Aromatic hydrocarbon receptor activator as well as preparation method and application thereof
By developing the aromatic hydrocarbon receptor activator 6-(3-hydroxyphenyl)-2-methoxyquinoline, the problem of difficulty in effectively treating psoriasis and specific dermatitis in the prior art has been solved, and the activity of AhR is achieved significant activation and significant effects of psoriasis treatment.
Patent Information
- Application Number
- CN202411326562.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-23
- Publication Date
- 2024-12-27
AI Technical Summary
Existing aromatic hydrocarbon receptor activators are difficult to effectively treat diseases caused by abnormal AhR activity such as psoriasis and specific dermatitis, and there is a lack of new treatment directions.
An aromatic hydrocarbon receptor activator 6-(3-hydroxyphenyl)-2-methoxyquinoline was developed, prepared by condensation reflux reaction, for activation of AhR as a new use of anti-psoriatic drugs.
6-(3-hydroxyphenyl)-2-methoxyquinoline can significantly activate AhR activity, showing important application value in the treatment of diseases caused by abnormal AhR activity, especially in the treatment of psoriasis.
Smart Images
Figure CN119192077A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of medical technology, and specifically relates to an aromatic hydrocarbon receptor activator and a preparation method and application thereof. Background Art
[0002] Introduction to Aryl hydrocarbon receptor (AhR): Aryl hydrocarbon receptor (AhR) is a ligand-dependent transcription factor that can bind exogenous and endogenous chemicals, regulate the expression of multiple genes, and have positive or negative effects in multiple organs including the skin.
[0003] Biological processes regulated after aryl hydrocarbon receptor activation: AhR is a ligand-activated transcription factor. In the absence of ligand, AhR exists in the cytoplasm and forms a protein complex with heat shock protein 90 (HSP90), hepatitis B virus X-associated protein 2 (XAP-2), and p23. After ligand binding, AhR dissociates from the cytoplasmic complex, exposing the nuclear translocation site of AhR. Then, AhR translocates to the nucleus, dimers with AhR nuclear translocation protein (ARNT), binds to DNA response elements called heterologous response elements (XRE), and upregulates the transcription of target genes, such as members of the phase I metabolic enzyme cytochrome P450 (CYP) (i.e., CYP1A1, CYP1A2, and CYP1B1). In terms of immune response, AhR signaling affects the differentiation of helper T cells (Th17) and plays an important role in the production of IL-22.
[0004] Aryl hydrocarbon receptor-related diseases: Psoriasis is an autoimmune-mediated disease characterized by widespread desquamation and erythema. It is highly comorbid with other autoimmune diseases and coexists with cardiovascular, metabolic and kidney diseases, seriously affecting people's physical and mental health. Atopic dermatitis is a common heterogeneous eczematous skin disease with frequent recurrences and intense itching. Its lifetime incidence is as high as 20% in the general population, seriously reducing people's quality of life. Psoriasis and atopic dermatitis are common inflammatory skin diseases. IL-4 and IL-13 play a key pathogenic role in atopic dermatitis, and TNF-α, IL-23 and IL-17 play a key pathogenic role in psoriasis. Although the signaling pathways of the two are different, 81% of the dysregulated genes in atopic dermatitis are the same as those in psoriasis. Studies have shown that the marketed AhR agonist benvimod can effectively treat atopic dermatitis and psoriasis. Inflammatory bowel disease (IBD) is characterized by bloody diarrhea, often causing mucosal ulcers and impaired intestinal function. AhR expression is defective in the inflamed intestine of patients with inflammatory bowel disease. Targeted activation of AhR to alleviate the above symptoms is expected to provide a new direction for the treatment of the above diseases. In view of this, how to develop AhR activators is an important issue that needs to be solved in the treatment of diseases caused by abnormal AhR activity. Summary of the invention
[0005] The purpose of the present invention is to provide an aromatic hydrocarbon receptor activator and a preparation method and application thereof.
[0006] To achieve the above object, the technical solution of the present invention is as follows:
[0007] The first aspect of the present invention provides an aromatic hydrocarbon receptor activator, which is 6-(3-hydroxyphenyl)-2-methoxyquinoline, and has the structural formula:
[0008]
[0009] The second aspect of the present invention provides a method for preparing the aromatic hydrocarbon receptor activator described in the first aspect, comprising the following steps:
[0010] With 6-bromo-2-methoxyquinoline, 3-hydroxybenzene-boric acid, potassium carbonate, tetrakistriphenylphosphine palladium and toluene as raw materials, a condensation reflux reaction is carried out under N2 protection. After the reaction is completed, ethyl acetate and water are added for stirring. After standing and stratification, the ethyl acetate layer is taken to make a sand, and 6-(3-hydroxyphenyl)-2-methoxyquinoline is obtained by elution.
[0011] Furthermore, the amount of 6-bromo-2-methoxyquinoline used is 500 mg, the amount of 3-hydroxybenzene-boric acid used is 234 mg, the amount of potassium carbonate used is 551 mg, the amount of tetrakistriphenylphosphine palladium used is 200 mg, and the amount of toluene used is 10 mL.
[0012] Furthermore, the temperature of the condensation reflux reaction is 110° C. and the time is 4 hours.
[0013] The third aspect of the present invention provides use of the aryl hydrocarbon receptor activator described in the first aspect in the preparation of an anti-psoriasis drug.
[0014] The fourth aspect of the present invention provides an anti-psoriasis pharmaceutical composition, comprising the aryl hydrocarbon receptor activator described in the first aspect.
[0015] Compared with the prior art, the present invention has the following beneficial effects:
[0016] The present invention demonstrates for the first time a new use of 6-(3-hydroxyphenyl)-2-methoxyquinoline. 6-(3-hydroxyphenyl)-2-methoxyquinoline can activate the activity of AhR, and can be used as an aromatic hydrocarbon receptor activator for preparing anti-psoriasis drugs, and has important application value in the treatment of diseases caused by abnormal AhR activity. BRIEF DESCRIPTION OF THE DRAWINGS
[0017] Figure 1 6-(3-hydroxyphenyl)-2-methoxyquinoline prepared in Example 1 1H NMR spectrum;
[0018] Figure 2 This is the sequence diagram of AhR-mediated luciferase reporter gene;
[0019] Figure 3 This is a diagram of AhR activity activated by Benvimod;
[0020] Figure 4 This is a heat map of AhR activation activity of 56 quinoline compounds at two concentrations of 5 μM and 20 μM;
[0021] Figure 5 The diagram shows the AhR activation activity of 6-substituted aryl-2-methoxyquinolines within 8 hours and 24 hours;
[0022] Figure 6 The diagram shows the AhR activation activity of 6-hydroxy-2-methoxyquinoline within four time periods of 8 hours, 24 hours, 48 hours and 72 hours;
[0023] Figure 7 is the relative expression level of AhR and CYP1A1 at the transcription level;
[0024] Figure 8 The relative expression and quantitative analysis statistical graphs of AhR and CYP1A1 protein levels;
[0025] Fig. 9 Representative pictures of the back skin of each group of Balb / c mice;
[0026] Fig.10 HE staining images of the back skin of each group of Balb / c mice;
[0027] Fig.11 This is a statistical chart of epidermal thickness, number of epidermal processes, and length of epidermal processes in Balb / c mice;
[0028] Fig.12 The Ki67 immunohistochemistry images of the back skin of each group of Balb / c mice;
[0029] Fig.13 This is a statistical chart of Balb / c Ki67 expression. DETAILED DESCRIPTION
[0030] In order to facilitate the understanding of the present invention, the present invention will be described more fully below. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.
[0031] Example 1
[0032] Preparation of 6-(3-Hydroxyphenyl)-2-methoxyquinoline
[0033] The reaction route is as follows:
[0034]
[0035] Accurately weigh 500 mg of 6-bromo-2-methoxyquinoline, 234 mg of 3-hydroxybenzene-boric acid, 551 mg of potassium carbonate, 200 mg of tetrakistriphenylphosphine palladium, and 10 mL of toluene in a round-bottom flask, pass N2 protection, and perform condensation reflux reaction at an external temperature of 110°C. After reacting for 4 hours, stop heating, wait for the reaction bottle to cool to room temperature, add ethyl acetate and water, stir, transfer to a separatory funnel, let it stand and separate, take the ethyl acetate layer to make a sand, use ethyl acetate and petroleum ether (volume ratio 1:20) as eluent, and obtain 205 g of white powder, i.e. 6-(3-hydroxyphenyl)-2-methoxyquinoline, with a yield of 47.9%. 1 H NMR spectrum is shown in Figure 1 .
[0036] Example 2
[0037] Study on the Effect of 6-(3-Hydroxyphenyl)-2-Methoxyquinoline on AhR Activity
[0038] 1. Construction of AhR-mediated luciferase reporter gene
[0039] (1) The AhR luciferase reporter gene vector is pRSV-AhR-Luc, see Figure 2 Using the pRSV-STAT3-Luc vector as a template, the STAT3 transcription factor response element sequence was replaced with the AhR transcription factor response element sequence after restriction digestion to construct the AhR reporter gene lentiviral plasmid vector pRSV-AhR-Luc.
[0040] (2) Mix the vector psPA×2:pMD2.G:pRSV-AhR in a ratio of 2:1:2 and use LipoFiter TM The reagent was used to transfect 293T cells. 72 hours after transfection, the culture medium was collected and centrifuged. PEG 8000 was added to concentrate the lentivirus. The cells were centrifuged at 12000×g for 10 min. The precipitate was mixed by pipetting with PBS and added to Hacat cells. Puromycin was added to a concentration of 2.5 μg / mL, and stable expression cell lines were screened to obtain Hacat AhR-Luc cells.
[0041] (3) Hacat AhR-Luc cells were passaged to 96-well plates so that the cell confluence rate was 100% when the drug was added. The experiment was divided into a benvimod-treated group and a control group: the benvimod-treated group was treated with 20μM, 10μM, 5μM, 2.5μM, and 0μM at a 24h treatment time; the control group was treated with the same concentration of DMSO for 24h. After the cells were treated for 24h, the culture medium was aspirated, 1×PBS was added, and the cells were washed after 10min. The PBS was aspirated, and cell lysis buffer was added, and the cells were treated at 4°C for 1h. 60μL was aspirated to a 96-well plate with a white bottom, 60μL of firefly luciferase was added, and the mixture was quickly shaken and mixed. The fluorescence value was measured by an ELISA reader to obtain the relative activation efficiency of the drug on HacaT AhR-Luc cells.
[0042] Depend on Figure 3 It can be seen that after the cells were treated with benvimod (positive drug) for 24 hours, the cell activity increased significantly and was concentration-dependent, indicating that the plasmid was successfully extracted and transfected to obtain a stably expressed Hacat AhR-Luc cell line.
[0043] 2. Screening of the activity of quinoline compounds in activating AhR
[0044] Hacat AhR-Luc cells were passaged to 96-well plates so that the cell confluence rate was 100% when the drug was added. The experiment was divided into a quinoline compound administration group (56 phenyl-substituted-2-methoxyquinolines), a benvimod administration group and a control group. The drug concentrations of the drug administration groups were 20μM, 5μM and 0μM, and the administration time was 8h and 24h, respectively; the control group was treated with the same concentration of DMSO for 8h and 24h, respectively. After cell treatment, the culture medium was aspirated, 1×PBS was added, and the cells were placed for 10min to wash the cells. PBS was aspirated, cell lysis buffer was added, and the treatment was carried out at 4℃ for 1h. 60μL was aspirated to a 96-well plate with a white bottom, 60μL of firefly luciferase was added, and the mixture was quickly shaken and mixed. The fluorescence value was measured by a microplate reader to obtain the relative activation efficiency of the drug on Hacat AhR-Luc cells.
[0045] like Figure 4 , 5 As shown in the figure, 56 phenyl-substituted-2-methoxyquinolines were divided into three categories according to the different positions of the substituents, namely 3-substituted aryl-7-methoxyquinolines, 2-substituted aryl-6-methoxyquinolines and 6-substituted aryl-2-methoxyquinolines. According to the luciferase reporter gene results, 1-4 indicates that the activation activity is from weak to strong, and the structures of compounds with the effect of activating AhR receptors are concentrated in 6-substituted aryl-2-methoxyquinolines. Further screening of 6-substituted aryl-2-methoxyquinolines found that the compound with the strongest effect of activating AhR was 6-(3-hydroxyphenyl)-2-methoxyquinoline (3c).
[0046] 3. Analysis of the activity of 6-(3-hydroxyphenyl)-2-methoxyquinoline in activating AhR
[0047] HacaT AhR-Luc cells were passaged to 96-well plates so that the cell confluence rate was 100% when the drug was added. The experiment was divided into 6-(3-hydroxyphenyl)-2-methoxyquinoline administration group, benvimod administration group and control group. The drug concentrations of the drug administration groups were 20μM, 10μM, 5μM, 2.5μM, 1.25μM and 0μM, and the drug administration time was 8, 24h, 48h and 72h, respectively. The control group was treated with the same concentration of DMSO for 8, 24h, 48h and 72h. After cell treatment, the culture medium was aspirated, 1×PBS was added, and the cells were placed for 10min to wash the cells. PBS was aspirated, cell lysis solution was added, and the treatment was carried out for 1h at 4℃. 60μL was aspirated to a 96-well plate with a white bottom, 60μL firefly luciferase was added, and the mixture was quickly shaken and mixed. The fluorescence value was measured by a microplate reader to obtain the relative activation efficiency of the drug on HacaT AhR-Luc cells.
[0048] Depend on Figure 6 It can be seen that 6-(3-hydroxyphenyl)-2-methoxyquinoline can significantly increase the relative activity of AhR after treating cells at different times, and the activation efficiency increases significantly with the extension of time. This shows that 6-(3-hydroxyphenyl)-2-methoxyquinoline can effectively activate AhR signaling, and its activation effect is time- and concentration-dependent.
[0049] Example 3
[0050] Effects of 6-(3-hydroxyphenyl)-2-methoxyquinoline on the expression of AhR target genes in cells
[0051] 1. Effects on AhR transcription
[0052] (1) HacaT cells were passaged into 6-well plates so that the cell confluence rate at the time of administration was 80%. The experiment was divided into a 6-(3-hydroxyphenyl)-2-methoxyquinoline administration group and a benvimod administration group, with the administration concentrations of 20μM, 10μM, 5μM, and 0μM, respectively, and the administration time was 24h. After 24h, 1mL of Trizol reagent was added to each well, and the mixture was quickly pipetted and mixed and transferred to 1.5mL centrifuge tubes of RNase, and 200μL of chloroform was added, vortexed for 15s, and allowed to stand at room temperature for 2-3min. Place in a centrifuge, centrifuge at 12000×g, 4℃ for 15min. Transfer the upper aqueous phase to another clean 1.5mL centrifuge tube of RNase, add 500μL of isopropanol, vortexed for 15s, and allowed to stand at room temperature for 10min. Place in a centrifuge, centrifuge at 12000×g, 4℃ for 10min. The supernatant was discarded, 1 mL of 75% ethanol prepared with DEPC water was added, vortexed for 15 seconds, and centrifuged at 8000×g at 4°C for 10 minutes. The supernatant was discarded, the centrifuge tube was opened and left for 5-10 minutes, the ethanol was evaporated, 30 mL of DEPC water was added and mixed, and heated at 60°C for 10-15 minutes to obtain RNA of each group, and the concentration was measured with a micro-spectrophotometer.
[0053] (2) According to PrimeScript TM RT reagent Kit with gDNA Eraser instructions, remove genomic DNA and reverse transcribe. Premix Ex Taq TM Ⅱ Instructions, perform real-time fluorescence quantitative PCR, obtain amplification data and calculate. Pre-sequence primer: CAAATCCTTCCAAGCGGCATA, post-sequence primer: CGCTGAGCCTAAGACTGAAAG
[0054] Depend on Figure 7 It can be seen that the expression of AhR and CYP1A1 transcription levels in intact cells before and after treatment was detected by real-time quantitative polymerase chain reaction (qRT-PCR). The CYP1A1 gene is a typical downstream gene of AhR. After activating AhR, the expression of this gene will be upregulated, thereby promoting the expression of CYP1A1. With the increase of concentration, the expression of AhR is basically the same, and the expression of CYP1A1 is significantly increased, indicating that 6-(3-hydroxyphenyl)-2-methoxyquinoline can effectively activate AhR signals without affecting the transcription of AhR in cells.
[0055] 2. Effects on AhR expression
[0056] Hacat cells were passaged to 5 10cm culture dishes so that the cell confluence rate reached 80% when the drug was added. The experiment was divided into 6-(3-hydroxyphenyl)-2-methoxyquinoline administration group, Benvimod administration group and blank control group. The administration concentrations of 6-(3-hydroxyphenyl)-2-methoxyquinoline administration group were 20μM, 10μM, 5μM, and 0μM, respectively, and the administration time was 24h. The administration concentration of Benvimod administration group was 20μM, and the administration time was 24h. After 24h, the culture medium was aspirated, PBS was added to wash once, PBS was aspirated, 500μL PBS was added, and the cells were scraped off with a cell scraper and aspirated into a 1.5mL centrifuge tube. Centrifuge, aspirate PBS, add 1× loading buffer, blow and mix immediately, use an ultrasonic disruptor to lyse the cells until there is no viscosity, put into a metal bath, 95℃, and heat for 5min. After cooling, store at -20℃. Western blotting was used to determine the expression levels of AhR and CYP1A1 proteins, with GAPDH as the internal reference protein.
[0057] Depend on Figure 8 It can be seen that with the increase of concentration, the expression level of AhR protein is basically the same, and the expression level of CYP1A1 protein is significantly increased. The protein level shows that 6-(3-hydroxyphenyl)-2-methoxyquinoline can effectively activate AhR signaling, thereby promoting the expression of downstream CYP1A1, and will not affect the expression of AhR in cells.
[0058] Example 4
[0059] Pharmacodynamic evaluation of 6-(3-hydroxyphenyl)-2-methoxyquinoline against psoriasis in mice
[0060] The experiment used 8-week-old Balb / c mice and divided them into 6 groups: healthy group, model group, positive drug group (1% benvimod), low-dose group (0.25% 6-(3-hydroxyphenyl)-2-methoxyquinoline), medium-dose group (0.5% 6-(3-hydroxyphenyl)-2-methoxyquinoline) and high-dose group (1% 6-(3-hydroxyphenyl)-2-methoxyquinoline).
[0061] Balb / c mice were adapted to the experimental environment for one week to reduce the impact of stress on the experimental results. The hair on the back of the mice was removed before the experiment so that the drug could act directly on the skin, and the model was established using 1% imiquimod. Every day, except for the healthy group, the other groups were given 62.5 mg of 1% imiquimod, and the healthy group was given the same amount of matrix without drugs; after 8 hours, the healthy group and the model group were smeared with 62.5 mg of matrix, and the low-dose group, medium-dose group and high-dose group were smeared with 62.5 mg of the corresponding drugs respectively; after 7 days of continuous modeling and administration, the mice were killed, and the skin tissues were taken for HE staining and immunohistochemistry of cell proliferation marker Ki67.
[0062] Depend on Fig. 9 It can be seen that compared with the healthy group, white scales appeared on the back of mice in the model group, and skin lesions and erythema were obvious; compared with the model group, the skin lesions on the back of mice in the drug-treated group were significantly improved; compared with the positive drug group, the scales and lesions in the low-dose group were improved, but the effect was weaker than that of the positive drug group, the efficacy of the medium-dose group was close to that of the positive drug group, and the effect of the high-dose group was significantly better than that of the positive drug group, indicating that 6-(3-hydroxyphenyl)-2-methoxyquinoline can improve psoriasis lesions in mice in a concentration-dependent manner, and the improvement effect on psoriasis lesions in mice increases with the increase in concentration.
[0063] Depend on Fig.10 , 11 It can be seen that compared with the healthy group, the epidermis of the mice in the model group was thickened and the epidermal protrusions were elongated; compared with the model group, the epidermal thickness of the drug-treated groups was reduced; compared with the positive group, the effect of the low-dose group was weaker, the efficacy of the medium-dose group was similar, the epidermal thickness of the high-dose group was significantly reduced, the number of epidermal protrusions was significantly reduced, and the effect was better than the positive drug group, indicating that 6-(3-hydroxyphenyl)-2-methoxyquinoline can effectively improve the epidermal thickening caused by psoriasis, and it is concentration-dependent.
[0064] Depend on Fig.12 , 13 It can be seen that compared with the healthy group, the cell proliferation marker Ki67 in the model group was significantly increased; compared with the model group, the Ki67 in the high-dose group was significantly decreased, and the effect was better than that in the positive drug group, indicating that high doses of 6-(3-hydroxyphenyl)-2-methoxyquinoline can inhibit the proliferation of keratinocytes and thus alleviate the symptoms of psoriasis.
[0065] The above description is only for better explaining the embodiments of the present invention, and is not intended to limit the present invention. Any modification or equivalent substitution that does not depart from the spirit and scope of the present invention shall fall within the scope of the present invention.
Claims
1. An aryl hydrocarbon receptor activator, characterized in that It is 6-(3-hydroxyphenyl)-2-methoxyquinoline, and its structural formula is:
2. The method for preparing the aromatic hydrocarbon receptor activator according to claim 1, characterized in that: The following steps are involved: With 6-bromo-2-methoxyquinoline, 3-hydroxybenzene-boric acid, potassium carbonate, tetrakistriphenylphosphine palladium and toluene as raw materials, a condensation reflux reaction is carried out under N2 protection. After the reaction is completed, ethyl acetate and water are added for stirring. After standing and stratification, the ethyl acetate layer is taken to make a sand, and 6-(3-hydroxyphenyl)-2-methoxyquinoline is obtained by elution.
3. The method for preparing the aromatic hydrocarbon receptor activator according to claim 2, characterized in that: The amount of 6-bromo-2-methoxyquinoline used is 500 mg, the amount of 3-hydroxybenzene-boric acid used is 234 mg, the amount of potassium carbonate used is 551 mg, the amount of tetrakistriphenylphosphine palladium used is 200 mg, and the amount of toluene used is 10 mL.
4. The method for preparing the aromatic hydrocarbon receptor activator according to claim 2, characterized in that: The temperature of the condensation reflux reaction is 110° C. and the time is 4 hours.
5. Use of the aryl hydrocarbon receptor activator according to claim 1 in the preparation of anti-psoriasis drugs.
6. An anti-psoriasis pharmaceutical composition, characterized in that: It contains the aryl hydrocarbon receptor activator according to claim 1.