Recombinant protein subunit vaccine for preventing highly pathogenic avian influenza H7N9 and preparation method thereof

Abstract

The invention belongs to the technical field of vaccine preparation, and particularly discloses an immunogenic compound which comprises an antigen containing HA protein of H7N9 avian influenza virus and a nanoparticle carrier containing carrier protein, the carrier protein is a Ferritin protein; the nano particle carrier is in covalent linkage with the antigen through SpyCatcher-SpyTag, and the nano particle carrier is in covalent linkage with the antigen through SpyCatcher-SpyTag. According to the immunogenic compound containing the HA protein and the Ferritin protein of the H7N9 avian influenza virus, the antigen characteristic of the immunogenic compound is remarkably enhanced, and a neutralizing antibody with higher titer can be induced. The H7N9 subtype highly pathogenic avian influenza virus immunogenicity complex is prepared into a vaccine, and an immune verification experiment proves that the vaccine prepared from the immunogenicity complex can effectively improve the humoral immunity and cellular immunity effects of antigen protein on an organism, and a new scheme is provided for prevention and control of prevalence of H7N9 subtype highly pathogenic avian influenza.

Description

Technical Field

[0001] The present invention belongs to the technical field of vaccine preparation, and in particular relates to a recombinant protein subunit vaccine for preventing highly pathogenic avian influenza H7N9 and a preparation method thereof. Background Art

[0003] At present, the main vaccine for preventing and controlling the spread of avian influenza virus is the inactivated whole virus vaccine of avian influenza. This vaccine is prepared by inactivating the avian influenza virus after culturing it in chicken embryos. It has the advantages of maintaining complete viral antigen components, high immunogenicity, providing long-term immunity and no risk of toxic reversion. However, this type of vaccine still has the disadvantages of not ideal cross-immune protection against different genotypes or subtypes of viruses, certain safety hazards in the production process, relatively low antibody production rate, relatively low effect of inducing cellular immune response, and large immune dose that may cause excessive stress to the vaccinated animals. Genetically engineered subunit vaccines are made by expressing antigen proteins using eukaryotic or prokaryotic expression systems and then adding adjuvants. This type of vaccine has a simple and safe production process and good biosafety. It is currently the main type of vaccine studied clinically. Among them, virus-like particle vaccine (VLPs vaccine) is a type of subunit vaccine. It is a hollow particle composed of one or several structural proteins of the virus without viral nucleic acid. The structure is similar to that of natural virus particles, with high safety and good immunogenicity.

[0004] At present, several commonly used expression systems include Escherichia coli expression system, yeast expression system and baculovirus expression system. As a bacterium with fast growth density and high cell density, Escherichia coli can achieve high-level recombinant protein expression, but while it rapidly expresses proteins, it may cause problems such as incorrect protein folding or inclusion body formation. At the same time, Escherichia coli may not provide a complete modification mechanism for some proteins that require post-translational modification. Pichia pastoris is a unicellular eukaryotic microorganism that reproduces asexually by fission or budding. As a commonly used eukaryotic expression system for efficient protein production, it has a series of advantages over Escherichia coli, such as genetic stability, high-density culture, post-translational glycosylation modification of proteins, correct protein folding, and directional transport of target proteins such as extracellular secretion. Although the baculovirus expression system can also perform correct post-translational modification and glycosylation modification at appropriate sites, the Pichia pastoris expression system has a low cost of use and is more conducive to large-scale production. Summary of the invention

[0005] The present invention uses the Pichia pastoris expression system to express the HA protein of the H7N9 subtype avian influenza virus, connects it to the Ferritin protein expressed by Escherichia coli through the SpyTag-SpyCatcher system to form virus-like particles, and combines it with the CpG adjuvant to prepare a subunit vaccine. Its immune effect was evaluated through animal experiments, providing a new solution for preventing and controlling the spread of the H7N9 subtype highly pathogenic avian influenza.

[0006] The first aspect of the present invention aims to provide an immunogenic complex.

[0007] The purpose of the second aspect of the present invention is to provide a method for preparing the immunogenic complex of the first aspect of the present invention.

[0008] The third aspect of the present invention aims to provide biological materials related to the immunogenic complex of the first aspect of the present invention.

[0009] The fourth aspect of the present invention aims to provide the use of the immunogenic complex of the first aspect of the present invention or the biomaterial of the third aspect of the present invention in the preparation of a drug for preventing and / or treating diseases caused by avian influenza virus.

[0010] The fifth aspect of the present invention aims to provide a vaccine.

[0011] The sixth aspect of the present invention aims to provide a kit.

[0012] In order to achieve the above object, the technical solution adopted by the present invention is:

[0013] The first aspect of the present invention provides an immunogenic complex comprising:

[0014] An antigen containing the HA protein of the H7N9 avian influenza virus and a nanoparticle carrier containing a carrier protein;

[0015] The carrier protein is Ferritin protein;

[0016] The nanoparticle carrier is covalently linked to the antigen via SpyCatcher-SpyTag.

[0017] Ferritin is an iron storage protein composed of 24 identical or homologous subunits. It is octahedral and exists in almost all organisms. Ferritin and its self-complex also show remarkable thermal and pH stability, monodispersity, biocompatibility, biodegradability and low-cost large-scale production, as well as adaptability to surface conjugation by chemical or genetic methods.

[0018] As a new type of protein coupling system, SpyTag-SpyCatcher can be used as a connection tool for vaccine antigens to construct a complex with high stability and immunogenicity, thereby enhancing the immune effect of the vaccine.

[0019] In some embodiments of the present invention, the antigen contains HA protein and SpyTag, and the SpyTag is located at the C-terminus of the HA protein.

[0020] In some embodiments of the present invention, the antigen further comprises a His tag located at the C-terminus of the HA protein.

[0021] In some embodiments of the present invention, the nucleotide sequence of the His tag is shown in SEQ ID NO:2.

[0022] In some embodiments of the present invention, the nucleotide sequence of the SpyTag is shown in SEQ ID NO:1.

[0023] In some embodiments of the present invention, the HA protein and SpyTag are fused via a connecting peptide.

[0024] In some embodiments of the present invention, the number of amino acids in the connecting peptide is 1 to 30; it can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30.

[0025] In some embodiments of the present invention, the amino acids of the connecting peptide are meaningless polypeptides that do not have additional functions other than connection (eg, protein localization, enzyme cleavage sites, etc.).

[0026] In some embodiments of the present invention, the connecting peptide is a flexible connecting peptide.

[0027] In some embodiments of the present invention, the amino acid sequence of the connecting peptide is selected from one or more of Gly, Ser, Pro, Ala and Glu.

[0028] In some embodiments, the amino acid sequence of the connecting peptide is selected from (GGGGS)n, (GGGS)n, (GGS)n, (GS)n or (G)n, wherein n is selected from 1, 2, 3, 4, 5 or 6. (GGS)n means that there are n GGS repeats, for example, (GGS)4 represents GGSGGSGGSGGS, and the same applies to the others.

[0029] In some embodiments of the present invention, the nanoparticle carrier comprises a Ferritin protein and a SpyCatcher, and the SpyCatcher is located at the C-terminus of the Ferritin protein.

[0030] In some embodiments of the present invention, the nanoparticle carrier further comprises a His tag located at the N-terminus of the Ferritin protein.

[0031] In some embodiments of the present invention, the nucleotide sequence of the His tag is shown in SEQ ID NO:3.

[0032] In some embodiments of the present invention, the NCBI accession number of the amino acid sequence of the HA protein is AUD54811.1.

[0033] In some embodiments of the present invention, the NCBI accession number of the amino acid sequence of the Ferritin protein is WP_000917208.1.

[0034] In some embodiments of the present invention, the NCBI accession number of the amino acid sequence of the SpyCatcher is AMD39964.1.

[0035] In some embodiments of the present invention, the nanoparticle carrier comprises HIS tag-Ferritin protein-SpyCatcher, the amino acid sequence of HIS tag-Ferritin protein-SpyCatcher is shown in SEQ ID NO:7, and the nucleotide sequence thereof is shown in SEQ ID NO:6.

[0036] In some embodiments of the present invention, the amino acid sequence of the antigen is shown as SEQ ID NO:4, and the nucleotide sequence of the antigen is shown as SEQ ID NO:3.

[0037] The present invention relates to an antigen protein targeting H7 subtype avian influenza virus and a gene sequence encoding the protein, which is constructed through a Pichia pastoris expression system.

[0038] In some embodiments of the present invention, the immunogenic complex is a polyhedral spherical structure, and the antigen is displayed on the surface of the Ferritin protein in the form of spikes.

[0039] In some embodiments of the present invention, the particle size of the immunogenic complex is 20 to 40 nm.

[0040] The second aspect of the present invention provides a method for preparing the immunogenic complex of the first aspect of the present invention, comprising the following steps: mixing the antigen with the nanoparticle carrier, and incubating to obtain the immunogenic complex.

[0041] In some embodiments of the present invention, the molar ratio of the antigen to the nanoparticle carrier is 1:1-2, preferably 1:1.

[0042] In some embodiments of the present invention, the incubation condition is 4° C. for 10 to 15 hours.

[0043] The preparation method provided by the invention does not involve live virus operation, has high biological safety, low cost, and is suitable for mass production.

[0044] The third aspect of the present invention provides a biological material related to the immunogenic complex of the first aspect of the present invention, wherein the biological material is any one of a1) to a12):

[0045] a1) a nucleic acid molecule encoding the immunogenic complex of the first aspect of the present invention;

[0046] a2) an expression cassette containing the nucleic acid molecule described in a1);

[0047] a3) a recombinant vector containing the nucleic acid molecule described in a1);

[0048] a4) a recombinant vector containing the expression cassette described in a2);

[0049] a5) a recombinant microorganism containing the nucleic acid molecule described in a1);

[0050] a6) a recombinant microorganism containing the expression cassette described in a2);

[0051] a7) a recombinant microorganism containing the recombinant vector described in a3);

[0052] a8) a recombinant microorganism containing the recombinant vector described in a4);

[0053] a9) a transgenic animal cell line containing the nucleic acid molecule described in a1);

[0054] a10) a transgenic animal cell line containing the expression cassette described in a2);

[0055] a11) a transgenic animal cell line containing the recombinant vector described in a3);

[0056] a12) A transgenic animal cell line containing the recombinant vector described in a4).

[0057] In some embodiments of the invention, the transgenic animal cell line does not contain reproductive material.

[0058] In some embodiments of the present invention, the nucleic acid molecule encoding the immunogenic complex of the first aspect of the present invention comprises a nucleic acid molecule encoding an antigen and a nucleic acid molecule encoding a nanoparticle carrier.

[0059] In some embodiments of the present invention, the nucleotide sequence of the nucleic acid molecule encoding the antigen is shown in SEQ ID NO:3.

[0060] In some embodiments of the present invention, the nucleotide sequence of the nucleic acid molecule encoding the nanoparticle carrier is shown in SEQ ID NO:6.

[0061] The fourth aspect of the present invention provides use of the immunogenic complex of the first aspect of the present invention or the biomaterial of the third aspect of the present invention in the preparation of a drug for preventing and / or treating diseases caused by avian influenza virus.

[0062] In some embodiments of the present invention, the avian influenza virus includes H7N9 avian influenza virus.

[0063] The fifth aspect of the present invention provides a vaccine comprising the immunogenic complex of the first aspect of the present invention or the biological material of the third aspect of the present invention.

[0064] In some embodiments of the present invention, the vaccine further comprises an adjuvant and / or a pharmaceutically acceptable carrier.

[0065] In some embodiments of the present invention, the adjuvant includes an aluminum adjuvant (such as Imject Alum), an oil emulsion adjuvant such as oil-in-water, water-in-oil, and a two-way emulsion, an adjuvant of microbial origin such as peptidoglycan (PG), gram-negative bacteria outer membrane lipopolysaccharide (LPS), ISA series adjuvants (such as ISATM 51, SEPPIC MONTANIDETM ISA 71VG), pica, mycobacteria and their components (such as muramyl dipeptide), CpG oligonucleotides (CpG ODN), CpG, MF59, AS01, AS04, cholera toxin (CT), a particulate antigen delivery system such as liposomes, polymeric microspheres, inert nanospheres, immunostimulating complexes (IS-COM), cytokines, polysaccharides such as inulin (MPI), and natural sources such as at least one of propolis and saponin.

[0066] In some embodiments of the invention, the adjuvant comprises CpG.

[0067] It has been verified through experiments that the vaccine combining the immunogenic complex of the present invention with CpG produces higher levels of IL-4, IFN-γ and TNF-α, ie, has a higher humoral immune effect.

[0068] In some embodiments of the present invention, examples of pharmaceutically acceptable carrier components include binders (syrup, gum arabic, gelatin, sorbitol, tragacanth, polyvinyl pyrrolidone, etc.), fillers (lactose, sucrose, starch, calcium phosphate, sorbitol, glycine, etc.), lubricants (magnesium stearate, talc, polyethylene glycol, etc.), disintegrants (starch, microcrystalline cellulose, etc.), wetting agents (sodium lauryl sulfate, etc.), suspending agents (sorbitol, syrup, methylcellulose, glucose syrup, gelatin, hydrogenated edible fats, etc.), emulsifiers (lecithin, etc.), Fat, sorbitan monooleate, gum arabic, etc.), non-aqueous carriers (almond oil, fractionated coconut oil or glycerol, propylene glycol, ethanol and other hydrophobic esters, etc.), preservatives (methyl paraben or propyl paraben, sorbic acid, etc.), fragrances (synthetic flavors, natural flavors, etc.), sweeteners (sucrose, stevia, xylitol, etc.), pH adjusters (sodium bicarbonate, potassium carbonate, etc.), powders (pigments, dyes, resins, etc.), thickeners (gum arabic, methyl cellulose, etc.), antioxidants (vitamin C, vitamin E, etc.), etc.

[0069] Immunizations of the present invention include nasal, oral, and subcutaneous (SC), intramuscular (IM), intravenous (IV), intraperitoneal (IP), or intradermal (ID) injections.

[0070] The above-mentioned vaccine is administered in a manner compatible with the dosage formulation, and in dosages such as therapeutically effective amounts and immunogenic effective amounts. The dosage depends on the subject being treated, the ability of the subject's immune system to synthesize antibodies, and the expected degree of protection. The exact amount of active ingredient to be administered depends on the physician's judgment, and the dosage varies from individual to individual. The appropriate regimen for initial administration and booster vaccination may also vary, but typically one injection or other administration is performed after a certain interval (several weeks or months) after the first administration.

[0071] In some embodiments of the invention, the vaccine is a water-in-oil emulsion having an aqueous phase and an oily phase.

[0072] In some embodiments of the present invention, the vaccine is a recombinant protein subunit vaccine.

[0073] A sixth aspect of the present invention provides a kit comprising the vaccine of the fifth aspect of the present invention and a container for vaccination.

[0074] In some embodiments of the present invention, the container is a medical syringe.

[0075] The beneficial effects of the present invention are:

[0076] The immunogenic complex containing the HA protein and the Ferritin protein of the H7N9 avian influenza virus provided by the present invention has significantly enhanced antigenic properties and can induce a higher titer of neutralizing antibodies. The immunogenic complex is prepared into a vaccine, and through immune validation experiments, it is proved that the vaccine prepared from the immunogenic complex can effectively improve the humoral immunity and cellular immunity of the antigen protein to the body, providing a new solution for preventing and controlling the spread of the H7N9 subtype highly pathogenic avian influenza.

[0077] The present invention explains in detail a vaccine preparation process based on recombinant protein subunits, including how to select and clone suitable viral protein subunits, how to express and purify them, and how to assemble them into vaccine particles or form vaccines. The vaccine preparation process of the present invention improves the safety and effectiveness of the vaccine. BRIEF DESCRIPTION OF THE DRAWINGS

[0078] Figure 1 This is the plasmid map of pPICZαA-H7HA1-Spytag.

[0079] Figure 2 It is the PCR identification result of pPICZαA-H7HA1-Spytag; wherein, A is the pPICZαA vector fragment after enzyme digestion, in the figure, M: DNA Marker DL5000, 1: pPICZαA vector fragment after enzyme digestion, 4299bp; B is the HA gene fragment after enzyme digestion, in the figure, M: DNA Marker DL2000, 1: HA gene fragment after enzyme digestion, 1063bp; C is the plasmid of pPICZαA-H7HA1-Spytag after connection, in the figure, M: DNA Marker DL5000, 1~2: plasmid of pPICZαA-H7HA1-Spytag after connection, 5346bp.

[0080] Figure 3 This is the plasmid map of pET28-Ferritin-SpyCatcher.

[0081] Figure 4The PCR identification results of pET28-Ferritin-SpyCatcher; wherein A is the pET28 vector fragment after enzyme digestion, in the figure, M: DNA Marker DL5000, 1: pET28 vector fragment after enzyme digestion, 5253bp; B is the Ferritin gene fragment after enzyme digestion, in the figure, M: DNA Marker DL2000, 1: Ferritin gene fragment after enzyme digestion, 951bp; C is the plasmid of pET28-Ferritin-SpyCatcher after connection, in the figure, M: DNA Marker DL10000; 1~2: plasmid of pET28-Ferritin-SpyCatcher after connection, 6186bp.

[0082] Figure 5 HA-Mut S HA-Mut + and Ferritin purification SDS-PAGE diagram; A is HA-Mut S Protein, in the figure, M: protein marker, 1-2: purified HA-Mut S Protein, about 30-40 kDa in size; B is HA-Mut + Protein, in the figure, M: protein marker, 1-2: purified HA-Mut + Protein, due to the presence of a greater degree of glycosylation, HA-Mut + The size of 1:1 is about 35-45 kDa; C is Ferritin protein. In the figure, M: protein marker, 1-2: purified Ferritin protein, the size of 1:1 is about 38 kDa.

[0083] Figure 6 HA-Mut S HA-Mut S and Ferritin Western Blot identification results; A is HA-Mut S Protein, in the figure, M: protein marker, 1: purified HA-Mut S Protein, about 30-40 kDa in size; B is HA-Mut + Protein, in the figure, M: protein marker, 1: HA-Mut + Protein is more diffuse, with a size of about 35-45kDa; C is Ferritin protein, in the figure, M: protein marker, 1: Ferritin protein, with a size of about 38kDa.

[0084] Figure 7 HA-MutS and HA-Mut + ELISA results of Q74, the figure shows the expressed antigen protein HA-Mut S and HA-Mut + ELISA reaction line graph with different concentrations of coated antigen, the horizontal axis is the expressed antigen protein HA-Mut S and HA-Mut + The vertical axis is the concentration, and the vertical axis is the reading at a wavelength of 450 nm after adding the ELISA stop solution.

[0085] Figure 8 HA-Mut S Sensorgram of interaction with Q74; A is HA-Mut S The sensorgram of the affinity of HA-Mut S Coated on the chip surface, different concentrations of Q74 flowed through the chip surface to obtain this figure, B is the equilibrium binding constant K D The equilibrium binding constant K was calculated by fitting the corresponding values ​​of Q74 and RU at different concentrations. D Value, R 2 =0.9928.

[0086] Fig. 9 HA-Mut S SDS-PAGE analysis results of the assembly with Ferritin. In the figure, M: protein marker, 1: Ferritin protein, size is about 38kDa, 2: HA-Mut S -Ferritin combined protein, size about 68 ~ 78kDa, 3: HA-Mut S Protein, about 30-40 kDa in size, the protein marked by the arrow is HA-Mut S -Ferritin combination protein.

[0087] Fig.10 HA-Mut S Western Blot analysis results of the assembly with Ferritin. In the figure, M: protein marker, 1: HA-Mut S Protein, size about 30-40 kDa, 2: HA-Mut S -Ferritin combination protein, size is about 68-78kDa, 3: Ferritin protein, size is about 38kDa, the protein marked by the arrow is HA-Mut S -Ferritin combination protein.

[0088] Fig.11 HA-Mut S-TEM test results of Ferritin protein; A is Ferritin protein, with a diameter of about 10nm under electron microscope, and B is HA-Mut S Protein, slightly less than 10nm in diameter, C is HA-Mut S -Ferritin protein, with a diameter of about 30nm, the scale bar in the figure is 10nm.

[0089] Fig.12 Ferritin, HA-Mut S and HA-Mut S -DLS detection of Ferritin protein. This figure is a line graph of the particle size measured by dynamic light scattering. The horizontal axis is the protein diameter and the vertical axis is the percentage of protein quantity. Ferritin protein is about 10nm in size. HA-Mut S The protein diameter is slightly less than 10nm, HA-Mut S -Ferritin protein is about 30nm in diameter.

[0090] Fig.13 The figure is the result of humoral immunity test of SPF chicken after immunization. After SPF chicken is immunized with vaccine, blood samples are separated to obtain chicken serum, and the results of hemagglutination inhibition test and ELISA experiment are summarized; among them, A is the flow chart of the whole animal experiment, B is the HI reaction bar graph of hemagglutination inhibition test, the horizontal axis represents the number of days after immunization, and the vertical axis represents the antibody titer in the serum, C is the HI reaction line graph of hemagglutination inhibition test, which better shows the trend of serum antibody changes, and D is the activity detection bar graph of HA-specific antibody titer in serum, and the horizontal axis represents each The name of the group, the ordinate is IgG titer, E and F are ELISA test bar graphs of IgG1 and IgG2b respectively, the abscissa is the name of each group, the ordinate is the reading at a wavelength of 450nm after adding ELISA stop solution, and G is the ratio of IgG1 / IgG2 in serum, reflecting that the immune response caused by the vaccine is Th1 biased; in the figure, ns means no significant difference, * means P < 0.05, ** means P < 0.01, *** means P < 0.005, **** means P < 0.001.

[0091] Fig.14 The figure shows the results of cell immune detection of SPF chickens after immunization. After immunization of SPF chickens with the vaccine, blood samples were separated to obtain chicken PBMC, and flow cytometry detection and cytokine supernatant ELISA experiments were performed. Among them, A and B are the results of flow cytometry detection of CD4 in peripheral blood lymphocytes of SPF chickens after immunization. + and CD8 +T lymphocyte level, A is the flow cytometry test result graph, B is the statistical graph of the test result graph, C is a bar graph evaluating the production of antigen-specific cytokines by ELISA, the abscissa is the name of each component, and the ordinate is the reading at a wavelength of 450nm after adding ELISA stop solution; in the figure, ns means no significant difference, * means P < 0.05, ** means P < 0.01, and *** means P < 0.005. DETAILED DESCRIPTION

[0092] The present invention is further described in detail below through specific examples.

[0093] It should be understood that these embodiments are only used to illustrate the present invention and are not used to limit the scope of the present invention.

[0094] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0095] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0096] Example 1 Construction of recombinant plasmids pPICZαA-H7HA1-Spytag and pET28-Ferritin-SpyCatcher and strain screening

[0097] 1) Search the NCBI website and download the amino acid sequences of A / goose / Guangdong / Q38 / 2017(H7N9)HA (accession number AUD54811.1) and Ferritin (accession number WP_000917208.1). Insert the SpyTag sequence (the sequence after codon optimization is GCGCATATTGTGATGGTGGATGCGTATAAACCGACCAAA (SEQ ID NO: 1)) and 6×HIS tag sequence (the sequence after codon optimization is CACCACCACCATCATCAC (SEQ ID NO: 2)) at the C-terminus of the HA protein sequence; insert the 6×HIS tag sequence (the sequence after codon optimization is CATCATCATCATCATCAC (SEQ ID NO: 3)) at the N-terminus of the Ferritin protein, and insert the SpyCatcher sequence (accession number AMD39964.1) at the C-terminus;

[0098] 2) Select human-preferred nucleic acid codons to optimize the nucleic acid sequences encoding HA and Ferritin proteins. Add restriction enzyme sites EcoR I and Xba I to the 5' and 3' ends of the HA nucleic acid sequence, and add restriction enzyme sites EcoR I and BamH I to the 5' and 3' ends of the Ferritin nucleic acid sequence. Entrust Shanghai Sangon Biotechnology Co., Ltd. to synthesize, and the synthesized nucleic acid sequence is stored in the pUC19 vector;

[0099] The nucleic acid sequence of the codon-optimized HA antigen is shown in SEQ ID NO:4, and the amino acid sequence is shown in SEQ ID NO:5.

[0100]

[0101] Glu Phe Met Asp Lys Ile Cys Leu Gly His His Ala Val Ser Asn Gly ThrLys Val Asn Thr Leu ThrGlu Arg Gly Val Glu Val Val Asn Ala Thr Glu Thr ValGlu Arg Thr Asn Ile Pro Arg Ile Cys Ser LysGly Lys Arg Thr Val Asp Leu GlyGln Cys Gly Leu Leu Gly Thr Ile Thr Gly Pro Pro Gln Cys Asp GlnPhe Leu GluPhe Ser Ala Asp Leu Ile Ile Glu Arg Arg Glu Gly Ser Asp Val Cys Tyr Pro GlyLys PheVal Asn Glu Glu Ala Leu Arg Gln Ile Leu Arg Glu Ser Gly Gly Ile AspLys Glu Pro Met Gly Phe ThrTyr Asn Gly Ile Arg Thr Asn Gly Val Thr Ser AlaCys Arg Arg Ser Gly Ser Ser Phe Tyr Ala Glu MetLys Trp Leu Leu Ser Asn ThrAsp Asn Ala Ala Phe Pro Gln Met Thr Lys Ser Tyr Lys Asn Thr Arg GluSer ProAla Ile Ile Val Trp Gly Ile His His Ser Val Ser Thr Ala Glu Gln Thr Lys LeuTyr Gly Ser GlyAsn Lys Leu Val Thr Val Gly Ser Ser Asn Tyr Gln Gln Ser PheVal Pro Ser Pro Gly Ala Arg Pro GlnVal Asn Gly Gln Ser Gly Arg Ile Asp PheHis Trp Leu Ile Leu Asn Pro Asn Asp Thr Val Thr Phe SerPhe Asn Gly Ala PheIle Ala Pro Asp Arg Ala Ser Phe Leu Arg GlyLys Ser Met Gly Ile Gln SerGlyVal Gln Val Asp Ala Asn Cys Glu Gly Asp Cys Tyr His Ser Gly Gly Thr IleIle Ser Asn Leu Pro PheGln Asn Ile Asp Ser Arg Ala Val Gly Lys Cys Pro ArgTyr Val Lys Gln Arg Ser Leu Leu Leu Ala ThrGly Met Lys Asn Val Gly Gly GlySer Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly Gly Ser Ala His IleVal Met ValAsp Ala Tyr Lys Pro Thr Lys His His His His His (SEQ ID NO: 5).

[0102] The nucleic acid sequence of the codon-optimized Ferritin protein is shown in SEQ ID NO:6, and the amino acid sequence is shown in SEQ ID NO:7.

[0103] ATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCATATGGATTATGACATCCCTACTACTGAAAACCTTTATTTTCAAGGTGCCATGGTGGACACGCTTAGTGGGCTTTCCTCTGAACAGGGCCAGTCAGGCGATATGACGATTGAGGAGGATTCTGCTACTCATATTAAATTTAGCAAACGGGACGAAGACGGGAAGGAATTGGCGGGTGCGACCATGGAGTTACGCGACTCTTCAGGCAAAACCATCTCCACATGGATCAGCGATGGTCAAGTCAAAGACTTTTATCTTTATCCAGGTAAGTACACGTTTGTCGAAACAGCCGCGCCGGACGGTTATGAAGTGGCTACAGCAATCACGTTTACGGTGAATGAGCAAGGGCAGGTCACCGTGAATGGCAAAGCCACGAAGGGGGATGCTCACATTCTCAAACCAGAAATGATCGAAAAACTTAACGAGCAGATGAATTTAGAGTTGTACTCCTCGCTGCTGTATCAACAAATGTCGGCGTGGTGTTCTTACCACACTTTTGAGGGCGCGGCGGCCTTCCTCCGTCGGCACGCTCAAGAAGAAATGACACACATGCAGCGCCTCTTCGACTACTTGACTGATACAGGCAATCTGCCACGCATCAACACTGTTGAGTCGCCATTTGCAGAATACTCATCGCTTGACGAACTCTTCCAGGAAACGTACAAGCATGAACAACTTATTACACAGAAGATCAATGAACTCGCCCACGCAGCTATGACCAACCAAGACTATCCTACCTTCAACTTCTTACAGTGGTATGTATCCGAACAGCATGAGGAAGAGAAGTTATTCAAGTCCATCATTGATAAACTTTCACTTGCCGGTAAGAGCGGTGAAGGGTTGTACTTTATCGATAAGGAATTATCAACCCTTGACACCCAAAATG(SEQ ID NO:6)。

[0104] His His His His His His Ser Ser Gly Leu Val Pro Arg Gly Ser His MetAsp Tyr Asp Ile Pro ThrThr Glu Asn Leu Tyr Phe Gln Gly Ala Met Val Asp ThrLeu Ser Gly Leu Ser Ser Glu Gln Gly Gln SerGly Asp Met Thr Ile Glu Glu AspSer Ala Thr His Ile Lys Phe Ser Lys Arg Asp Glu Asp Gly Lys GluLeu Ala GlyAla Thr Met Glu Leu Arg Asp Ser Ser Gly Lys Thr Ile Ser Thr Trp Ile Ser AspGly GlnVal Lys Asp Phe Tyr Leu Tyr Pro Gly Lys Tyr Thr Phe Val Glu Thr AlaAla Pro Asp Gly Tyr Glu ValAla Thr Ala Ile Thr Phe Thr Val Asn Glu Gln GlyGln Val Thr Val Asn Gly Lys Ala Thr Lys Gly AspAla His Ile Leu Lys Pro GluMet Ile Glu Lys Leu Asn Glu Gln Met Asn Leu Glu Leu Tyr Ser Ser LeuLeu TyrGln Gln Met Ser Ala Trp Cys Ser Tyr His Thr Phe Glu Gly Ala Ala Ala Phe LeuArg Arg HisAla Gln Glu Glu Met Thr His Met Gln Arg Leu Phe Asp Tyr Leu ThrAsp Thr Gly Asn Leu Pro Arg IleAsn Thr Val Glu Ser Pro Phe Ala Glu Tyr SerSer Leu Asp Glu Leu Phe Gln Glu Thr Tyr Lys His GluGln Leu Ile Thr Gln LysIle Asn Glu Leu Ala His Ala Ala Met Thr AsnGln Asp Tyr Pro Thr Phe AsnPheLeu Gln Trp Tyr Val Ser Glu Gln His Glu Glu Glu Lys Leu Phe Lys Ser Ile IleAsp Lys Leu SerLeu Ala Gly Lys Ser Gly Glu Gly Leu Tyr Phe Ile Asp Lys GluLeu Ser Thr Leu Asp Thr Gln Asn (SEQ ID NO:7).

[0105] 3) The synthetic HA gene fragment and the pPICZαA vector stored in the laboratory were cut with restriction endonucleases EcoR I and Xba I, and then the target fragment was recovered. At the same time, the synthetic Ferritin gene fragment and the pET28 vector stored in the laboratory were cut with restriction endonucleases EcoR I and BamH I, and then the target fragment was recovered. After ligation at 37°C for 1 hour, the ligation product was transformed into the DH5α strain, and a small amount of plasmid was extracted and sequenced for identification.

[0106] The PCR primer nucleic acid sequences used for identification are:

[0107] 5-αfactor-F: 5'-TACTATTGCCAGCATTGCTGC-3' (SEQ ID NO: 8);

[0108] 3-AOX1-R: 5'-GGCAAATGGCATTCTGACAT-3' (SEQ ID NO: 9).

[0109] 4) The correctly sequenced recombinant plasmid pET28-Ferritin-SpyCatcher was transformed into the prokaryotic expression strain BL21 (DE3) by heat shock transformation, and then coated on a solid LB plate with Km and cultured at 37°C overnight. When a single colony appeared, a single colony PCR was selected for identification. The correctly sequenced recombinant plasmid pPICZαA-H7HA1-Spytag was digested with Sac I and Bgl II restriction endonucleases at 37°C for 1h, and then the linearized fragment was recovered using a gel recovery kit (Omega Bio, item number D2500-03). The recovered linearized fragment was transformed into the eukaryotic expression strain SuperMan5 by a Pichia pastoris chemical transformation kit (Beijing Coolbo Technology Co., Ltd., item number D0308M), and then coated on a solid YPD plate with Zeocin and cultured at 30°C overnight for 48 to 72h.

[0110] The PCR primer nucleic acid sequences used for identification are:

[0111] T7-F: 5'-TAATACGACTCACTATAGGG-3' (SEQ ID NO10);

[0112] T7-R: 5'-TGCTAGTTATTGCTCAGCGG-3' (SEQ ID NO: 11).

[0113] The plasmid map of the recombinant plasmid pPICZαA-H7HA1-Spytag is as follows Figure 1 , PCR target gene identification results are as follows Figure 2 The plasmid map and PCR identification of the recombinant plasmid pET28-Ferritin-SpyCatcher are as follows: Figure 3-4 .

[0114] 5) Strain screening: Prepare MD solid plate medium with glucose as the sole carbon source and MM solid plate medium with methanol as the sole carbon source. Dilute the constructed yeast strain with 50 μL sterile PBS solution, take 10 μL of bacterial solution and drop it on MD and MM solid plates in sequence. Open the cover and air dry for 10 minutes in the biosafety cabinet, then place it in a 30°C incubator for 48 hours. Observe the colony morphology and growth on the culture medium. The strain that grows normally on the methanol medium is a methanol-sensitive strain (Mut + ), and the strains that could not grow or showed weak growth were methanol-insensitive strains (Mut S ). Select the Mut obtained by screening + and Mut S The strain was preserved and used for subsequent experiments.

[0115] Example 2 Target Protein Ferritin and Mut S Expression, purification and identification of

[0116] 1)Mut S and Mut + Protein induction expression: Select activated white, smooth yeast colonies from YPD solid medium and inoculate them into BMGY liquid medium and culture overnight until OD 600 =1.5. Then transfer the obtained part of the bacteria into BMMY liquid medium and control the initial OD 600The concentration of the supernatant was 0.6. The culture was shaken in a shaker at 30°C and 250 r / min, and 0.5% methanol was added as a carbon source every 24 hours. After 72 hours of shaking culture, the supernatant was collected by centrifugation and purified by affinity chromatography. The specific purification steps are as described in Example 2 (3). 30 μL of supernatant and 10 μL of 4×SDS loading buffer were used to prepare a sample. After 60 minutes of protein electrophoresis at 120V, the protein gel was taken out. After staining, clear dark bands could be observed. After 30 minutes of decolorization with clean water, the target protein size of about 30 to 40 kDa ( Figure 5 A and Figure 5 (middle B).

[0117] 2) Induced expression of Ferritin protein: The recombinant plasmid pET28-Ferritin-SpyCatcher was transformed into BL21 (DE3) and then coated on a solid LB plate with Km and cultured overnight in a 37°C constant temperature incubator. A single colony was picked in a biosafety cabinet and placed in LB liquid medium with Km, and cultured in a shaking incubator at 37°C at 200 r / min until the bacterial solution OD 600 The value is about 0.2, and the empty BL21 (DE3) bacterial solution is also cultured at the same time. IPTG with an induction concentration of 1.0mM was added to the recombinant bacterial solution and the empty BL21 (DE3) bacterial solution, respectively, and then the expression was induced at low temperature for 16 hours at 16℃ 200r / min in a shaker. After the induction, the bacterial solution was centrifuged at 8000r / min for 10min, and the supernatant was removed to retain the bacteria. The bacteria were suspended in lysis buffer and crushed at low temperature using an ultrasonic cell disruptor. The lysate was centrifuged at 12000r / min for 30min at 4℃, and the supernatant was purified by affinity chromatography. Then 39μL of the supernatant was taken, 10μL of 4×SDS loading buffer was added, mixed and boiled in boiling water for 10min, centrifuged at 12000r / min for 5min, 30μL of the supernatant was aspirated and spotted, and the protein gel was taken out after 60min of protein electrophoresis at 120V. Dark bands were visible after staining, and the band size was about 38kDa ( Figure 5 Middle C).

[0118] 3) Purification of target protein: Filter the collected protein supernatant with a 0.22μm microporous membrane filter and store it on ice. Fix the Ni-NTA resin filler on the column, add 3mL Lysis Buffer to the column, and use gravity to wash the 20% ethanol that stores the filler. After the liquid in the column has flowed out, load the filtered protein sample solution onto the affinity chromatography column filler. Wait patiently for the sample to pass through the filler, and then elute the protein with Elution Buffer containing 50, 100, 150, 200 and 250mM imidazole. Collect with EP tube and analyze by SDS-PAGE. The obtained target protein is dialyzed overnight in PBS solution using an 8kDa dialysis bag and collected for later use.

[0119] 4) Western Blot identification of purified products: The collected target protein purified product HA-Mut S SDS-PAGE electrophoresis was performed with Ferritin, and then the protein was transferred from the gel to the NC membrane using a wet transfer system. The parameters of the transfer system were constant current 200mAh for 40min. After the transfer, the membrane was placed in a buffer containing 3% skim milk powder and blocked at room temperature for 1h to prevent specific binding. At the same time, mouse anti-His Tag monoclonal antibody was diluted with PBS buffer at a ratio of 1:4000 as the primary antibody, and it was placed at 4°C for standby use after preparation. After the blocking, the membrane was placed in the primary antibody and incubated at 4°C overnight. The NC membrane was then rinsed with PBST solution 3 times, 3 minutes each time, to remove non-specific binding antibodies. While washing the membrane, HRP-labeled goat anti-mouse IgG was diluted with PBS buffer at a ratio of 1:5000 as the secondary antibody. The washed membrane was placed in the secondary antibody and incubated for 1h. The membrane after the secondary antibody incubation was washed again, added to the ECL chemiluminescent solution for color development in the dark for 1 minute, and then placed in a scanner for scanning and taking pictures. It can be observed that the sizes of the three proteins are consistent with the SDS-PAGE results ( Figure 6 ).

[0120] Example 3 Target protein Mut + and Mut S Affinity determination

[0121] 1) HA-Mut S and HA-Mut +ELISA assay with Q74: Take a high binding 96-well ELISA plate and add 150 μL ELISA coating solution to each well. Add 50 μL of the target protein to the first row and dilute it to the second to last row with a 50 μL dilution ratio using a gun. The last row is used as a blank control. Seal the plate with an ELISA sealing film and place it at 4°C overnight for coating. After the coating is completed, carefully discard the liquid in the ELISA plate, add 300 μL of 3% BSA solution to each well and block it at room temperature for 1 hour. Take the nano antibody Q74 of avian influenza H7 with V5 label (preserved in this laboratory) as the primary antibody (patent application number: CN202211108871.6), dilute it at 1:1000, add 100 μL to each well, and incubate at room temperature. After 2 hours of incubation, carefully discard the supernatant in the plate, gently add 300 μL PBST solution to each well for washing, stay for 5 minutes each time, and wash a total of 3 times. Take the mouse anti-V5 Tag monoclonal antibody as the secondary antibody, dilute it at 1:4000, add 100μL of the diluted secondary antibody to each well, and incubate at room temperature for 3h. Wash the plate with PBST solution. Dilute HRP-labeled goat anti-mouse IgG at 1:5000 as the tertiary antibody and incubate for 1h, 100μL per well. Wash the plate with PBST solution. Add 100μL of TMB colorimetric solution to each well and color at 37℃ in the dark for 30min, then add an equal volume of TMB colorimetric stop solution to stop the reaction. Place the plate in an ELISA reader and read at a wavelength of 450nm.

[0122] ELISA results showed that HA-Mut S and HA-Mut + In OD 450nm The values ​​of HA-Mut S Compared with HA-Mut + The increase is greater ( Figure 7 ). The negative control group was at OD 450nm The value of HA-Mut S and HA-Mut + Both are effective antigens, and HA-MutS has stronger specific binding ability.

[0123] 2) HA-Mut S SPR affinity assay with Q74: HA-Mut SThe protein concentration was adjusted to 0.5 mg / mL, and the concentration of the H7-specific antibody Q74 stored in the laboratory was adjusted to 1 mg / mL. After turning on the Biacore 8K system, the computer entered the Biacore 8K control software and ran the buffer. Measure 50 mL of 10×HBS-EP buffer and 450 mL of deionized water (filtered with a 0.22 μm membrane), mix them well and put them into a 500 mL buffer bottle, and use a sonicator to remove bubbles in the water before use. After placing the prepared buffer and waste liquid bottles, place the NTA sensor chip in the chip compartment of the molecular interaction instrument and prepare to run. According to the computer prompts, place the HA-Mut with a His tag S Add protein to the sample plate and let HA-Mut S Coupled to the NTA chip. Then use the running buffer solution to dilute the antibody at 1:400, 1:800, 1:1600 and 1:3200 times to perform the experiment. After the machine runs, use the data analysis software Biacore T200 Evaluation Software for analysis.

[0124] The analysis results showed that as Q74 with different dilution ratios flowed over the chip surface, the RU value also changed ( Figure 8 (A) RU change trend shows that RU decreases with the decrease of H7 antibody Q74 concentration. The steady-state fitting model was used to calculate the relationship between Q74 and HA-Mut S The affinity between -7 M( Figure 8 (B) Analysis of SPR test results proves that HA-Mut S It has good affinity with antibodies, and the binding ability increases with increasing concentration.

[0125] Example 4 HA-Mut S Extracellular self-assembly of ferritin and its in vitro characterization

[0126] 1) The dialyzed Ferritin and the dialyzed and ELISA-verified HA-Mut S The proteins were assembled at 4°C overnight according to the system shown in Table 1 below to obtain the combined protein HA-MutS-Ferritin. After self-assembly, SDS-PAGE electrophoresis and Western Blot were used to verify the completion of the assembly.

[0127] Table 1 Combination protein self-assembly system (1 mL)

[0128]

[0129] The results showed that the 38kDa Ferritin and the 30-40kDa HA-MutS After the reaction, the HA-MutS-Ferritin protein was successfully assembled with a size of 68-78 kDa, which is consistent with the theoretical value ( Fig. 9 and Fig.10 ).

[0130] 2) Transmission electron microscopy (TEM) and dynamic light scattering (DLS) verification of in vitro characterization

[0131] Observation of protein particle morphology by TEM: HA-Mut S , Ferritin and HA-Mut S -Ferritin is mixed with potassium dichromate negative stain, and then a certain amount of the mixture is drawn and dropped on the electron microscope grid, so that the sample is stained and attached to the grid, and the thin slice required for transmission electron microscopy observation is prepared. A small amount of glutaraldehyde solution is used to fix the protein sample to maintain its morphology and structure. Subsequently, the sample is dehydrated to remove water using an ethanol solvent of gradually increasing concentration. The sample is embedded in a transparent embedding agent and cut into thin slices, which are transferred to a copper grid, stained with phosphotungstic acid, and images of protein particles are observed and photographed using a transmission electron microscope.

[0132] The results showed that Ferritin protein appeared as a hollow iron cage ball under TEM electron microscope, with a size of about 10nm ( Fig.11 Middle A). HA-Mut S The protein appears uniformly spherical under TME electron microscopy, slightly smaller than 10nm ( Fig.11 Middle B). HA-Mut after assembly S -Ferritin protein structure Fig.11 As shown in C, TEM images show that HA-Mut S The HA-Mut protein was successfully assembled with the Ferritin protein, with a diameter of about 30 nm and a polyhedral spherical structure. S Displayed in the form of spikes on the surface of the Ferritin protein.

[0133] Observation of the particle size of protein particles by DLS: HA-Mut S , Ferritin and HA-Mut S -Ferritin protein concentration was adjusted to 1mg / mL, the protein sample was evenly distributed in the sample pool, and the dynamic light scattering instrument was started after adjusting the measurement parameters to measure the scattered light intensity of the protein particles. Based on the data generated by the measurement, the autocorrelation function analysis method was used for data processing and particle size analysis. The DLS test results also proved that the particle size of Ferritin was 10nm, and the HA-Mut S The particle size of the protein is about 7nm. The assembled HA-MutS -Ferritin protein size is about 30nm ( Fig.12 ), which is consistent with the TEM results. The above TEM images and DLS test data show that HA-Mut S -Ferritin successfully self-assembles in vitro.

[0134] Example 5 Vaccine preparation and immunogenicity assessment

[0135] 1) Vaccine preparation: Take a single colony of activated yeast from the YPD+Zeo plate and induce expression to obtain HA-Mut S , Ferritin and HA-Mut + Protein, according to the extracellular self-assembly step of Example 4, HA-Mut S Connected to Ferritin (HA-Mut S -Ferritin). The CpG biosynthetic plasmid mentioned in the invention patent application number CN202311404387 was used as a vaccine adjuvant, and the plasmid was extracted from the pUC19-CpGkm strain. HA-Mut was added with PBS solution. S HA-Mut + The concentrations of HA-Mut + Group and HA-Mut S Each group was injected with 30 μg protein. S -Ferritin and HA-Mut S -Ferritin-CpG added an equal amount of Ferritin protein, so the HA-MutS-Ferritin group and the HA-MutS-Ferritin-CpG group were injected with 60μg of protein. S -Ferritin-CpG group also added 200 μg of CpG adjuvant. + HA-Mut S HA-Mut S -Ferritin and HA-Mut S -Ferritin-CpG was mixed with SEPPIC MONTANIDETM ISA 71VG adjuvant at a volume ratio of 1:1, and the protein solution was mixed with the oil-emulsion adjuvant using a vaccine emulsifier to prepare a water-in-oil vaccine.

[0136] 2) Poultry immunization: 50 gender-balanced SPF white-feathered chickens were randomly divided into 5 groups, each containing 5 males and 5 females. The five groups were named PBS, HA-Mut+ HA-Mut S HA-Mut S -Ferritin and HA-Mut S -Ferritin-CpG. The injection method was multiple subcutaneous injections in the neck. Each chicken in the PBS group was injected with 0.12 mL of emulsified PBS solution; HA-Mut + Group and HA-Mut S Each chicken in the group was injected with 0.12 mL of the corresponding vaccine; HA-Mut S -Ferritin group and HA-Mut S Each chicken in the Ferritin-CpG group was injected with 0.24 mL of the corresponding vaccine. From the first week, serum was collected every 7 days until the antigen titer decreased. The specific experimental process is as follows: Fig.13 As shown in A.

[0137] 3) Humoral Immunity Testing:

[0138] Hemagglutination inhibition: add 25 μL PBS to columns 1 to 11 of a 96-well reaction plate with a v-bottom, and add 50 μL PBS to column 12; add 25 μL of collected chicken serum to column 1, mix well, and pipette to column 2, dilute in multiples to column 10, discard 25 μL PBS after mixing, and do not add to columns 11 and 12; add 25 μL of diluted inactivated AIV H7 subtype Re-122 strain 4 unit antigen suspension to each well from columns 1 to 11, and let stand at room temperature (24 to 25°C) for at least 30 minutes, and do not add to column 12; gently shake and mix 1% red blood cells, and add 25 μL to each well in columns 1 to 12; shake, let stand at room temperature (24 to 25°C) for 40 minutes, and observe the results.

[0139] The results showed that HA-Mut with Ferritin protein S -Ferritin group antibody level and only HA-Mut S HA-Mut S Compared with the control group, there was a significant improvement, proving that the combination of Ferritin and HA antigen can effectively improve the immune effect of the vaccine; HA-Mut S -Ferritin-CpG group produced antibodies and HA-Mut S -Ferritin group has a faster growth rate and higher titer, indicating that CpG adjuvant also has a certain positive auxiliary effect, and the combination of Ferritin and CpG adjuvant can induce a strong humoral immune response in the body ( Fig.13 B and C).

[0140] Antigen-antibody specific ELISA: dialyzed HA-Mut S The protein was coated on a 96-well ELISA plate at 1 μg per well and coated overnight at 4°C. After removing the supernatant, 300 μL of 3% BSA solution was added to each well for blocking at 37°C. After blocking for 1 hour, 40 μL of PBS solution was added to each well, followed by 10 μL of serum sample to be tested, and incubated at 37°C for 2 hours. At the end of the incubation, the plate was washed 3 times with PBST solution, and 100 μL of HRP-labeled goat anti-chicken secondary antibody diluted 1:5000 was added to each well, and reacted at 37°C for 45 minutes. After washing the plate 3 times with PBST solution, 100 μL of TMB colorimetric solution was added to each well, and reacted at 37°C in the dark for 30 minutes. After the reaction in the dark was completed, 100 μL of ELISA reaction stop solution was added to each well, and the reading was read at OD of 450nm.

[0141] The experimental results showed that on the 35th day after immunization, HA-Mut S -Ferritin-CpG group produced the highest level of HA-specific antibodies, proving that CpG vaccine adjuvant can enhance the immune effect of the vaccine. S The antibody titer of the group was significantly lower than that of HA-Mut S -Ferritin group, this result shows that Ferritin nanoparticles greatly enhance the immunogenicity of HA antigen ( Fig.13 (middle D).

[0142] Antibody typing: The corresponding antigen is coated on the ELISA plate, and the sample to be tested is added to the coated microwells in turn, and then combined with the HRP-labeled antigen to form an antigen-antibody-enzyme-labeled antigen complex. After thorough washing, the substrate TMB is added for color development. The OD value is measured at a wavelength of 450nm using an enzyme reader, and the concentration of each antibody in the sample is calculated using the standard curve. The specific operation steps are the same as above.

[0143] The experimental results showed that compared with other groups, HA-Mut S -Ferritin-CpG group immunized SPF chickens induced more abundant HA-specific IgG1 and IgG2b. S -Ferritin-CpG subunit vaccine elicited Th1 and Th2 immune responses, and the IgG1 / IgG2b ratio was less than 1. These results indicate that HA-Mut S -Ferritin-CpG subunit vaccine induces Th1 and Th2 immune responses and is biased towards Th1 immune response ( Fig.13 (middle E~G).

[0144] 4) Cellular Immunoassay:

[0145] Isolation of peripheral blood lymphocytes: Use a 0.55μm sterile blood collection needle and a sodium heparin vacuum blood collection tube to collect peripheral blood samples from the subwing vein of the chicken. Mix the blood sample with an equal volume of sterile PBS buffer. Slowly add the diluted blood sample to a sterile centrifuge tube, and then centrifuge it at 400r / min for 20min. After centrifugation, you can see that the blood is layered in the centrifuge tube, with serum on the upper layer, white blood cells in the middle layer, and red blood cells in the lower layer. Use a sterile Pasteur pipette to draw the white blood cells in the middle layer into a new sterile centrifuge tube. Add an equal volume of sterile PBS to the separated white blood cells and mix gently for washing. Then centrifuge at 300r / min for 5min. Resuspend the precipitated cells with sterile PBS or to evenly disperse the cells and set aside.

[0146] T lymphocyte detection: Use a sterile Pasteur pipette to resuspend the peripheral blood lymphocytes separated in the above step, count the cells, and dilute the concentration of each cell to 1×10 5 cells / mL. Dispense 100μL of lymphocyte suspension into 1.5mL EP tubes, and then add diluted APC-labeled CD3 antibody, FITC-labeled CD4 antibody, and PE-labeled CD8 antibody to the EP tubes. Incubate on ice in the dark for 20 minutes, centrifuge at 350r / min for 5 minutes, and discard the supernatant. Gently wash twice with PBS solution containing 2% FBS, add 200μL of PBS solution containing 2% FBS to the EP tubes to resuspend the cells, and quickly test on the machine.

[0147] The results showed that at week 3 after immunization, HA-Mut + Group, HA-Mut S Group, HA-Mut S -Ferritin group and HA-Mut S -Ferritin-CpG group induced CD4 + and CD8 + T lymphocytes proliferated massively, among which HA-Mut S -Ferritin group had the strongest proliferation effect ( Fig.14 A and B).

[0148] Cytokine detection: After the chicken peripheral blood lymphocytes were extracted and counted, they were diluted to 1×10 5 cells / mL, take 2mL into a suspended six-well plate. Add HA-Mut at 3mg / mL S The cells were stimulated with antigens and cultured for 24 h at 37°C and 5% CO2. After the stimulation, the supernatant was taken for ELISA detection of cytokines.

[0149] The results showed that HA-Mut S -Ferritin group and HA-Mut S -Ferritin-CpG group produced higher IL-4, IFN-γ and TNF-α. Different from the experimental results of humoral immunity, in cellular immunity, HA-Mut S -Ferritin group compared with HA-Mut S -Ferritin-CpG group can stimulate higher T cell immune response ( Fig.14 Middle C).

[0150] The embodiments of the present invention are described in detail above in conjunction with the accompanying drawings, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. An immunogenic complex, characterized in that Include: An antigen containing the HA protein of the H7N9 avian influenza virus and a nanoparticle carrier containing a carrier protein; The carrier protein is Ferritin protein; The nanoparticle carrier is covalently linked to the antigen via SpyCatcher-SpyTag.

2. The immunogenic complex according to claim 1, characterized in that The antigen contains HA protein and SpyTag, and the SpyTag is located at the C-terminus of the HA protein; Preferably, the antigen further comprises a His tag located at the C-terminus of the HA protein; Preferably, the nucleotide sequence of the His tag is as shown in SEQ ID NO:

2.

3. The immunogenic complex according to claim 1, characterized in that The nanoparticle carrier includes Ferritin protein and SpyCatcher, and the SpyCatcher is located at the N-terminus of the Ferritin protein; Preferably, the nanoparticle carrier further comprises a His tag located at the N-terminus of the Ferritin protein; Preferably, the nucleotide sequence of the His tag is as shown in SEQ ID NO:

3.

4. The immunogenic complex according to claim 3, characterized in that The nanoparticle carrier comprises HIS tag-Ferritin protein-SpyCatcher, and the amino acid sequence of HIS tag-Ferritin protein-SpyCatcher is shown in SEQ ID NO:

7.

5. The immunogenic complex according to claim 4, characterized in that The amino acid sequence of the antigen is shown in SEQ ID NO:

4.

6. The method for preparing the immunogenic complex according to any one of claims 1 to 5, comprising the following steps: The antigen is mixed with the nanoparticle carrier and incubated to obtain an immunogenic complex.

7. A biological material related to the immunogenic complex according to any one of claims 1 to 5, wherein the biological material is any one of a1) to a12): a1) a nucleic acid molecule encoding the immunogenic complex according to any one of claims 1 to 5; a2) an expression cassette containing the nucleic acid molecule described in a1); a3) a recombinant vector containing the nucleic acid molecule described in a1); a4) a recombinant vector containing the expression cassette described in a2); a5) a recombinant microorganism containing the nucleic acid molecule described in a1); a6) a recombinant microorganism containing the expression cassette described in a2); a7) a recombinant microorganism containing the recombinant vector described in a3); a8) a recombinant microorganism containing the recombinant vector described in a4); a9) a transgenic animal cell line containing the nucleic acid molecule described in a1); a10) a transgenic animal cell line containing the expression cassette described in a2); a11) a transgenic animal cell line containing the recombinant vector described in a3); a12) a transgenic animal cell line containing the recombinant vector described in a4); Preferably, the nucleic acid molecule encoding the immunogenic complex according to any one of claims 1 to 5 comprises a nucleic acid molecule encoding an antigen and a nucleic acid molecule encoding a nanoparticle carrier.

8. Use of the immunogenic complex according to any one of claims 1 to 5 or the biomaterial according to claim 7 in the preparation of a medicament for preventing and / or treating diseases caused by avian influenza virus.

9. A vaccine comprising the immunogenic complex according to any one of claims 1 to 5 and / or the biological material according to claim 7; Preferably, the vaccine further comprises an adjuvant and / or a pharmaceutically acceptable carrier.

10. A kit comprising the vaccine according to claim 9 and a container for vaccination.

Images