Application of TRIM21 / OTUD4 in removal of SHBs / HBsAg

Abstract

The invention discloses a medicine for removing SHBs / HBsAg protein and a preparation method thereof, and relates to the technical field of biology, the medicine comprises a recombinant plasmid of a TRIM21 gene and / or OTUD4 small interfering RNA; the preparation method comprises the following steps: synthesizing a TRIM21 gene and cloning the TRIM21 gene to an expression vector to obtain a recombinant plasmid; synthesizing a small interfering RNA (Ribonucleic Acid) of the OTUD4 gene; and transfecting the constructed recombinant plasmid or the synthesized small interfering RNA into liver cancer cells for expressing SHBs protein or HBV (Hepatitis B Virus). According to the present invention, the construction of the recombinant vector pcDNATM3.1 / myc-His (-) A-TRIM21-myc and the construction of the OTUD4 siRNA are constructed; overexpression of TRIM21 or knockout of OTUD4 can significantly inhibit expression of SHBs / HBsAg protein in liver cancer cells, expression of HBsAg and HBeAg protein secreted out of the cells and the HBV DNA level.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to an application of TRIM21 / OTUD4 in clearing SHBs / HBsAg. Background Art

[0002] Hepatitis B virus (HBV) infection can cause acute and chronic hepatitis, and lead to liver fibrosis, cirrhosis and hepatocellular carcinoma. HBV infection is a major global public health problem. At present, direct antiviral strategies based on interferon and nucleoside analogs cannot completely eliminate HBV in patients. Therefore, the goal of the discovery and development of anti-HBV infection drugs has shifted from completely eliminating HBV to achieving functional cure of chronic hepatitis B (CHB). HBV surface antigen (HBsAg) is one of the main pathogenic factors of HBV. Sustained high levels of HBsAg can lead to immune exhaustion and greatly increase the risk of liver cancer in CHB patients. Clearance of HBsAg is considered to be a "functional cure" of HBV in clinical practice. Currently, a variety of drugs have been developed to target the removal or block the secretion of HBsAg into the serum, including small interfering RNA (AB-729) and antisense oligonucleotides (ASO) designed to hinder the synthesis or translation of HBsAg, as well as nucleic acid polymers (NAPs) and S-antigen transport inhibitory oligonucleotide polymers (STOPs) to inhibit HBsAg secretion. Although a variety of drugs have been developed to target the removal or block the secretion of HBsAg into the serum, due to issues such as duration, efficacy and safety, it is currently impossible to completely remove HBsAg, and more drugs need to be developed to remove HBsAg. SHBs is the most stable and abundant part of HBsAg, accounting for about 70% of HBsAg, and the SHBs region is a common segment of LHBs, MHBs and SHBs. The E3 ubiquitin ligase and deubiquitinase of SHBs may also be the E3 ubiquitin ligase and deubiquitinase of LHBs and MHBs. The E3 ubiquitin ligase and deubiquitinase that regulates SHBs protein can not only regulate the protein level of SHBs, but also act on the protein levels of LHBs and MHBs.

[0003] Therefore, those skilled in the art are committed to developing a drug for clearing SHBs / HBsAg protein targeting TRIM21 protein and OTUD4 protein and a preparation method thereof. Summary of the invention

[0004] In view of the above-mentioned defects of the prior art, the technical problem to be solved by the present invention is to develop a drug for clearing SHBs / HBsAg protein targeting TRIM21 protein and OTUD4 protein and a preparation method thereof.

[0005] To achieve the above object, the present invention provides a drug for clearing SHBs / HBsAg protein, comprising a recombinant plasmid of TRIM21 gene and / or OTUD4 small interfering RNA, and targeting TRIM21 protein and OTUD4 protein.

[0006] Furthermore, the GenBank accession number of the TRIM21 gene is NM_003141.4, the nucleotide sequence thereof is shown in the sequence listing SEQ ID NO: 1, and the amino acid sequence of the encoded protein thereof is shown in the sequence listing SEQ ID NO: 2.

[0007] Furthermore, the GenBank accession number of the OTUD4 gene is: NM_001366057.1, the nucleotide sequence thereof is shown in the sequence listing as SEQ ID NO: 3, and the amino acid sequence of the encoded protein thereof is shown in the sequence listing as SEQ ID NO: 4.

[0008] The present invention also provides a method for preparing a drug for removing SHBs / HBsAg protein, comprising the following steps:

[0009] Step 1, synthesize the TRIM21 gene and clone it into an expression vector to obtain a recombinant plasmid;

[0010] Step 2, synthesizing small interfering RNA of OTUD4 gene;

[0011] Step 3: transfect the recombinant plasmid constructed in step 1 or the small interfering RNA synthesized in step 2 into liver cancer cells expressing SHBs protein or expressing HBV.

[0012] Furthermore, step 1 also includes: extracting mRNA from liver cancer cell Huh7, reverse transcribing and constructing a cDNA library.

[0013] Furthermore, step 1 further comprises: the nucleotide sequence of the TRIM21 gene is as shown in SEQ ID NO: 1, synthetic primers are designed according to the sequence SEQ ID NO: 1, and the TRIM21 gene is synthesized from the cDNA library.

[0014] Furthermore, the synthetic primers include primer 1 and primer 2; the nucleotide sequence of primer 1 is: CGGAATTCGCCACCATGGCTTCAGCAGCACGCTT; the nucleotide sequence of primer 2 is: CCCAAGCTTTTACAGATCCTCTTCAGAGATGAGTTTCTGCTCATAGTCAGTGGATC CTTGTG.

[0015] Furthermore, the method also includes amplifying the TRIM21 gene. The amplification reaction conditions are 96°C for 5 minutes, (95°C for 30 seconds, 58°C for 30 seconds, 72°C for 1 minute), for a total of 25 cycles, and 72°C for 10 minutes.

[0016] Furthermore, step 2 also includes a primer pair for synthesizing small interfering RNA, including primer OTUD4 siRNA#1 and primer OTUD4 siRNA#2, the sequence of primer OTUD4 siRNA#1 is: OTUD4 siRNA#1: 5'-UCGAGAGAACAGAGAGAAATT-3'; the sequence of primer OTUD4 siRNA#2 is: 5'-GGGUAGGACAAGUGGAAAUTT-3'.

[0017] Furthermore, step 3 also includes: detecting the intracellular SHBs / HBsAg protein expression, the extracellular HBsAg, HBeAg and HBV DNA expression by protein immunoblotting, enzyme-linked immunosorbent assay and real-time fluorescence quantitative PCR experiment.

[0018] Furthermore, agonists of E3 ubiquitin ligases or inhibitors of deubiquitinases can be used as drugs for treating disease-related diseases. The present invention found that overexpression of TRIM21 or knockdown of OTUD4 can reduce the levels of SHBs / HBsAg protein and other viral markers HBeAg and HBV DNA, providing a new target for the elimination of SHBs / HBsAg.

[0019] In the preferred embodiment 1 of the present invention, the construction process of the cDNA library is described in detail;

[0020] In another preferred embodiment 2 of the present invention, the construction of the expression vector, transformation of the host, and identification of the positive clone are described in detail;

[0021] In another preferred embodiment 3 of the present invention, the process of designing and synthesizing siRNA is described in detail;

[0022] In another preferred embodiment 4 of the present invention, the host transfection and protein expression detection process are described in detail;

[0023] In another preferred embodiment 5 of the present invention, the process of detecting protein expression outside secretory cells is described in detail;

[0024] In another preferred embodiment 6 of the present invention, the process of detecting the level of HBV DNA outside the secreted cells is described in detail.

[0025] The beneficial technical effects of the present invention are as follows:

[0026] The present invention analyzes the E3 ubiquitin ligase TRIM21 and the deubiquitinase OTUD4 that regulate the stability of SHBs / HBsAg proteins, provides a theoretical basis for the development of drugs or intervention measures to remove SHBs / HBsAg proteins, and also provides a potential new antiviral target for the clinical functional cure of HBV, specifically:

[0027] The recombinant vector pcDNATM3.1 / myc-His(-)A-TRIM21-myc and OTUD4 siRNA were constructed;

[0028] Overexpression of TRIM21 or knockdown of OTUD4 can significantly inhibit the expression of SHBs / HBsAg proteins in liver cancer cells, the expression of HBsAg and HBeAg proteins secreted into the cells, and the level of HBV DNA.

[0029] The concept, specific structure and technical effects of the present invention will be further described below in conjunction with the accompanying drawings to fully understand the purpose, characteristics and effects of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 It is a schematic diagram of the structure of the expression vector pcDNATM3.1 / myc-His(-)A of a preferred embodiment 1 of the present invention;

[0031] Figure 2 is an electrophoresis pattern of the amplified sample TRIM21 genomic DNA product of a preferred embodiment 2 of the present invention;

[0032] Figure 3 The electrophoresis pattern of the recombinant plasmid pcDNATM3.1 / myc-His(-)A-TRIM21-myc of a preferred embodiment 2 of the present invention after double digestion with EcoRI and HindIII;

[0033] Figure 4 This is an electrophoresis diagram of reducing the protein level of SHBs by overexpressing TRIM21 and knocking down OTUD4 in a preferred embodiment 4 of the present invention;

[0034] Figure 5 This is an electrophoresis diagram of reducing the intracellular HBsAg protein level by overexpressing TRIM21 and knocking down OTUD4 in a preferred embodiment 4 of the present invention;

[0035] Figure 6 This is a bar graph showing that overexpression of TRIM21 and knockdown of OTUD4 reduce the levels of HBsAg and HBeAg proteins outside secreted cells according to a preferred embodiment 5 of the present invention;

[0036] Figure 7This is a bar graph showing that overexpression of TRIM21 and knockdown of OTUD4 reduce the level of extracellular HBV DNA in a preferred embodiment 6 of the present invention. DETAILED DESCRIPTION

[0037] The following describes several preferred embodiments of the present invention with reference to the drawings in the specification, so that the technical content is clearer and easier to understand. The present invention can be embodied in many different forms of embodiments, and the protection scope of the present invention is not limited to the embodiments mentioned in the text.

[0038] Example 1 Construction of cDNA library

[0039] The nucleotide sequence of the TRIM21 gene (GenBank accession number: NM_003141.4) is shown in the sequence list as SEQ ID NO1, and the amino acid sequence of the encoded protein is shown in the sequence list as SEQ ID NO2. Synthetic primers were designed based on the sequence, mRNA was extracted from liver cancer cell Huh7, reverse transcribed and a cDNA library was constructed, and the target gene was synthesized from the cDNA library using the above primers and cloned into an expression vector. The schematic diagram of the structure of the expression vector pcDNATM3.1 / myc-His(-)A is shown in Figure 1 As shown, the recombinant plasmid was obtained.

[0040] Take 1x10 6 The total RNA of the sample cells was extracted using Qiagen RNeasy mini kit, and then further reverse transcribed into cDNA using Takara's PrimeScript RT Master Mix. The amplification reaction conditions were 37℃15min, 85℃5sec, and stored at 4℃.

[0041] Example 2 Construction of expression vector, transformation of host, and identification of positive clones

[0042] Primers (primer 1: CGGAATTCGCCACCATGGCTTCAGCAGCACGCTT; primer 2: CCCAAGCTTTTACAGATCCTCTTCAGAGATGAGTTTCTGCTCATAGTCAGTGGATC CTTGTG) were designed to amplify the TRIM21 gene using PrimeSTARMax Premix (2x) from Takara. The electrophoresis pattern of the amplified sample TRIM21 genomic DNA product is shown in Figure 2As shown, M: molecular weight standard; sample 1 is the PCR product of TRIM21 with a value of 1428 bp. The conditions for the amplification reaction are 96°C for 5 min, (95°C for 30 s, 58°C for 30 s, 72°C for 1 min) for a total of 25 cycles, 72°C for 10 min, and stored at 4°C. After double digestion with EcoRI and HindIII, it was cloned into the E. coli expression vector pcDNATM3.1 / myc-His(-)A of Invitrogen, transformed into the E. coli host DH5α, and the transformed positive clones were selected by PCR identification, and further identified by enzyme digestion. The electrophoretic pattern of the recombinant plasmid pcDNATM3.1 / myc-His(-)A-TRIM21-myc identified by double digestion with EcoRI and HindIII is shown in the figure below. Figure 3 As shown, M: molecular weight standard; sample 1 is the enzyme digestion product of the expression vector pcDNATM3.1 / myc-His(-)A; sample 2 is the enzyme digestion product of the recombinant plasmid pcDNATM3.1 / myc-His(-)A-TRIM21-myc.

[0043] Sequencing identification, the sequencing primers used the vector's own primers T7 promoter: TAATACGACTCACTATAG and T7 terminator: GCTAGTTATTGCTCAGCGGT to obtain the recombinant plasmid pcDNATM3.1 / myc-His(-)A-TRIM21-myc.

[0044] Example 3 Design and synthesis of siRNA

[0045] The nucleotide sequence of the OTUD4 gene (GenBank accession number: NM_001366057.1) is shown in the sequence listing as SEQ ID NO: 3, and the amino acid sequence of the encoded protein is shown in the sequence listing as SEQ ID NO: 4. Small interfering RNA (siRNA) was designed and synthesized based on the sequence.

[0046] Two siRNAs targeting OTUD4 were designed and synthesized, and the sequences were as follows: OTUD4 siRNA#1: 5'-UCGAGAGAACAGAGAGAAATT-3'; OTUD4 siRNA#2: 5'-GGGUAGGACAAGUGGA AAU TT-3'.

[0047] Example 4 Host transfection and protein expression detection

[0048] The recombinant plasmids or synthesized siRNA constructed in Examples 2 and 3 were transfected into liver cancer cells expressing SHBs protein or HBV, and the intracellular SHBs / HBsAg protein expression, extracellular HBeAg and HBV DNA expression were detected by Western blotting, enzyme-linked immunosorbent assay and real-time fluorescence quantitative PCR.

[0049] Hepatoma cells expressing SHBs or HBV were counted at 3.5×10 5 Cells were inoculated into 35 mm cell culture dishes. After 12-16 hours, the cell confluence reached 80%. Invitrogen's Lipofectamine 3000 transfection reagent was used to transfect 3 μg of pcDNATM3.1 / myc-His(-)A-TRIM21-myc plasmid (empty plasmid pcDNATM3.1 / myc-His(-)A plasmid) or 120 pmol of OTUD4 siRNA into the cells. 48 hours after cell transfection, total cell protein was extracted with Western&IP cell lysis buffer from Bio-Tech and protein quantity was detected with BCA protein quantification kit from Thermo Scientific. Immunoblotting was performed: equal amounts of protein were electrophoresed by SDS-PAGE and transferred to PVDF membranes. The expression of target protein was detected with the tag antibody myc antibody from CellSignaling Technology and the OTUD4 antibody from Abcam, and the expression of target protein was detected with the SHBs antibody from Creative Diagnostics.

[0050] The results of immunoblotting showed that overexpression of TRIM21-myc protein in liver cancer cells or two siRNAs knocked down OTUD4 expression in liver cancer cells, and overexpression of TRIM21 protein or knockdown of OTUD4 protein could reduce the expression of SHBs and HBsAg proteins in cells. Overexpression of TRIM21 and knockdown of OTUD4 reduced the level of SHBs protein. Figure 4 As shown in Figure 2, overexpression of TRIM21 and knockdown of OTUD4 reduced the intracellular HBsAg protein level. Figure 5 shown.

[0051] Example 5 Detection of protein expression outside secreted cells

[0052] 3.5×10 hepatoma cells expressing HBV 5Cells were inoculated into 35 mm cell culture dishes. After 12-16 hours, the cell confluence reached 80%. Invitrogen's Lipofectamine 3000 transfection reagent was used to transfect 3 μg of pcDNATM3.1 / myc-His(-)A-TRIM21-myc plasmid (empty plasmid pcDNATM3.1 / myc-His(-)A plasmid) or 120 pmol of OTUD4 siRNA into the cells. 48 hours after cell transfection, the supernatant of the cultured cells was collected and tested by enzyme-linked immunosorbent assay: the expression of HBsAg and HBeAg secreted into the cells was detected by the hepatitis B virus surface antigen detection kit and hepatitis B virus e antigen detection kit of Wantai Biological Company.

[0053] The results of enzyme-linked immunosorbent assay showed that overexpression of TRIM21 protein or knockdown of OTUD4 protein could reduce the expression of HBsAg and HBeAg secreted outside cells. Overexpression of TRIM21 and knockdown of OTUD4 could reduce the levels of HBsAg and HBeAg secreted outside cells. Figure 6 shown.

[0054] Example 6 Detection of HBV DNA levels outside secreted cells

[0055] 3.5×10 hepatoma cells expressing HBV 5 Cells were inoculated into 35 mm cell culture dishes. After 12-16 hours, the cell confluence reached 80%. Invitrogen's Lipofectamine 3000 transfection reagent was used to transfect 3 μg of pcDNATM3.1 / myc-His(-)A-TRIM21-myc plasmid (empty plasmid pcDNATM3.1 / myc-His(-)A plasmid) or 120 pmol of OTUD4 siRNA into the cells. 48 hours after cell transfection, the cell supernatant was collected, and HBV DNA was released with HBV sample release agent of Yisheng Company. The HBV DNA level was further detected by real-time fluorescence quantitative PCR using Yisheng Company's hepatitis B virus nucleic acid detection kit (PCR-fluorescence method). The amplification reaction conditions were 25℃30s 1cycle, 94℃5min 1cycle, (94℃15s, 57℃30s) for a total of 45 cycles.

[0056] The results of real-time fluorescence quantitative PCR experiments showed that overexpression of TRIM21 protein or knockdown of OTUD4 protein could inhibit the level of HBV DNA secreted into cells. Overexpression of TRIM21 and knockdown of OTUD4 reduced the level of HBV DNA secreted into cells. Figure 7 shown.

[0057] The above results prove that overexpression of TRIM21 or knockdown of OTUD4 can significantly inhibit the expression of SHBs / HBsAg proteins in liver cancer cells and the expression of HBsAg and HBeAg proteins secreted into the cells and the level of HBV DNA.

[0058] The preferred specific embodiments of the present invention are described in detail above. It should be understood that ordinary technicians in the field can make many modifications and changes based on the concept of the present invention without creative work. Therefore, all technical solutions that can be obtained by technicians in the technical field based on the concept of the present invention through logical analysis, reasoning or limited experiments on the basis of the prior art should be within the scope of protection determined by the claims.

Claims

1. A drug for removing SHBs / HBsAg protein, characterized in that: The drug comprises a recombinant plasmid of the TRIM21 gene and an OTUD4 small interfering RNA, and the targets of the drug are the TRIM21 protein and the OTUD4 protein.

2. The drug according to claim 1, characterized in that The GenBank accession number of the TRIM21 gene is NM_003141.4, the nucleotide sequence thereof is shown in the sequence listing SEQ ID NO: 1, and the amino acid sequence of the encoded protein thereof is shown in the sequence listing SEQ ID NO:

2.

3. The drug according to claim 1, characterized in that The GenBank accession number of the OTUD4 gene is NM_001366057.1, the nucleotide sequence thereof is shown in the sequence listing as SEQ ID NO: 3, and the amino acid sequence of the encoded protein thereof is shown in the sequence listing as SEQ ID NO:

4.

4. A method for preparing the drug according to claim 1, characterized in that: The method comprises the following steps: Step 1, synthesize the TRIM21 gene and clone it into an expression vector to obtain a recombinant plasmid; Step 2, synthesizing small interfering RNA of OTUD4 gene; Step 3: transfect the recombinant plasmid constructed in step 1 or the small interfering RNA synthesized in step 2 into liver cancer cells expressing SHBs protein or expressing HBV.

5. The method according to claim 4, characterized in that The step 1 also includes: extracting mRNA from liver cancer cell Huh7, reverse transcribing and constructing a cDNA library.

6. The method according to claim 5, characterized in that The step 1 further comprises: the nucleotide sequence of the TRIM21 gene is as shown in SEQ ID NO: 1, a synthetic primer is designed according to the sequence SEQ ID NO: 1, and the TRIM21 gene is synthesized from the cDNA library.

7. The method according to claim 6, characterized in that The synthetic primers include primer 1 and primer 2; the nucleotide sequence of primer 1 is: CGGAATTCGCCACCATGGCTTCAGCAGCACGCTT; the nucleotide sequence of primer 2 is: CCCAAGCTTTTACAGATCCTCTTCAGAGATGAGTTTCTGCTCATAGTCAGTGGATC CTTGTG.

8. The method according to claim 6, characterized in that It also includes amplification of TRIM21 gene. The amplification reaction conditions are 96°C for 5 min, (95°C for 30 s, 58°C for 30 s, 72°C for 1 min) for a total of 25 cycles, and 72°C for 10 min.

9. The method according to claim 4, characterized in that The step 2 also includes synthesizing a primer pair for small interfering RNA, wherein the primer pair includes primer OTUD4 siRNA#1 and primer OTUD4 siRNA#2, the sequence of primer OTUD4 siRNA#1 is: OTUD4 siRNA#1: 5'-UCGAGAGAACAGAGAGAAATT-3'; the sequence of primer OTUD4 siRNA#2 is: 5'-GGGUAGGACAAGUGGAAAU TT-3'.

10. The method according to claim 4, characterized in that The step 3 also includes: detecting the intracellular SHBs / HBsAg protein expression, the extracellular HBsAg, HBeAg and HBV DNA expression by protein immunoblotting, enzyme-linked immunosorbent assay and real-time fluorescence quantitative PCR experiment.

Images