared spectrum.

[0037] Figure 2 HE staining images of mouse joint synovial tissue sections of the normal group, model group, experimental group (liposome treatment provided in Example 1) and control group in the animal experiment provided in the embodiments of the present invention. DETAILED DESCRIPTION

[0038] In order to make the purpose, technical scheme and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the examples. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention. The reagents not described separately in detail in the present invention are all conventional reagents and can be obtained from commercial channels; the methods not described in detail are all conventional experimental methods and can be obtained from the prior art.

[0039] It should be noted that the terms "first", "second", etc. in the specification and claims of the present invention and the above-mentioned drawings are used to distinguish similar objects, and are not necessarily used to describe a specific order or sequence, nor do they play a substantial limiting role on the subsequent technical features. It should be understood that the data used in this way can be interchanged where appropriate, so that the embodiments of the present invention described herein can be implemented in an order other than those illustrated or described herein. In addition, the terms "including" and "having" and any variations thereof are intended to cover non-exclusive inclusions, for example, a process, method, system, product or device that includes a series of steps or units is not necessarily limited to those steps or units clearly listed, but may include other steps or units that are not clearly listed or inherent to these processes, methods, products or devices.

[0040] 1. Materials

[0041] Sunflower disk peptide (synthesized according to the method provided in "Evolutionary Origins of a Bioactive Peptide Buried within Preproal bumin [J] The Plant Cell, Vol. 26: 981-995, March 2014"). The present invention relates to: PDP-9: GDCYWTSTPPFFTCTPD, as shown in SEQ ID NO.1; PDP-17: GDCHWIPAPPFFMCTPD, as shown in SEQ ID NO.2; SFTI-1: GRCTKSIPPICFPD, as shown in SEQ ID NO.3.

[0042] 2. Modification of sunflower disc peptide

[0043] The present invention provides a method for modifying a sunflower disk peptide, comprising: protecting the amino group of the sunflower disk peptide; reacting aminoferrocene with the amino-protected sunflower disk peptide to form tert-butyloxy-sunflower disk peptide-ferrocene, and then performing acid hydrolysis to obtain a ferrocene-modified sunflower disk peptide. Specifically comprising:

[0044] (1) Protection of peptide amino groups

[0045] Take 780 mg of sodium bicarbonate in a round-bottom flask, dissolve it with distilled water at 4°C to prepare a saturated solution of sodium bicarbonate, weigh 460 mg of di-tert-butyl dicarbonate ((Boc)2O, CAS: 24424-99-5, Nanjing Aupchi Pharmaceutical Technology Co., Ltd.), dissolve it in about 50 mL of dioxane (CAS: 123-91-1, Shanghai Aladdin), mix the above two solutions; then weigh 700 mg of sunflower peptide and add it to the above mixture in batches in small amounts and multiple times, and track the reaction progress by TLC. After reacting overnight, wash with ethyl acetate 2-3 times; wash the water phase with ethyl acetate twice; wash the oil phase with saturated sodium bicarbonate twice. Then mix all the water phases and adjust the pH of the water phase to 1 with 10% hydrochloric acid, and then wash the water phase with ethyl acetate twice. Collect the above oil phases, dry them with anhydrous sodium sulfate, filter them, and evaporate them to obtain a white crystalline product. The solid was dissolved in methanol and recrystallized repeatedly with ether to obtain relatively pure Boc-protected Boc-PDP-9, Boc-PDP-17 and Boc-SFTI-1, 450 mg, 537 mg and 514 mg respectively.

[0046] (2) Synthesis of tert-butyloxy-sunflower peptide-ferrocene

[0047] The above-obtained Boc-PDP-9, Boc-PDP-17 and Boc-SFTI-1 were dissolved in anhydrous dichloromethane in a dry round-bottom flask, and 2.0 mL of triethylamine was added at 0°C, and then 430 mg of benzotriazole-1-tetramethyl hexafluorophosphate (HBTU, CAS: 94790-37-1, Shanghai Covalent Chemical Technology Co., Ltd.) was added. After reacting for 1 hour, 303 mg of amino-ferrocene (CAS: 1273-82-1, Beijing Bailingwei) was added. After reacting for 2 hours, the mixture was moved to room temperature for reaction, and the reaction was left overnight. The reaction progress was tracked by TLC (ninhydrin color development). After the reaction was completed, the mixture was washed with saturated sodium bicarbonate solution, 0.5 M hydrochloric acid, 0.5 M sodium bicarbonate solution and water respectively, and the oil phase was dried with anhydrous sodium sulfate, filtered, and evaporated to dryness to obtain a solid. The solid was dissolved in dichloromethane and ethanol, and passed through a chromatography column with a mixed solution of dichloromethane and ethanol (mixed volume ratio 95:5) as the eluent. The components were collected and dried to obtain 298 mg, 285 mg and 279 mg of purified tert-butyloxy-sunflower peptide-ferrocene solids, respectively.

[0048] (3) Synthesis of ferrocene sunflower peptide

[0049] The tert-butyloxy-sunflower peptide-ferrocene obtained above was dissolved in ethyl acetate solution, and then dry HCl gas was passed through at 0°C for 1 hour, and then reacted at room temperature for 0.5 hours, and finally evaporated to dryness. Since amino compounds are easily oxidized and deteriorated, they must be dried and stored at low temperature. The solid was dissolved in methanol and recrystallized repeatedly with ether to obtain a relatively pure product, sunflower peptide, Fc-PDP-9, Fc-PDP-17 and Fc-SFTI-1, 179 mg, 164 mg and 171 mg respectively.

[0050] (4) Infrared detection

[0051] The ferrocene sunflower peptide (KBr tablet) was determined at 4000-400 cm -1 IR spectrum in the range. Figure 1 Fc-PDP-9( Figure 1 A), Fc-PDP-17 ( Figure 1 B) and Fc-SFTI-1 ( Figure 1 C) infrared spectrum. Among them, 3247cm -1 A broad single peak appears near 1537cm -1 The NH in-plane bending vibration absorption is shown nearby, which is a common characteristic absorption peak of general amine ferrocene derivatives. -1 The stretching vibration absorption peak of C=O in the ester group appears nearby; 1136cm -1 The stretching vibration absorption peak of COC appears near 1403cm -1 Appearance-COO - Antisymmetric stretching vibration peak. 2927cm -1 The CH stretching vibration absorption of methylene appears nearby. 1302cm -1 A weak CN stretching vibration absorption peak appears nearby. -1 The CH stretching vibration absorption of cyclopentadienyl appears at 1009 cm -1 and 824cm -1 The characteristic absorption peak of monocyclic substituted ferrocene appeared nearby, which indicated that the above-mentioned Fc-PDP-9, Fc-PDP-17 and Fc-SFTI-1 were successfully prepared.

[0052] 3. Sunflower disk extract

[0053] Referring to the process of "Pharmacological effects of sunflower disk powder, a Chinese herbal medicine for anti-gout [J] Inner Mongolia Chinese Medicine 2016 (08): 130-1", the sunflower disk alkaloids and flavonoids were extracted as follows:

[0054] Extraction of total flavonoids and alkaloids: Take 100g of sunflower disk powder particles, extract once with 10 times the mass of 50% ethanol by reflux, extract for 15min, filter, and concentrate the filtrate under reduced pressure to 0.5 times the mass of sunflower disk powder to obtain the alcohol extract. Load 1000mL of pretreated D001 macroporous resin into a glass column with an inner diameter of 60mm and a height of 1200mm, add the alcohol extract obtained by the above extraction, slowly and fully adsorb, and then wash away water-soluble impurities with about 5 times the column volume of distilled water at a flow rate of 4BV / h. Then elute with 5BV50% ethanol at a flow rate of 1BV / h, and collect eluent I. Then elute with 5BV50% ethanol with ammonia content of 1% at a flow rate of 1BV / h, and collect eluent II. After the eluent I was concentrated and dried, the total flavonoids of sunflower disc were obtained, and the content of rutin was 61.4% (refer to "HPLC method for simultaneous determination of alkaloids and tricin in total alkaloid extract of malt [J] New Chinese Medicine and Clinical Pharmacology, January 2020"), which is the total flavonoids component of sunflower disc. After the eluent II was concentrated and dried, the total alkaloids of sunflower disc were obtained, and the content of methyl sunflower alkaloid was 75.8% (refer to "HPLC method for simultaneous determination of alkaloids and tricin in total alkaloid extract of malt [J] New Chinese Medicine and Clinical Pharmacology, January 2020"), which is the total flavonoids component of sunflower disc.

[0055] 4. Preparation of liposomes

[0056] (1) Liposome preparation process

[0057] 200 mg of soybean lecithin, 50 mg of cholesterol and 25 mg of distearoylphosphatidylethanolamine methoxypolyethylene glycol (DSPE-PEG2000, Guangzhou Weihua Biotechnology Co., Ltd.) were weighed into a 250 mL single-mouth round-bottom flask, and 50 mL of dichloromethane was added to dissolve all the solids; then 50 mL of a methanol solution containing 1.0 mg / mL ferrocene sunflower disk peptide, 4 mg / mL sunflower disk total alkaloids (prepared in the above embodiment) and 2.5 mg / mL sunflower disk total flavonoids (prepared in the above embodiment) was added, and ultrasonicated for 30 seconds to mix them evenly. Subsequently, the flask was connected to a rotary evaporator, and the dichloromethane-methanol solution was completely evaporated in a 42°C water bath under vacuum to form a uniform yellow phospholipid film with refraction on the wall of the flask. The flask was removed, 8 mL of sterile PBS solution of pH 7.4 was added, the phospholipid film was separated in an ultrasonic cleaner, and then the flask was transferred to an ultrasonic cell disruptor and ultrasonicated at 300 W for 10 min to allow the phospholipid film to self-assemble into sunflower disc liposomes.

[0058] The liposome solution was then transferred to a 10 mL centrifuge tube and centrifuged at 3000 rpm for 5 min to remove the unencapsulated ferrocene sunflower peptide, and the precipitate after centrifugation was retained to determine the encapsulation efficiency. Finally, the obtained liposome solution was stored in a refrigerator at 4°C.

[0059] As a control, the same liposome preparation process was performed without adding ferrocenyl sunflower peptide in the above steps to obtain blank liposomes.

[0060] In this step, Fc-PDP-9, Fc-PDP-17 and Fc-SFTI-1 were used as ferrocene sunflower disk peptides, and were combined with sunflower disk total alkaloids and 2.5 mg / mL sunflower disk total flavonoids to prepare corresponding liposomes, which were respectively used as Examples 1, 2 and Comparative Example 1; blank liposomes were used as Comparative Example 2.

[0061] Liposome preparation provided in Comparative Example 3:

[0062] 200 mg of soybean lecithin, 50 mg of cholesterol and 25 mg of distearoylphosphatidylethanolamine methoxypolyethylene glycol (DSPE-PEG2000, Guangzhou Weihua Biotechnology Co., Ltd.) were placed in a 250 mL single-mouth round-bottom flask, and 50 mL of dichloromethane was added to dissolve all the solids; 50 mL of a methanol solution containing 1.0 mg / mL sunflower disk peptide (PDP-9), 4 mg / mL sunflower disk total alkaloids (prepared in the above embodiment) and 2.5 mg / mL sunflower disk total flavonoids (prepared in the above embodiment) was added, and the mixture was uniformly mixed by ultrasonication for 30 seconds. Subsequently, the flask was connected to a rotary evaporator, and the dichloromethane-methanol solution was completely evaporated in a 42°C water bath under vacuum to form a uniform yellow phospholipid film with refraction on the wall of the flask. The flask was removed, 8 mL of sterile PBS solution of pH 7.4 was added, the phospholipid film was separated in an ultrasonic cleaner, and the flask was transferred to an ultrasonic cell disruptor and ultrasonicated at 300W for 10 minutes to allow the phospholipid film to self-assemble into sunflower disk liposomes. The sunflower disk peptide is PDP-9.

[0063] Liposome preparation provided in Comparative Example 4:

[0064] 200 mg of soybean lecithin, 50 mg of cholesterol and 25 mg of distearoylphosphatidylethanolamine methoxypolyethylene glycol (DSPE-PEG2000, Guangzhou Weihua Biotechnology Co., Ltd.) were placed in a 250 mL single-mouth round-bottom flask, and 50 mL of dichloromethane was added to dissolve all the solids; 50 mL of a methanol solution containing 1.0 mg / mL sunflower disk peptide (PDP-17), 4 mg / mL sunflower disk total alkaloids (prepared in the above embodiment) and 2.5 mg / mL sunflower disk total flavonoids (prepared in the above embodiment) was added, and the mixture was uniformly mixed by ultrasonication for 30 seconds. Subsequently, the flask was connected to a rotary evaporator, and the dichloromethane-methanol solution was completely evaporated in a 42°C water bath under vacuum to form a uniform yellow phospholipid film with refraction on the wall of the flask. The flask was removed, 8 mL of sterile PBS solution of pH 7.4 was added, the phospholipid film was separated in an ultrasonic cleaner, and the flask was transferred to an ultrasonic cell disruptor and ultrasonicated at 300W for 10 minutes to allow the phospholipid film to self-assemble into sunflower disk liposomes. The sunflower disk peptide is PDP-17.

[0065] Liposome preparation provided in Comparative Example 5

[0066] 200 mg soybean lecithin, 50 mg cholesterol and 25 mg distearoyl phosphatidylethanolamine methoxy polyethylene glycol (DSPE-PEG2000, Guangzhou Weihua Biotechnology Co., Ltd.) were taken into a 250 mL single-mouth round-bottom flask, and 50 mL of dichloromethane was added to dissolve all the solids; then 50 mL of a methanol solution containing 1.0 mg / mL sunflower disk peptide (SFTI-1), 4 mg / mL sunflower disk total alkaloids (prepared in the above embodiment) and 2.5 mg / mL sunflower disk total flavonoids (prepared in the above embodiment) was added, and ultrasonicated for 30 seconds to mix them evenly. Subsequently, the flask was connected to a rotary evaporator, and the dichloromethane-methanol solution was completely evaporated in a 42°C water bath under vacuum to form a uniform yellow phospholipid film with refraction on the wall of the flask. The flask was removed, 8 mL of sterile PBS solution of pH 7.4 was added, the phospholipid film was separated in an ultrasonic cleaner, and the flask was transferred to an ultrasonic cell disruptor and ultrasonicated at 300W for 10 minutes to allow the phospholipid film to self-assemble into sunflower disk liposomes. The sunflower disk peptide is -SFTI-1.

[0067] (2) Characterization of liposome particle size

[0068] The particle size and Zeta potential of the prepared liposomes were measured by Malvern ZetaSizer Nano ZSC Model: ZEN3600, wherein the liposomes used for the Zeta potential determination were ultrasonically hydrated with deionized water without PBS during preparation. To study the short-term physiological stability of the liposomes, three groups of liposome solutions diluted with PBS solution (pH 7.4) were placed in a 37°C shaker for 7 days and their particle size distribution was measured. The results are shown in Table 2.

[0069] (3) Liposome loading performance

[0070] Collect the ultrasonic cleaning solution of the liposomes on the market, take 2 mL in a quartz cuvette to determine its absorbance at 441 nm, and calculate the content of ferrocenyl sunflower disc peptide in it in turn, so as to calculate the liposome encapsulation efficiency of it according to the difference between the volume of the ultrasonic cleaning solution and the amount of ferrocenyl sunflower disc peptide added. In addition, according to the method disclosed in "HPLC method for simultaneous determination of alkaloids and flavonoids in malt total alkaloid extract [J] New Chinese Medicine and Clinical Pharmacology, January 2020", the total alkaloids and total flavonoids in the ultrasonic cleaning solution were detected, and the liposome encapsulation efficiency of the total alkaloids and total flavonoids of the sunflower disc was calculated in turn.

[0071] Table 2

[0072]

[0073] As can be seen from Table 2, the hydration dynamic diameters of the liposomes prepared in Examples 1 to 2 and Comparative Examples 1 to 5 are not much different. The encapsulation efficiency of the liposomes provided by Example 1 and Comparative Example 3 for ferrocene sunflower disk peptide, total alkaloids and total flavonoids is not much different, the encapsulation efficiency of the liposomes provided by Example 2 and Comparative Example 4 is not much different, and the encapsulation efficiency of the liposomes provided by Comparative Example 1 and Comparative Example 5 is not much different.

[0074] 5. Hepatocyte test

[0075] (1) Materials

[0076] Test samples: liposomes provided in Examples 1 to 3 and Comparative Examples 1 to 5, and ferrocene sunflower peptides provided in Examples 1 to 3, respectively.

[0077] Human primary hepatocytes (L-O2 cells, Shanghai Huiying Biotechnology Co., Ltd.) were selected to measure whether the liposomes provided in Examples 1 to 3 and Comparative Examples 1 to 5, respectively, and the ferrocene sunflower disk peptide provided in Examples 1 to 3, respectively, have cytotoxicity thereto and the intervention effect on the hyperuricemia model cells.

[0078] (2) Cytotoxicity test

[0079] Select L-O2 cells growing in the logarithmic phase, digest them with trypsin containing 0.25% EDTA, gently blow them into a cell suspension and count them, and dilute them to 1×10 with culture medium. 5 5000 cells / mL were inoculated into each well of a 96-well cell culture plate, and then 200 μL of serum-containing culture medium was added, and the plate was placed in a cell culture incubator for overnight culture to allow the cells to completely adhere to the wall. After the cells were completely attached to the wall, the culture medium in the well was removed, and the plate was rinsed once with sterile PBS solution, and 200 μL, 200 μM of different test samples (dissolved in tert-butyl alcohol) was added to the serum-free culture medium.

[0080] Then incubate in a 37°C incubator for 24h, 48h and 96h. After the incubation, aspirate the culture medium in the well plate, rinse twice with sterile PBS, add 100μL of serum-free culture medium containing 1mg / mL MTT in a light-proof environment, and incubate in a 37°C incubator for 4h. Aspirate the culture medium in the well plate, add 100μL DMSO and incubate in a 37°C constant temperature shaking box for 20min, then use an enzyme marker to measure the absorbance of each well solution in the well plate at 570nm, and use serum-free culture medium as the control group. Make 6 parallel groups for each group, and calculate the cell survival rate using the following formula = absorbance of the test group / absorbance of the control group × 100%.

[0081] Table 3

[0082]

[0083]

[0084] Table 3 shows the cell survival rates of human primary hepatocytes in each treatment group at 24h, 48h and 96h. As shown in Table 3, the cell survival rates of each group at 24h and 48h were all higher than 100%, and decreased at 96h, indicating that the test products in each group had almost no toxic effect on human primary hepatocytes.

[0085] (3) In vitro hyperuricemia model cell intervention experiment

[0086] Human primary hepatocytes in the logarithmic growth phase were divided into a control group, a model group and an observation group, with 9 wells in each group.

[0087] 1) Establishment of hyperuricemia model cells:

[0088] LO2 cells in the logarithmic growth phase were taken at 10 5The cells were inoculated at a density of 100 / mL on a 24-well plate, cultured in a 37°C, 5% CO2 incubator for 48 hours, then the culture medium was removed, and different concentrations of adenosine solution 2.5mM (CAS: 58-61-7, Nanjing Spike Biotechnology Co., Ltd.) were added, with 3 parallel wells set for each concentration. After 36 hours of continuous culture, the cell supernatant was taken out, and xanthine oxidase was added to make its concentration 0.005U / mg. The cells were incubated for 12 hours, and the uric acid concentration in the cell supernatant was analyzed by high-performance liquid chromatography (the detection method refers to "Construction of Hyperuricemia Cell Model and Its Application in Screening Uric Acid-Lowering Peptides [J] Modern Food Science and Technology, Vol. 33, No. 8, 2017"). Taking the control group without the above adenosine induction process as the control, the uric acid production in the model group increased significantly, and there was basically no uric acid production in the blank control group, indicating that the hyperuricemia model was basically successfully constructed.

[0089] 2) Group test

[0090] The above-induced hyperuricemia model cells were plated as the model group, and were set as the model group, positive drug group and test group, and adhered to the wall for 24 hours. Complete medium was added to the model group, 0.5 mg / mL Febuxostat solution (CAS: 144060-53-7, Beijing Century Maijin Biotechnology Co., Ltd.) was added to the positive drug group, and 200 μM of the above test samples containing different test samples (dissolved in tert-butyl alcohol) were added to the test group. After incubation for 24 hours, the supernatant was removed, washed three times with PBS, and the blank control group was added with complete medium. The model group, positive drug group and whey protein polypeptide group were added with adenosine solution and continued to incubate for 36 hours, and the uric acid content in the cell supernatant was determined by high-performance liquid chromatography.

[0091] After each group of cells was cultured for 4 hours, the culture medium was collected and centrifuged at 1000 r / min for 5 minutes, and the supernatant was taken to detect the XO enzyme activity according to the instructions of the XO enzyme detection kit (K710-100, Biovision). The enzyme activity of the model group was used as a reference, and the percentage of the difference between the enzyme activity of the supernatant of each group of cells and the enzyme activity of the supernatant of the model group and the enzyme activity of the model group was used as the percentage of the enzyme activity decrease.

[0092] Table 4

[0093]

[0094] Table 4 shows the uric acid content in the cell supernatant of each group of cells after treatment. The data were multiple compared and marked with significant differences. "—" means no detection. As shown in Table 4, the uric acid content and XO enzyme activity in the model group were the highest, while the uric acid content in the positive drug group was reduced to about half of its content, and the XO enzyme activity was also greatly reduced, indicating that the positive drug has the ability to reduce uric acid content and inhibit XO enzyme activity. In the experimental group, liposomes and ferrocene sunflower peptides intervened in the XO enzyme activity and uric acid synthesis of L-O2 model cells, resulting in different degrees of reduction in XO enzyme activity and uric acid content.

[0095] Among them, the liposomes provided in Examples 1 to 2 can reduce the uric acid content of the supernatant of the hyperuricemia model cells to the minimum. Relative to Example 1, the ferrocene sunflower disk peptide provided in Comparative Example 1 did not show the effect of inhibiting XO enzyme activity and lowering uric acid. Relative to Examples 1 to 2, the liposomes in Comparative Examples 3 to 4 use sunflower disk peptides, alkaloids and flavonoids as raw materials, and their XO enzyme activity inhibition and uric acid lowering effects are significantly reduced, which may be related to the alkaloids and flavonoids in the raw materials, but not to the effect of the sunflower disk peptide. This shows that, by comparing the above description of the preparation process of the liposomes provided in Examples 1 to 2 and Comparative Examples 1 to 5, it is found that Examples 1 to 2 not only use ferrocene sunflower disk peptides and alkaloids and flavonoids extracted from sunflower disks as raw materials, and form liposomes through self-assembly, but also use Fc-PDP-9 and Fc-PDP-17 instead of Fc-SFTI-1 as raw materials, and can obtain a preparation that can significantly intervene in the uric acid metabolism of hepatocytes and significantly reduce the amount of uric acid metabolism.

[0096] 6. Small Intestinal Mucosal Epithelial Cell Test

[0097] (1) Materials

[0098] Rat intestinal epithelial cells were purchased from ATCC cell bank.

[0099] Test samples: liposomes provided in Examples 1 to 3 and Comparative Examples 1 to 5, and ferrocene sunflower peptides provided in Examples 1 to 3, respectively.

[0100] (2) Culture and passage of rat small intestinal epithelial cells

[0101] The rat small intestinal epithelial cells were cultured in DMEM medium with 100 mL / L fetal bovine serum, 10 g / L penicillin and streptomycin in a 37°C, 5% CO2 incubator, with the medium changed every 2 days. When the number of cells grew to about 80% to 90%, the cells were digested with trypsin and subcultured at a ratio of 1:3. The cells used in the experiment were the third generation cells. The cells were cultured at 5×10 4 / cm 2The ratio was inoculated into the well plate for subsequent experiments.

[0102] (3) Establishment of small intestinal mucosal epithelial cell inflammation model

[0103] Uric acid treatment of cells: Cells were inoculated into 96-well plates at a ratio of about 1000 cells per well, with a volume of 100 μL per well. They were treated with 50 mg / L uric acid (to ensure model establishment and cell activity), with 4 replicates per concentration, and placed in a cell culture incubator for 48 hours. The MTS method was used to detect cell activity with almost no attenuation.

[0104] (4) Group test

[0105] The small intestinal mucosal epithelial cells in the logarithmic growth phase were taken as the normal group, and the above-mentioned small intestinal mucosal epithelial cell inflammation model cells were taken as the model group.

[0106] About 1000 small intestinal mucosal epithelial cells in the logarithmic growth phase were taken and inoculated into a 96-well plate with a volume of 100 μL per well. They were treated with 50 mg / L uric acid (to ensure model establishment and cell activity at the same time), and 4 replicate wells were set for each concentration. After being placed in a cell culture incubator for 48 hours, 100 μL of 2 mg / mL of the above test sample was added and incubated for 24 hours before use.

[0107] (5) Real-time fluorescence quantitative PCR

[0108] The mRNA expression of TSPO (transporter), ABCG2 (ATP-binding membrane transporter), and IL-1β in small intestinal mucosal epithelial cells was detected. RNA was extracted with Trizol (TAKARA), and then 1 μg RNA was reverse transcribed into cDNA using a reverse transcription kit (TAKARA). The operation method was carried out according to the reagent instructions. The SYBR Ex Taq kit (TAKARA) was used to detect the expression content of the gene, with GAPDH as the internal reference. The primer sequences are shown in Table 4.

[0109] Table 5

[0110]

[0111]

[0112] (7) Results

[0113] Table 6 Relative expression of mRNA

[0114]

[0115] Table 6 shows the relative expression levels of TSPO, ABCG2 and IL-1β detected by RT-PCR in each group of cells, and multiple comparisons and significant difference marks are performed on each column of data. The results are shown in Table 5. Compared with the normal group, the expression of TSPO, ABCG2 and IL-1β in the model group cells after 24 hours of uric acid treatment increased significantly. This shows that uric acid stimulates the expression of TSPO, ABCG2 and IL-1β in small intestinal mucosal epithelial cells, which not only accelerates the uric acid transport of cells, but also causes inflammatory responses in cells.

[0116] In Table 6, after the cells were treated with the ferrocene sunflower disc peptide provided in Examples 1 to 2, the expression of TSPO in the cells was increased relative to the normal group and was equivalent to the model group, the expression of ABCG2 was significantly increased relative to the model group, and the expression of IL-1β was significantly decreased relative to the model group. Similarly, after the cells were treated with the liposomes provided in Examples 1 to 2, the expression of TSPO in the cells was significantly increased relative to the model group, the expression of ABCG2 was significantly increased relative to the model group, and the expression of IL-1β was significantly decreased relative to the model group. The liposomes provided in Comparative Examples 3 to 5 used PDP-9, PDP-17 and SFTI-1 as raw materials, respectively, instead of Fc-PDP-9, Fc-PDP-17 and Fc-SFTI-1 as raw materials. After the cells were treated with them, the expression of TSPO in the cells was significantly decreased relative to the model group, while the expression of ABCG2 and IL-1β did not change significantly relative to the model group.

[0117] The results showed that compared with liposomes obtained from PDP-9, PDP-17 and SFTI-1 as raw materials and Fc-PDP-9, Fc-PDP-17 and Fc-SFTI-1 as preparations to intervene in small intestinal mucosal epithelial cells, liposomes obtained from Fc-PDP-9, Fc-PDP-17 and Fc-SFTI-1 as raw materials can not only promote their transport of uric acid, but also reduce the occurrence of inflammatory response.

[0118] 7. Animal Experimentation

[0119] (1) Experimental animals

[0120] Healthy male SD rats, clean grade, weighing (250±25)g, a total of 60 rats were selected, provided by Shanghai Slake Experimental Animal Center, animal license number: SCXK (Shanghai) 2017-0005. Animal breeding environment: clean laboratory breeding, temperature 20-25℃, humidity 40%-70%, noise <60 decibels, ventilation frequency 10-20 times / h, working illumination L / D = 12h / 12h. All animals were adaptively caged for 1 week after purchase, and those with no adverse reactions and normal diet and drinking water were included in the experiment.

[0121] (2) Test sample

[0122] The liposomes provided in Examples 1 to 3 and Comparative Examples 1 to 5, and the ferrocene sunflower disk peptide provided in Examples 1 to 3 were used as test samples.

[0123] (3) Establishment of rat hyperuricemia model

[0124] The rats in the modeling group were given potassium oxonate (Sigma) 100 mg / kg intraperitoneal injection and hypoxanthine 500 mg / kg gavage to induce hyperuricemia. The modeling drugs were administered once a day until the end of the experiment, for a total of 24 days.

[0125] (4) Experimental groups

[0126] After routine adaptive feeding, rats were divided into normal group, model group, experimental group and control group (febuxostat 4 mg / kg dose), 10 rats in each group, to establish the hyperuricemia model in rats.

[0127] (5) Experimental animals

[0128] After successful modeling, the experimental group was given the above test sample by gavage at 7.5 / (kg·d), 2 times / d, daily; at the same time, the febuxostat group was treated at 4mg / (kg·d), 1 time / d, and the other control groups and model groups were gavaged with an equal volume of normal saline. Starting from the 4th day of the experiment, 0.5h after the modeling agent was administered, the test sample (dissolved in tert-butyl alcohol) solution was gavaged according to the adult dose based on the body surface area conversion method, and the positive drug group (febuxostat 4mg / kg dose), model group and blank group were only gavaged with an appropriate amount of normal saline. The treatment drug was administered once / d for a total of 21 days. The entire experiment lasted for 24 days. The normal control group did not receive any treatment.

[0129] (6) Detection

[0130] HE staining: The synovial tissue of the joint was fixed in 4% paraformaldehyde solution, dehydrated with gradient alcohol, embedded in conventional paraffin, sliced ​​at 5 μm, and read under a light microscope after HE staining.

[0131] On the 21st day, 3 hours after drug treatment, 3 ml of blood was collected from the heart (using vacuum blood collection tubes commonly used in clinical practice), and the serum was separated by centrifugation at 3000 r / min and 4°C for 15 minutes and stored at -80°C.

[0132] The concentration of UA, creatinine and urea nitrogen in serum were determined by Hitachi-7150 automatic biochemical analyzer.

[0133] ELISA kits (eBioscience) were used to detect the levels of TNF-α and IL-1β in rat serum.

[0134] RT-PCR detection (related kits from TAKARA) extracts total RNA from cells according to the Trizol reagent product instructions, and then reverse transcribes 1 μg RNA into cDNA using a reverse transcription kit (TAKARA), and the operation method is carried out according to the reagent instructions. The SYBR Ex Taq kit (TAKARA) is used to detect the expression level of the gene, with GAPDH as the internal reference. The relevant detection genes and primers are shown in Table 7.

[0135] Table 7

[0136] sequence name Nucleotide sequence (5'→3') TLR4-F ctccattcaagcccaagcct, shown in SEQ ID NO.12 TLR4-R gtccttccatgacagaacggt, shown in SEQ ID NO.13 AKT-F caggaccacgagaagctgtt, shown in SEQ ID NO.14 AKT-R gatctccttggcatcctcgg, shown in SEQ ID NO.15 PI3K-F ggagaaccagccctaagctc, shown in SEQ ID NO.16 PI3K-R cagtgatggggttttgcagc, SEQ ID NO. 17 NF-kBp65-F atgcccaacttctccgacag, SEQ ID NO. 18 NF-kBp65-R aggacttccggtactccctc, shown in SEQ ID NO.19

[0137] (7) Results

[0138] like Figure 2 As shown in the figure, the synovial tissue of the hind foot joint of the rats in the normal group was smooth and intact, and the soft tissue under the synovium was fat, blood vessels and collagen fibers, with occasional congestion changes, no inflammatory cell infiltration, vascular hyperplasia and fibrin exudation. The synovium of the model group and the positive group was congested, showing exudative neutrophils and fibrinoid necrosis, focal hyperplasia of synovial surface cells, diffuse or perivascular inflammatory cell infiltration of the synovium, including neutrophils, lymphocytes and a few plasma cells; while the inflammation of the experimental group and the positive group was reduced.

[0139] Table 8

[0140]

[0141]

[0142] Table 8 shows the results of uric acid, uric acid protein and blood creatinine content in the serum of each group of mice, and multiple comparisons and significant difference marks are performed on each column of data. The results show that in the blood UA test results of rats, the blood UA level of the model group is far higher than that of the normal control group, and the difference is statistically significant (P < 0.01), indicating that the modeling method is effective. After intraperitoneal injection of potassium oxonate and oral administration of hypoxanthine, the experimental rats are in a state of hyperuricemia. In the experimental group, the uric acid, uric acid nitrogen and blood creatinine levels in the serum of mice treated with liposomes and ferrocene sunflower disk peptide provided in Examples 1 to 2 are significantly lower than those in the model group, and the control effect on uric acid, uric acid nitrogen and blood creatinine in mice is not inferior to that of the control group.

[0143] Table 9

[0144]

[0145] Table 9 shows the results of TNF-α and IL-1β content in the serum of each group of mice, and multiple comparisons and significant difference marks are performed on each column of data. In the experimental group, the levels of TNF-α and IL-1β in the serum of mice treated with the liposomes and ferrocene sunflower peptide provided in Examples 1 to 2 were significantly lower than those in the model group, and the control effect on TNF-α and IL-1β in mice was not inferior to that of the control group, indicating that the liposomes and ferrocene sunflower peptide provided in Examples 1 to 2 can effectively control the occurrence of inflammation.

[0146] Table 10 mRNA relative expression

[0147]

[0148]

[0149] Table 10 shows the results of TLR4, AKT, PI3K, and NF-κB-P65 gene expression in the serum of mice in each group, and multiple comparisons and significant difference marks are performed on each column of data. In the experimental group, the TLR4, AKT, PI3K, and NF-κB-P65 gene expression in the serum of mice treated with liposomes and ferrocene sunflower disc peptides provided in Examples 1 to 2 were significantly higher than those in the model group, and the control effect on the expression of TLR4, AKT, PI3K, and NF-κB-P6 genes in mice was not inferior to that in the control group, indicating that the liposomes and ferrocene sunflower disc peptides provided in Examples 1 to 2 respectively have good therapeutic effects on hyperuricemia, and the therapeutic effect is achieved based on the regulation of the PI3K / AKT signaling pathway.

[0150] The above description is only a preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any changes or substitutions that can be easily conceived by any technician familiar with the technical field within the technical scope disclosed by the present invention should be covered within the protection scope of the present invention.

Claims

1. A method for modifying a sunflower disk peptide, characterized in that: include: Protect the amino group of sunflower disk peptide; react aminoferrocene with the amino-protected sunflower disk peptide to form tert-butyloxy-sunflower disk peptide-ferrocene; and then perform acid hydrolysis on the sunflower disk peptide to obtain ferrocene-modified sunflower disk peptide; wherein the sunflower disk peptide is PDP-9 with an amino acid sequence as shown in SEQ ID NO.1, or PDP-17 with an amino acid sequence as shown in SEQ ID NO.2; or a mixture of PDP-9 and PDP-17; The step of "protecting the amino group of the sunflower peptide" specifically includes: A saturated solution of sodium bicarbonate is prepared and mixed with a dioxane solution containing di-tert-butyl dicarbonate; then the sunflower peptide is added to the mixture in small amounts and multiple times, and the reaction progress is tracked by TLC; After reacting overnight, wash with ethyl acetate 2-3 times; The aqueous phase was washed twice with ethyl acetate; the oil phase was washed twice with saturated sodium bicarbonate; Then, all the aqueous phases were mixed and the pH of the aqueous phase was adjusted to 1 with 10% hydrochloric acid, and the aqueous phase was washed twice with ethyl acetate; the above oil phases were concentrated and dried with anhydrous sodium sulfate, filtered, and evaporated to obtain a crystalline product; Wherein, the step of "reacting aminoferrocene with amino-protected sunflower peptide to form tert-butyloxy-sunflower peptide-ferrocene" comprises: The amino-protected sunflower peptide obtained above was dissolved in anhydrous dichloromethane in a dry round-bottom flask, triethylamine was added at 0°C, and then benzotriazole-1-tetramethyl hexafluorophosphate was added to react for 1 hour; Add amino-ferrocene, react for 2 hours, then move to room temperature for overnight reaction, and monitor the reaction progress by TLC; After the reaction is completed, the mixture is washed with saturated sodium bicarbonate solution, 0.5 M hydrochloric acid, 0.5 M sodium bicarbonate solution and water in sequence, and the oil phase is dried over anhydrous sodium sulfate, filtered and evaporated to obtain a solid; The solid was dissolved in dichloromethane and ethanol, and the mixture of dichloromethane and ethanol (mixed volume ratio 95:5) was used as eluent to pass through a chromatography column, and the components were collected and dried to obtain a purified tert-butyloxy-sunflower peptide-ferrocene solid; Wherein, the step of "acid hydrolysis" specifically includes: Dissolve tert-butyloxy-sunflower peptide-ferrocene in ethyl acetate solution, then pass dry HCl gas at 0℃ for 1h, then react at room temperature for 0.5h, and finally evaporate to dryness; The solid was dissolved in methanol and recrystallized repeatedly with ether to obtain relatively pure ferrocene sunflower peptide.

2. A method for preparing sunflower disc liposomes, characterized in that: include: Weigh soybean lecithin, cholesterol and distearoylphosphatidylethanolamine methoxypolyethylene glycol into a 250 mL single-necked round-bottom flask, and add dichloromethane to dissolve all the solids; Then, a methanol solution containing ferrocene sunflower disk peptide, total sunflower disk alkaloids and total sunflower disk flavonoids was added, and ultrasonicated for 30 seconds to mix evenly; Subsequently, the flask was connected to a rotary evaporator, and the dichloromethane-methanol solution was completely evaporated in a 42°C water bath under vacuum to form a uniform yellow phospholipid film with refractive index on the wall of the flask; as well as Remove the flask, add 8 mL of sterile PBS solution of pH 7.4, separate the phospholipid film in an ultrasonic cleaner, and then transfer the flask to an ultrasonic cell disruptor and use 300W ultrasound for 10 min to allow the phospholipid film to self-assemble into sunflower disc liposomes; Wherein, the ferrocene sunflower peptide is prepared by the method described in claim 1.

3. The preparation method according to claim 2, characterized in that: The method for extracting total alkaloids and total flavonoids from sunflower discs comprises: Take the sunflower disk powder particles and extract them once with 10 times the mass of 50% ethanol for 15 minutes, filter, and concentrate the filtrate under reduced pressure to 0.5 times the mass of the sunflower disk powder to obtain the alcohol extract; 1000 mL of the pretreated D001 macroporous resin was loaded into a glass column with an inner diameter of 60 mm and a height of 1200 mm, and the alcohol extract obtained by the above extraction was added. After slow and sufficient adsorption, water-soluble impurities were washed away with 5 times the column volume of distilled water at a flow rate of 4 BV / h; Then, 5BV of 50% ethanol was used for elution at a flow rate of 1BV / h, and eluate I was collected. Then, 5BV of 50% ethanol containing 1% ammonia was used for elution at a flow rate of 1BV / h, and eluate II was collected. The total flavonoids of sunflower disc are obtained by concentrating and drying the eluate I, and the total alkaloids of sunflower disc are obtained by concentrating and drying the eluate II.

4. The ferrocene sunflower peptide prepared according to the method of claim 1.

5. Sunflower disc liposome prepared by the method described in claim 2 or 3.

6. Use of the sunflower disc liposome prepared by the method according to claim 2 or 3 in the preparation of a liposome for reducing inflammatory response.

7. Use of the sunflower disc liposome prepared by the method according to claim 2 or 3 in the preparation of uric acid reducing agents.

Images