Schizochytrium limacinum genetic engineering strain of overexpression lysophosphatidic acid acyltransferase gene, and construction method and application of schizochytrium limacinum genetic engineering strain

Abstract

The invention belongs to the technical field of genetic engineering, and discloses a schizochytrium limacinum genetic engineering strain for overexpressing lysophosphatidic acid acyltransferase gene, and a construction method and application thereof, the schizochytrium limacinum genetic engineering strain for overexpressing lysophosphatidic acid acyltransferase gene is constructed by a Schizochytrium sp. HX-308 strain, and the Schizochytrium limacinum sp. The genetic engineering strain can be used for overexpression of lysophosphatidic acid acyltransferase gene LPAT in a DHA storage path. According to the invention, a lysophosphatidic acid acyltransferase (LPAT) gene is over-expressed in a schizochytrium limacinum wild type to obtain the schizochytrium limacinum LPAT engineering bacterium, so that the accumulation of sn-2 DHA can be obviously improved, and a basis is provided for the industrial oriented synthesis of sn-2 DHA by the strain.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and in particular to a Schizochytrium genetic engineering strain overexpressing a lysophosphatidic acid acyltransferase (LPAT) gene, and a construction method and application thereof. Background Art

[0002] The effective absorption rate of DHA is closely related to the storage form of DHA. The high-purity DHA commonly sold on the market is mainly ethyl ester (EE) DHA obtained by processing fish oil, and the effective absorption rate of EE-DHA by the human body is only 21%. In addition, EE-DHA will decompose into ethanol during the use process, which may cause adverse reactions in children and some people with physical diseases. Natural algae oil DHA mainly exists in the form of triglycerides (TAG), and the comprehensive effective absorption rate of TAG-DHA by the human body is 57%, while the effective absorption rate of TAG sn-2 DHA is close to 100%.

[0003] Schizochytrium is a heterotrophic, lipid-rich marine organism with great potential for lipid compound production. About 50% of the lipids accumulated by Schizochytrium are DHA, so it is considered to be the most suitable microorganism for mass production of DHA lipids.

[0004] Methods for producing sn-2 DHA include biosynthesis, chemical method, chemoenzyme method and enzymatic method. Compared with other methods, biosynthesis is specifically regulated according to the metabolic characteristics of fatty acids, and does not have the problems of high production costs, many side reactions, and catalyst toxicity. However, the production of sn-2 DHA using biosynthesis lacks an efficient production chassis, so the key to achieving efficient production of sn-2 DHA is to construct an engineered strain of Schizochytrium that produces high sn-2 DHA. Summary of the invention

[0005] The object of the present invention is to overcome the deficiencies in the prior art and to provide a Schizochytrium genetic engineering strain overexpressing a lysophosphatidic acid acyltransferase (LPAT) gene and a construction method and application thereof.

[0006] The technical solution adopted by the present invention to solve its technical problem is:

[0007] A Schizochytrium genetically engineered strain overexpressing a lysophosphatidic acid acyltransferase gene, wherein the genetically engineered strain is constructed from Schizochytrium sp. HX-308 strain and can overexpress a lysophosphatidic acid acyltransferase gene LPAT in a DHA storage pathway.

[0008] Furthermore, the gene sequence of the lysophosphatidic acid acyltransferase gene LPAT is SEQ ID No.13, SEQ ID No.14, SEQ ID No.16, SEQ ID No.17 or SEQ ID No.18.

[0009] A method for constructing a genetically engineered strain of Schizochytrium as described above comprises the following steps:

[0010] (1) Construction of recombinant plasmid pZPK-G418-LPAT:

[0011] The lysophosphatidic acid acyltransferase gene LPAT from Schizochytrium sp. HX-308 was cloned and inserted into a plasmid by homologous recombination to construct an overexpression vector pZPK-G418-LPAT.

[0012] (2) Construction of genetically engineered strains of Schizochytrium:

[0013] The linearized overexpression vector pZPK-G418-LPAT was electro-transformed into Schizochytrium sp. HX-308 by electro-transformation to obtain the Schizochytrium genetic engineering strain.

[0014] Furthermore, the construction method of the overexpression vector pZPK-G418-LPAT comprises the following steps performed in sequence:

[0015] 1) Primers were designed based on the sequence of the lysophosphatidic acid acyltransferase gene LPAT of Schizochytrium sp. HX-308, and the lysophosphatidic acid acyltransferase gene LPAT fragment was obtained by PCR amplification technology;

[0016] 2) Use restriction endonuclease Hind Ⅲ to digest the vector plasmid pZPK at 37℃ for 4 hours, and then recover the digestion product from gel;

[0017] 3) Connecting the lysophosphatidic acid acyltransferase gene LPAT fragment with the enzyme-digested product and transforming them into Escherichia coli DH5α competent cells to obtain the overexpression vector pZPK-G418-LPAT.

[0018] Use of the Schizochytrium genetically engineered strain as described above in the production of sn-2 DHA.

[0019] The method for efficiently accumulating and producing sn-2 DHA using the Schizochytrium genetically engineered strain described above comprises the following steps:

[0020] The genetically engineered strain of Schizochytrium is inoculated into a seed culture medium to obtain first-generation seeds; the first-generation seeds are inoculated into a seed culture medium to obtain second-generation seeds; the second-generation seeds are inoculated into a seed culture medium to obtain third-generation seeds as fermentation strains; the fermentation strain is inoculated into a fermentation culture medium, and after the fermentation culture is completed, the bacteria are collected to extract lipids, and sn-2 DHA is further extracted to obtain sn-2 DHA.

[0021] Furthermore, the culture conditions are 25-30° C. and 150-250 r / min shaking culture.

[0022] Furthermore, the method for collecting bacteria to extract lipids comprises the following steps:

[0023] 1) After the fermentation culture is completed, NaOH solution is added to the fermentation broth to adjust the pH to 10-13, and then 0.01-0.5% of the fermentation broth mass of the cell wall breaking enzyme is added, and the mixture is shaken at 40-60°C and 100-200 r / min for 5-15 hours;

[0024] 2) Cool to room temperature and add anhydrous ethanol equal to the volume of the fermentation liquid to inactivate the cell wall-breaking enzyme;

[0025] 3) Add n-hexane for extraction and collect the upper organic phase;

[0026] 4) Repeat step 3) several times, combine the organic phases, evaporate the solvent, obtain DHA-containing lipids, and weigh them.

[0027] Furthermore, the method for extracting sn-2 DHA comprises the following steps:

[0028] (1) Removal of phospholipids

[0029] 1) Place the extracted lipids in a sealed bottle, heat it to 90°C in a water bath, and filter / suction it to remove insoluble matter;

[0030] 2) Weigh the sample, heat it to 80°C, add ultrapure water, the ratio of sample to ultrapure water is 1:1, stir thoroughly to hydrate;

[0031] 3) Centrifuge the centrifuge tube for centrifugation. The upper layer is glycerol, the middle layer is phospholipids, and the lower layer is aqueous phase. Collect the upper layer of glycerol.

[0032] (2) Preparation of 2-monoglyceride

[0033] 1) Add DHA oil, i.e., upper glyceride, and anhydrous ethanol into the reactor, and then add lipase with a mass concentration of 3% to start the alcoholysis reaction. The reaction temperature is 23°C and the stirring is continuous at 350 r / min for 4 hours.

[0034] 2) After centrifuging the reaction mixture at 12000 rpm for 1 min, the lipase was removed by filtering through an organic filter membrane;

[0035] 3) Dissolve the product in n-hexane, then add 75% ethanol-water solution, transfer the mixed solution to a separation funnel and let stand to separate the layers;

[0036] 4) After two layers are formed, the upper layer containing esters and unreacted triglyceride residues is removed, and the extraction layer containing 2-MAG is retained;

[0037] 5) Add a mixed solution to the extraction layer containing 2-MAG, the mixed solution is a mixed solution of ethanol and n-hexane in a volume ratio of 9:1, centrifuge at 3500 r / min for 1 min, and absorb the n-hexane phase containing 2-MAG on the upper layer to obtain sn-2 DHA;

[0038] Among them, the ratio of sample: DHA oil: anhydrous ethanol: lipase: n-hexane in step 3): 75% ethanol-water solution: mixed solution of ethanol and n-hexane is 2:1:4:0.03:15:6:10 g:g:g:mL:mL:mL.

[0039] Furthermore, the pH value of the seed culture medium is 6.0-6.6, and comprises: 50 g / L glucose, 5 g / L yeast extract, 5 g / L sodium sulfate, 2 g / L magnesium sulfate, 6 g / L ammonium sulfate, 1 g / L potassium chloride, 0.1 g / L calcium chloride, 0.6 g / L potassium sulfate, 1 g / L potassium dihydrogen phosphate, 10 g / L sodium glutamate, 0.1% trace minerals, 5 mg / L vitamin B6, and 10 g / L vitamin B6. 12 0.5 mg / L, the solvent is water; the above percentages are mass percentages; the formula of trace minerals is: MnCl28g / L, ZnSO48g / L, CoCl20.1g / L, N-methylmorpholine oxide NaMo 0.1g / L, CuSO46g / L, NiSO46g / L, FeSO420g / L, concentrated H2SO410mL / L, the solvent is water;

[0040] The fermentation medium has a pH value of 6.0 to 7.5 and comprises: 80 g / L glucose, 10 g / L yeast extract, 10 g / L sodium sulfate, 2 g / L magnesium sulfate, 6 g / L ammonium sulfate, 1 g / L potassium chloride, 0.1 g / L calcium chloride, 0.6 g / L potassium sulfate, 1 g / L potassium dihydrogen phosphate, 20 g / L sodium glutamate, 0.1% trace minerals, 5 mg / L vitamin B6, and 10 g / L vitamin B6. 120.5 mg / L, the solvent is water; the above percentages are mass percentages; among them, the formula of trace minerals is: MnCl28g / L, ZnSO48g / L, CoCl20.1g / L, N-methylmorpholine oxide NaMo 0.1g / L, CuSO46g / L, NiSO46g / L, FeSO420g / L, concentrated H2SO410mL / L, and the solvent is water.

[0041] The advantages and positive effects achieved by the present invention are:

[0042] 1. The Schizochytrium HX-308 chassis cells selected in the present invention have huge DHA production potential.

[0043] 2. The present invention adopts the idea of ​​synthetic biology, analyzes key target genes and their regulatory mechanisms, optimizes the sn-2 DHA storage pathway, improves the sn-2 DHA accumulation efficiency, and has good application prospects.

[0044] 3. The present invention conducted transcriptome analysis on Schizochytrium and found that the enhancement of the sn-2DHA accumulation function of Schizochytrium is due to the upregulation of the transcription level of the gene related to lysophosphatidic acid acyltransferase.

[0045] 4. The present invention obtains Schizochytrium LPAT engineered bacteria by overexpressing the lysophosphatidic acid acyltransferase (LPAT) gene in the wild type of Schizochytrium, which can significantly improve the accumulation of sn-2 DHA, thus providing a basis for the industrial directional synthesis of sn-2DHA by the strain.

[0046] 5. The present invention constructed 6 LPAT engineered strains, among which LPAT2 had the best effect, and the sn-2 DHA production was increased by more than 70% compared with the wild-type strain. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] Figure 1 This is a nucleic acid gel electrophoresis verification diagram of the gene LPAT1 / 2 / 3 / 4 / 5 / 6 in the present invention;

[0048] Figure 2 This is the pZPK-G418-LPAT1 plasmid map of the present invention;

[0049] Figure 3 This is the pZPK-G418-LPAT2 plasmid map of the present invention;

[0050] Figure 4 This is the pZPK-G418-LPAT3 plasmid map of the present invention;

[0051] Figure 5 This is the plasmid map of pZPK-G418-LPAT4 in the present invention;

[0052] Figure 6 This is the pZPK-G418-LPAT5 plasmid map of the present invention;

[0053] Figure 7 This is the pZPK-G418-LPAT6 plasmid map of the present invention;

[0054] Figure 8 The thin layer chromatogram of oil and glyceride in Example 5 of the present invention;

[0055] Fig. 9 This is a comparison chart of the sn-2 DHA content of the engineered strains LPAT1 / 2 / 3 / 4 / 5 / 6 of the present invention and the yield of the wild type. DETAILED DESCRIPTION

[0056] The present invention will be further described below in conjunction with the embodiments. The following embodiments are descriptive rather than restrictive, and the protection scope of the present invention cannot be limited by the following embodiments.

[0057] The various experimental operations involved in the specific embodiments are all routine techniques in the art. For parts not specially annotated in this document, ordinary technicians in the art can implement them by referring to various commonly used reference books, scientific and technological literature or related instructions, manuals, etc. before the filing date of this invention.

[0058] A Schizochytrium genetically engineered strain overexpressing a lysophosphatidic acid acyltransferase gene, wherein the genetically engineered strain is constructed from Schizochytrium sp. HX-308 strain and can overexpress a lysophosphatidic acid acyltransferase gene LPAT in a DHA storage pathway.

[0059] Preferably, the gene sequence of the lysophosphatidic acid acyltransferase gene LPAT is SEQ ID No.13, SEQ ID No.14, SEQ ID No.16, SEQ ID No.17 or SEQ ID No.18.

[0060] A method for constructing a genetically engineered strain of Schizochytrium as described above comprises the following steps:

[0061] (1) Construction of recombinant plasmid pZPK-G418-LPAT:

[0062] The lysophosphatidic acid acyltransferase gene LPAT from Schizochytrium sp. HX-308 was cloned and inserted into a plasmid by homologous recombination to construct an overexpression vector pZPK-G418-LPAT.

[0063] (2) Construction of genetically engineered strains of Schizochytrium:

[0064] The linearized overexpression vector pZPK-G418-LPAT was electro-transformed into Schizochytrium sp. HX-308 by electro-transformation to obtain the Schizochytrium genetic engineering strain.

[0065] Preferably, the method for constructing the overexpression vector pZPK-G418-LPAT comprises the following steps performed in sequence:

[0066] 1) Primers were designed based on the sequence of the lysophosphatidic acid acyltransferase gene LPAT of Schizochytrium sp. HX-308, and the lysophosphatidic acid acyltransferase gene LPAT fragment was obtained by PCR amplification technology;

[0067] 2) Use restriction endonuclease Hind Ⅲ to digest the vector plasmid pZPK at 37℃ for 4 hours, and then recover the digestion product from gel;

[0068] 3) Connecting the lysophosphatidic acid acyltransferase gene LPAT fragment with the enzyme-digested product and transforming them into Escherichia coli DH5α competent cells to obtain the overexpression vector pZPK-G418-LPAT.

[0069] Preferably, (2) the method for constructing a genetically engineered strain of Schizochytrium is:

[0070] 1. Preparation of Schizochytrium competent cells

[0071] (1) Pick a single colony of Schizochytrium sp. HX-308 that has been activated on the plate and add it to 50 mL of seed culture medium. Incubate it in a shaking incubator at 28°C and 170 rpm for 24 h.

[0072] (2) Transfer 5% of the inoculum to 50 mL of seed culture medium and culture at 28°C, 170 rpm, and shake for 24 h.

[0073] (3) Repeat step (2).

[0074] (4) Take 25 mL of bacterial culture and centrifuge at 4000 rpm for 2 min at room temperature. Discard the supernatant.

[0075] (5) Resuspend the cells in 25 mL of pretreatment reagent (20 mM DTT and 0.1 M CaCl2 in Tris-HCl buffer, pH 6.5) and vortex gently to loosen the cell walls.

[0076] (6) After centrifugation, wash the cells twice with 25 mL of pre-cooled sterile water at 4000 rpm and 4°C for 2 min.

[0077] (7) Wash the cells twice by centrifugation with 1 M sterile precooled sorbitol solution (containing 0.1 M CaCl2) at 4000 rpm and 4°C for 2 min.

[0078] (8) Resuspend the cells in 200 μL of 1 M sterile precooled sorbitol solution (containing 0.1 M CaCl2) and dispense into 1.5 mL sterile centrifuge tubes, 100 μL per tube, and keep on ice until ready to use.

[0079] 2. Electrotransformation of Schizochytrium

[0080] (1) Add 10 μL of the linearized recombinant overexpression vector to 100 μL of Schizochytrium competent cells, mix well, transfer to a pre-cooled electroporation cup, and place on ice for 30 min.

[0081] (2) Electric shock, 2KV, one pulse.

[0082] (3) Immediately add 1 mL of pre-cooled seed medium containing 1 M sorbitol to the electroporation cup, mix well, and transfer to the seed medium containing 1 M sorbitol.

[0083] (4) Incubate at 28°C, 180 rpm for 2–3 h.

[0084] (5) Take an appropriate amount of bacterial solution and spread it on plates. Incubate at 28°C for 2 to 4 days.

[0085] 3. Screening and identification of genetically engineered Schizochytrium strains expressing recombinant vectors pZPK-G418-LPAT1, pZPK-G418-LPAT2, pZPK-G418-LPAT3, pZPK-G418-LPAT4, pZPK-G418-LPAT5, and pZPK-G418-LPAT6 genes

[0086] (1) Pick a colony from the plate and inoculate it into a seed medium containing 50 mg / L G418 and culture it at 28°C and 180 rpm for 24 h.

[0087] (2) The overexpression vector was subcultured five times to ensure stable inheritance. The experiment described in step (1) was repeated in each generation.

[0088] (3) The stable genetic strains overexpressed the LPAT1 / 2 / 3 / 4 / 5 / 6 engineered strain phenotype and were stored in a -80°C freezer.

[0089] Use of the Schizochytrium genetically engineered strain as described above in the production of sn-2 DHA.

[0090] The method for efficiently accumulating and producing sn-2 DHA using the Schizochytrium genetically engineered strain described above comprises the following steps:

[0091] The genetically engineered strain of Schizochytrium is inoculated into a seed culture medium to obtain first-generation seeds; the first-generation seeds are inoculated into a seed culture medium to obtain second-generation seeds; the second-generation seeds are inoculated into a seed culture medium to obtain third-generation seeds as fermentation strains; the fermentation strain is inoculated into a fermentation culture medium, and after the fermentation culture is completed, the bacteria are collected to extract lipids, and sn-2 DHA is further extracted to obtain sn-2 DHA.

[0092] Preferably, the culture conditions are 25-30° C. and shaking at 150-250 r / min.

[0093] Preferably, the method for collecting bacteria to extract lipids comprises the following steps:

[0094] 1) After the fermentation culture is completed, NaOH solution is added to the fermentation broth to adjust the pH to 10-13, and then 0.01-0.5% of the fermentation broth mass of the cell wall breaking enzyme is added, and the mixture is shaken at 40-60°C and 100-200 r / min for 5-15 hours;

[0095] 2) Cool to room temperature and add anhydrous ethanol equal to the volume of the fermentation liquid to inactivate the cell wall-breaking enzyme;

[0096] 3) Add n-hexane for extraction and collect the upper organic phase;

[0097] 4) Repeat step 3) several times, combine the organic phases, evaporate the solvent, obtain lipids containing DHA, and weigh them.

[0098] Preferably, the method for extracting sn-2 DHA comprises the following steps:

[0099] (1) Removal of phospholipids

[0100] 1) Place the extracted lipids in a sealed bottle, heat it to 90°C in a water bath, and filter / suction it to remove insoluble matter;

[0101] 2) Weigh the sample, heat it to 80°C, add ultrapure water, the ratio of sample to ultrapure water is 1:1, stir thoroughly to hydrate;

[0102] 3) Centrifuge the centrifuge tube for centrifugation. The upper layer is glycerol, the middle layer is phospholipids, and the lower layer is aqueous phase. Collect the upper layer of glycerol.

[0103] (2) Preparation of 2-monoglyceride

[0104] 1) Add DHA oil, i.e., upper glyceride, and anhydrous ethanol into the reactor, and then add lipase with a mass concentration of 3% to start the alcoholysis reaction. The reaction temperature is 23°C and the stirring is continuous at 350 r / min for 4 hours.

[0105] 2) After centrifuging the reaction mixture at 12000 rpm for 1 min, the lipase was removed by filtering through an organic filter membrane;

[0106] 3) Dissolve the product in n-hexane, then add 75% ethanol-water solution, transfer the mixed solution to a separation funnel and let stand to separate the layers;

[0107] 4) After two layers are formed, the upper layer containing esters and unreacted triglyceride residues is removed, and the extraction layer containing 2-MAG is retained;

[0108] 5) Add a mixed solution to the extraction layer containing 2-MAG, the mixed solution is a mixed solution of ethanol and n-hexane in a volume ratio of 9:1, centrifuge at 3500 r / min for 1 min, and absorb the n-hexane phase containing 2-MAG on the upper layer to obtain sn-2 DHA;

[0109] Among them, the ratio of sample: DHA oil: anhydrous ethanol: lipase: n-hexane in step 3): 75% ethanol-water solution: mixed solution of ethanol and n-hexane is 2:1:4:0.03:15:6:10 g:g:g:mL:mL:mL.

[0110] Preferably, the pH value of the seed culture medium is 6.0-6.6, and comprises: 50 g / L glucose, 5 g / L yeast extract, 5 g / L sodium sulfate, 2 g / L magnesium sulfate, 6 g / L ammonium sulfate, 1 g / L potassium chloride, 0.1 g / L calcium chloride, 0.6 g / L potassium sulfate, 1 g / L potassium dihydrogen phosphate, 10 g / L sodium glutamate, 0.1% trace minerals, 5 mg / L vitamin B6, 5 mg / L vitamin B 12 0.5 mg / L, the solvent is water; the above percentages are mass percentages; the formula of trace minerals is: MnCl28g / L, ZnSO48g / L, CoCl20.1g / L, N-methylmorpholine oxide NaMo 0.1g / L, CuSO46g / L, NiSO46g / L, FeSO420g / L, concentrated H2SO410mL / L, the solvent is water;

[0111] The fermentation medium has a pH value of 6.0 to 7.5 and comprises: 80 g / L glucose, 10 g / L yeast extract, 10 g / L sodium sulfate, 2 g / L magnesium sulfate, 6 g / L ammonium sulfate, 1 g / L potassium chloride, 0.1 g / L calcium chloride, 0.6 g / L potassium sulfate, 1 g / L potassium dihydrogen phosphate, 20 g / L sodium glutamate, 0.1% trace minerals, 5 mg / L vitamin B6, and 10 g / L vitamin B6. 120.5 mg / L, the solvent is water; the above percentages are mass percentages; among them, the formula of trace minerals is: MnCl28g / L, ZnSO48g / L, CoCl20.1g / L, N-methylmorpholine oxide NaMo 0.1g / L, CuSO46g / L, NiSO46g / L, FeSO420g / L, concentrated H2SO410mL / L, and the solvent is water.

[0112] Specifically, the relevant preparation and detection are as follows:

[0113] In the present invention, unless otherwise specified in the art, % refers to mass percentage, and ratio refers to mass ratio. The unit of mass is, for example, gram, kilogram or ton.

[0114] In the present invention, the "room temperature" refers to the normal ambient temperature, which can be 10-30°C.

[0115] The culture medium used in the following examples is as follows:

[0116] The pH of the plate medium is 6.5, and includes agar 15g / L, glucose 50g / L, yeast extract 5g / L, sodium sulfate 5g / L, magnesium sulfate 2g / L, ammonium sulfate 6g / L, potassium chloride 1g / L, calcium chloride 0.1g / L, potassium sulfate 0.6g / L, potassium dihydrogen phosphate 1g / L, sodium glutamate 10g / L, 0.1% trace minerals (the formula of trace minerals is: MnCl28g / L, ZnSO48g / L, CoCl20.1g / L, N-methylmorpholine oxide NaMo 0.1g / L, CuSO46g / L, NiSO46g / L, FeSO420g / L, concentrated H2SO410mL / L, the solvent is water.), vitamin B6 5mg / L, vitamin B 12 0.5 mg / L, the solvent is water; the above percentages are mass percentages;

[0117] The pH of the seed culture medium of the seed solution is 6.6, and includes: glucose 50g / L, yeast extract 5g / L, sodium sulfate 5g / L, magnesium sulfate 2g / L, ammonium sulfate 6g / L, potassium chloride 1g / L, calcium chloride 0.1g / L, potassium sulfate 0.6g / L, potassium dihydrogen phosphate 1g / L, sodium glutamate 10g / L, 0.1% trace minerals (the formula of trace minerals is: MnCl28g / L, ZnSO48g / L, CoCl20.1g / L, N-methylmorpholine oxide NaMo 0.1g / L, CuSO46g / L, NiSO46g / L, FeSO420g / L, concentrated H2SO410mL / L, the solvent is water.), vitamin B6 5mg / L, vitamin B 120.5 mg / L, the solvent is water; the above percentages are mass percentages.

[0118] The pH value of the fermentation medium is 6.0-7.5, and the fermentation medium includes: 80 g / L glucose, 10 g / L yeast extract, 10 g / L sodium sulfate, 2 g / L magnesium sulfate, 6 g / L ammonium sulfate, 1 g / L potassium chloride, 0.1 g / L calcium chloride, 0.6 g / L potassium sulfate, 1 g / L potassium dihydrogen phosphate, 20 g / L sodium glutamate, 0.1% trace minerals (the formula of trace minerals is: MnCl28 g / L, ZnSO48 g / L, CoCl20.1 g / L, N-methylmorpholine oxide NaMo 0.1 g / L, CuSO46 g / L, NiSO46 g / L, FeSO420 g / L, concentrated H2SO410 mL / L, and the solvent is water.), vitamin B6 5 mg / L, vitamin B 12 0.5 mg / L, the solvent is water; the above percentages are mass percentages.

[0119] Example 1. Cloning of Schizochytrium lysophosphatidic acid acyltransferase (LPAT)

[0120] According to the sequence information of six lysophosphatidic acid acyltransferase (LPAT) genes of Schizochytrium, primers P1 / P2, P3 / P4, P5 / P6, P7 / P8, P9 / P10 and P11 / P12 as shown in SEQ ID No.1 / SEQ ID No.2, SEQ ID No.3 / SEQ ID No.4, SEQ ID No.5 / SEQ ID No.6, SEQ ID No.7 / SEQ ID No.8, SEQ ID No.9 / SEQ ID No.10 and SEQ ID No.11 / SEQ ID No.12 were designed respectively. The genome of Schizochytrium HX-308 was used as a template and the six lysophosphatidic acid acyltransferase (LPAT) gene fragments were amplified by PCR using the primers and PrimerStar high-fidelity polymerase to obtain LPAT1, LPAT2, LPAT3, LPAT4, LPAT5 and LPAT6 gene fragments, whose gene sequences are SEQ ID No.13, SEQ ID No.14, SEQ ID No.15 and SEQ ID No.16, respectively. No.15, SEQ ID No.16, SEQ ID No.17 or SEQ ID No.18. The PCR system includes: 10µl PrimerStar enzyme, 1µl template, 2µl upstream primer, 2µl downstream primer, 5µl ddH2O, PCR program: 94℃30s, 55℃30s, 70℃30s, 32 cycles, and the PCR product is purified, and the purified product is verified by agarose gel electrophoresis. The result is as follows Figure 1 as shown

[0121] SEQ ID No.1 P1(sense): AGCCGAGCGCGGGAGGGAAGATGTGGGCGCCACAGAC

[0122] SEQ ID No.2 P2(antisense): TGACATAACTAATTACATGACTAGTCCCATGATGCAGCCTTG

[0123] SEQ ID No.3 P3(sense): AGCCGAGCGCGGGAGGGAAGATGCTGTCGCGCGAAAAG

[0124] SEQ ID No.4 P4(antisense): TGACATAACTAATTACATGACTACTTTGTTTTCTTCTTCGACTCGGG

[0125] SEQ ID No.5 P5(sense): AGCCGAGCGCGGGAGGGAAGATGGGCGCGGGATACTC

[0126] SEQ ID No.6 P6(antisense): TGACATAACTAATTACATGATTAGCGCATAAGGTTTTGCCG

[0127] SEQ ID No.7 P7(sense): AGCCGAGCGCGGGAGGGAAGATGGCGACCGAGCAG

[0128] SEQ ID No.8 P8(antisense): TGACATAACTAATTACATGATTATGAAGATGAGGAAGTTGGATTGGA

[0129] SEQ ID No.9 P9(sense): AGCCGAGCGCGGGAGGGAAGATGAGCAATCGCCACCTCAT

[0130] SEQ ID No.10 P10(antisense): TGACATAACTAATTACATGATTACTTGTCTTTCTTCAAAGACTGCTGC

[0131] SEQ ID No.11 P11(sense):AGCCGAGCGCGGGAGGGAAGATGGCCACCGTGTCCG

[0132] SEQ ID No.12 P12(antisense):TGACATAACTAATTACATGATTAGACAATGTGCCGGACA

[0133] Example 2. Construction of overexpression vector pZPK-G418-LPAT

[0134] 1. Enzyme digestion reaction

[0135] The vector plasmid pZPK was digested with restriction endonuclease Hind Ⅲ at 37°C for 4 hours, and the digestion product was recovered from the gel to obtain the skeleton.

[0136] 50μL enzyme digestion system includes: 1μL Hind Ⅲ, 5μL 10X Loading Buffer, 10μL plasmid, 34μL ddH2O.

[0137] 2. Ligation reaction

[0138] The enzyme-cut vector and the Schizochytrium LPAT1, LPAT2, LPAT3, LPAT4, LPAT5, and LPAT6 fragments were connected using Gibson assembly to obtain recombinant overexpression vectors pZPK-G418-LPAT1, pZPK-G418-LPAT2, pZPK-G418-LPAT3, pZPK-G418-LPAT4, pZPK-G418-LPAT5, and pZPK-G418-LPAT6.

[0139] The 25 μL ligation system includes: 2 μL target gene fragment, 1 μL vector enzyme digestion fragment, 2.5 μL ligase buffer, 19.5 μL ddH2O, 50℃ ligation for 2h.

[0140] 3. Transform the ligation product into E. coli DH5α competent cells

[0141] (1) Aseptically take 100 μL of competent cells, add the ligation product, mix well, and place on ice for 30 min.

[0142] (2) Heat shock at 42°C for 90 seconds and immediately place on ice for 2 minutes.

[0143] (3) Add 900 μL LB medium and incubate at 37°C, 180 rpm for 1 h.

[0144] (4) Take 200 μL and spread it on an LB plate containing 50 μg / mL kan resistance. Invert and culture at 37°C overnight.

[0145] Positive transformants were selected, plasmids were extracted, and sequencing verification results showed that the connection was successful. Overexpression vectors pZPK-G418-LPAT1, pZPK-G418-LPAT2, pZPK-G418-LPAT3, pZPK-G418-LPAT4, pZPK-G418-LPAT5, and pZPK-G418-LPAT6 were obtained. The vector schematic diagram is shown in Figures 2 to 7 shown.

[0146] Example 3. Construction of a genetically engineered Schizochytrium strain overexpressing lysophosphatidic acid acyltransferase LPAT

[0147] 2. Preparation of Schizochytrium competent cells

[0148] (1) Pick a single colony of Schizochytrium sp. HX-308 that has been activated on the plate and add it to 50 mL of seed culture medium. Incubate it in a shaking incubator at 28°C and 170 rpm for 24 h.

[0149] (2) Transfer 5% of the inoculum to 50 mL of seed culture medium and culture at 28°C, 170 rpm, and shake for 24 h.

[0150] (3) Repeat step (2).

[0151] (4) Take 25 mL of bacterial culture and centrifuge at 4000 rpm for 2 min at room temperature. Discard the supernatant.

[0152] (5) Resuspend the cells in 25 mL of pretreatment reagent (20 mM DTT and 0.1 M CaCl2 in Tris-HCl buffer, pH 6.5) and vortex gently to loosen the cell walls.

[0153] (6) After centrifugation, wash the cells twice with 25 mL of pre-cooled sterile water at 4000 rpm and 4°C for 2 min.

[0154] (7) Wash the cells twice by centrifugation with 1 M sterile precooled sorbitol solution (containing 0.1 M CaCl2) at 4000 rpm and 4°C for 2 min.

[0155] (8) Resuspend the cells in 200 μL of 1 M sterile precooled sorbitol solution (containing 0.1 M CaCl2) and dispense into 1.5 mL sterile centrifuge tubes, 100 μL per tube, and keep on ice until ready to use.

[0156] 2. Electrotransformation of Schizochytrium

[0157] (1) Add 10 μL of the linearized recombinant overexpression vector to 100 μL of Schizochytrium competent cells, mix well, transfer to a pre-cooled electroporation cup, and place on ice for 30 min.

[0158] (2) Electric shock, 2KV, one pulse.

[0159] (3) Immediately add 1 mL of pre-cooled seed medium containing 1 M sorbitol to the electroporation cup, mix well, and transfer to the seed medium containing 1 M sorbitol.

[0160] (4) Incubate at 28°C, 180 rpm for 2–3 h.

[0161] (5) Take an appropriate amount of bacterial solution and spread it on plates. Incubate at 28°C for 2 to 4 days.

[0162] 3. Screening and identification of genetically engineered Schizochytrium strains expressing recombinant vectors pZPK-G418-LPAT1, pZPK-G418-LPAT2, pZPK-G418-LPAT3, pZPK-G418-LPAT4, pZPK-G418-LPAT5, and pZPK-G418-LPAT6 genes

[0163] (1) Pick a colony from the plate and inoculate it into a seed medium containing 50 mg / L G418 and culture it at 28°C and 180 rpm for 24 h.

[0164] (2) The overexpression vector was subcultured five times to ensure stable inheritance. The experiment described in step (1) was repeated in each generation.

[0165] (3) The stable genetic strains overexpressed the LPAT1 / 2 / 3 / 4 / 5 / 6 engineered strain phenotype and were stored in a -80°C freezer.

[0166] Example 4. Fermentation of Schizochytrium LPAT1 / 2 / 3 / 4 / 5 / 6 engineered strains and determination of fatty acid content

[0167] This example is an experiment for determining the fatty acid content in lipids of a Schizochytrium genetically engineered strain that overexpresses lysophosphatidic acid acyltransferase LPAT, including the following steps performed in sequence:

[0168] (1) Fermentation seed culture

[0169] The genetically engineered strain of Schizochytrium overexpressing lysophosphatidic acid acyltransferase LPAT and the wild-type strain of Schizochytrium sp. HX-308 were cultured on a plate containing 500 µg / mL G418 resistance, and a single colony was picked and inoculated in a 250 mL conical flask (containing 50 mL of seed culture medium), and cultured in a shaking incubator at 28° C. and 180 r / min for 24 hours to obtain first-level seeds, 1 mL of the first-level seed culture solution was inoculated in a 250 mL conical flask (containing 50 mL of seed culture medium), and cultured in a shaking incubator at 28° C. and 180 r / min for 24 hours to obtain second-level seeds, and 1 mL of the second-level seed culture solution was inoculated in a 250 mL conical flask (containing 50 mL of seed culture medium), and cultured in a shaking incubator at 28° C. and 180 r / min for 24 hours to obtain third-level seeds, which were used as fermentation strains;

[0170] (2) Shake flask fermentation

[0171] Take 10 mL of the third-level seed culture solution and inoculate it into a 500 mL conical flask (containing 90 mL of fermentation medium), and culture it in a shaking incubator at 28°C and 180 r / min for 120 h. Take samples every 24 h to measure the fatty acid ratio.

[0172] (3) Collecting bacteria and extracting lipids

[0173] After the fermentation culture is completed, NaOH solution is added to the fermentation broth to adjust the pH to 12, and then 0.2% of the mass of the fermentation broth is added with a cell wall-breaking enzyme. The mixture is shaken at 50°C and 180 r / min for 5 to 15 hours. The mixture is cooled to room temperature, and anhydrous ethanol with an equal volume to the fermentation broth is added to inactivate the cell wall-breaking enzyme. N-hexane is added for extraction, and the upper organic phase is collected for gas phase detection to analyze the fatty acid composition and proportion.

[0174] Example 5. Determination of 2-monoglyceride DHA in Schizochytrium LPAT1 / 2 / 3 / 4 / 5 / 6

[0175] This example is an experiment for determining the fatty acid content in 2-monoglyceride of a Schizochytrium genetically engineered strain that overexpresses lysophosphatidic acid acyltransferase LPAT, comprising the following steps performed in sequence:

[0176] 1. Remove phospholipids

[0177] (1) Place about 10 mL of the extracted lipid in a sealed bottle, heat it in a water bath to about 90°C, and then filter / suction it to remove insoluble matter.

[0178] (2) Weigh 2 g of the sample into a clean beaker, heat it to 80°C, add 2.0 mL of ultrapure water, and stir thoroughly to hydrate it.

[0179] (3) Centrifuge the tube for centrifugation. The upper layer is glycerol, the middle layer is phospholipids, and the lower layer is water. Try to collect the upper layer of glycerol. Glycerol can be verified by thin layer chromatography. The results are as follows Figure 8 As shown. Methyl esterification analysis of DHA content.

[0180] 2. Preparation of 2-monoglyceride

[0181] (1) Add 1 g of DHA oil (i.e., the upper glyceride obtained in the previous step) and 4 g of anhydrous ethanol to the reactor, and then add 0.03 g (3%, w / w) of lipase to initiate the alcoholysis reaction. The reaction temperature was 23 °C and the mixture was stirred continuously at 350 r / min for 4 h.

[0182] (2) The reaction mixture is centrifuged and filtered through an organic filter to remove lipase.

[0183] (3) Dissolve the product in 15 mL of n-hexane, then add 6 mL of 75% ethanol-water solution. Transfer the mixed solution to a separation funnel and let stand to separate the layers.

[0184] (4) After two layers are formed, the upper layer containing esters and unreacted triglyceride residues is removed, and the extraction layer containing 2-MAG is retained.

[0185] (5) Add 10 mL of a mixed solution of V(ethanol):V(n-hexane) = 90:10 (volume ratio) to the lower organic phase, centrifuge at 3500 r / min for 1 min, and draw the n-hexane phase containing 2-MAG from the upper layer for gas phase detection to analyze the fatty acid composition and ratio. Fig. 9 The sn-2 DHA content of the wild-type Schizochytrium was only 35.7%. Except for the LPAT3 strain, which had a decreased sn-2 DHA content, the sn-2 DHA content of the LPAT1 / 2 / 4 / 5 / 6 strains increased by 21%, 71%, 55%, 37%, and 25%, respectively.

[0186] The present invention obtains an engineered strain of Schizochytrium by overexpressing 6 lysophosphatidic acid acyltransferases LPAT, and the ability of LPAT2 strain to accumulate sn-2 DHA is significantly improved compared with the wild type. Except that the sn-2 DHA content of LPAT3 strain is decreased, the ability of LPAT1 / 4 / 5 / 6 strains to accumulate sn-2DHA is improved. The results of fed-batch fermentation of Schizochytrium wild-type strain and LPAT2 strain and the fatty acid composition of sn-2 monoglyceride are shown in Tables 1 and 2. The DHA content in the total lipid of Schizochytrium engineered bacteria LPAT2 is 49.6%, which is not significantly improved compared with the wild type (47.9%), but the sn-2 DHA content accounts for 60.9% of the total fatty acid content, which is more than 70% higher than the wild type (35.7%). It shows that overexpression of LPAT2 enables the DHA in Schizochytrium triglyceride to achieve efficient and specific accumulation to the sn-2 site.

[0187]

[0188] Although the embodiments of the present invention are disclosed for illustrative purposes, those skilled in the art will appreciate that various substitutions, changes and modifications are possible without departing from the spirit and scope of the present invention and the appended claims. Therefore, the scope of the present invention is not limited to the contents disclosed in the embodiments.

Claims

1. A genetically engineered strain of Schizochytrium overexpressing a lysophosphatidic acid acyltransferase gene, characterized in that: The genetically engineered strain is constructed from Schizochytrium sp. HX-308 strain, and the genetically engineered strain can overexpress the lysophosphatidic acid acyltransferase gene LPAT in the DHA storage pathway, and the gene sequence of the lysophosphatidic acid acyltransferase gene LPAT is SEQ ID No.13, SEQ ID No.14, SEQ ID No.16, SEQ ID No.17 or SEQ ID No.

18.

2. A method for constructing a genetically engineered strain of Schizochytrium according to claim 1, characterized in that: The steps include: (1) Construction of recombinant plasmid pZPK-G418-LPAT: The lysophosphatidic acid acyltransferase gene LPAT from Schizochytrium sp. HX-308 was cloned and inserted into a plasmid by homologous recombination to construct an overexpression vector pZPK-G418-LPAT. (2) Construction of genetically engineered strains of Schizochytrium: The linearized overexpression vector pZPK-G418-LPAT was electrotransformed into Schizochytrium sp. HX-308 by electrotransformation to obtain the Schizochytrium genetic engineering strain.

3. The construction method according to claim 2, characterized in that: The construction method of the overexpression vector pZPK-G418-LPAT comprises the following steps performed in sequence: 1) Primers were designed based on the sequence of the lysophosphatidic acid acyltransferase gene LPAT of Schizochytrium sp. HX-308, and the lysophosphatidic acid acyltransferase gene LPAT fragment was obtained by PCR amplification technology; 2) Use restriction endonuclease Hind Ⅲ to digest the vector plasmid pZPK at 37℃ for 4 hours, and then recover the digestion product from gel; 3) Connecting the lysophosphatidic acid acyltransferase gene LPAT fragment to the enzyme-digested product and transforming them into Escherichia coli DH5α competent cells to obtain the overexpression vector pZPK-G418-LPAT.

4. Use of the genetically engineered Schizochytrium strain according to claim 1 in the production of sn-2 DHA.

5. A method for efficiently accumulating and producing sn-2 DHA using the genetically engineered strain of Schizochytrium as claimed in claim 1, characterized in that: The steps include: The genetically engineered strain of Schizochytrium is inoculated into a seed culture medium to obtain first-generation seeds; the first-generation seeds are inoculated into a seed culture medium to obtain second-generation seeds; the second-generation seeds are inoculated into a seed culture medium to obtain third-generation seeds as fermentation strains; the fermentation strain is inoculated into a fermentation culture medium, and after the fermentation culture is completed, the bacteria are collected to extract lipids, and sn-2 DHA is further extracted to obtain sn-2 DHA.

6. The method according to claim 5, characterized in that: The culture conditions are 25-30° C. and 150-250 r / min shaking.

7. The method according to claim 5, characterized in that: The method for collecting cells to extract lipids comprises the following steps: 1) After the fermentation culture is completed, NaOH solution is added to the fermentation broth to adjust the pH to 10-13, and then 0.01-0.5% of the fermentation broth mass of the cell wall breaking enzyme is added, and the mixture is shaken at 40-60°C and 100-200 r / min for 5-15 hours; 2) Cool to room temperature and add anhydrous ethanol equal to the volume of the fermentation liquid to inactivate the cell wall-breaking enzyme; 3) Add n-hexane for extraction and collect the upper organic phase; 4) Repeat step 3) several times, combine the organic phases, evaporate the solvent, obtain DHA-containing lipids, and weigh them.

8. The method according to claim 5, characterized in that: The method for extracting sn-2 DHA comprises the following steps: (1) Removal of phospholipids 1) Place the extracted lipids in a sealed bottle, heat it to 90°C in a water bath, and filter / suction it to remove insoluble matter; 2) Weigh the sample, heat it to 80°C, add ultrapure water, the ratio of sample to ultrapure water is 1:1, stir thoroughly to hydrate; 3) Centrifuge the tube for centrifugation, the upper layer is glycerol, the middle layer is phospholipids, and the lower layer is water. Collect the upper layer of glycerol; (2) Preparation of 2-monoglyceride 1) Add DHA oil, i.e., upper glyceride, and anhydrous ethanol into the reactor, and then add lipase with a mass concentration of 3% to start the alcoholysis reaction. The reaction temperature is 23°C and the mixture is stirred continuously at 350 r / min for 4 hours. 2) After centrifuging the reaction mixture at 12000 rpm for 1 min, the lipase was removed by filtering through an organic filter membrane; 3) Dissolve the product in n-hexane, then add 75% ethanol-water solution, transfer the mixed solution to a separation funnel and let stand to separate the layers; 4) After two layers are formed, the upper layer containing esters and unreacted triglyceride residues is removed, and the extraction layer containing 2-MAG is retained; 5) Add a mixed solution to the extraction layer containing 2-MAG, the mixed solution is a mixed solution of ethanol and n-hexane in a volume ratio of 9:1, centrifuge at 3500 r / min for 1 min, and absorb the n-hexane phase containing 2-MAG on the upper layer to obtain sn-2 DHA; Among them, the ratio of sample: DHA oil: anhydrous ethanol: lipase: n-hexane in step 3): 75% ethanol-water solution: mixed solution of ethanol and n-hexane is 2:1:4:0.03:15:6:10 g:g:g:mL:mL:mL.

9. The method according to any one of claims 5 to 8, characterized in that: The pH value of the seed culture medium is 6.0-6.6, and the seed culture medium comprises: 50 g / L glucose, 5 g / L yeast extract, 5 g / L sodium sulfate, 2 g / L magnesium sulfate, 6 g / L ammonium sulfate, 1 g / L potassium chloride, 0.1 g / L calcium chloride, 0.6 g / L potassium sulfate, 1 g / L potassium dihydrogen phosphate, 10 g / L sodium glutamate, 0.1% trace minerals, 5 mg / L vitamin B6, and 10 g / L vitamin B6. 12 0.5 mg / L, the solvent is water; the above percentages are mass percentages; the formula of trace minerals is: MnCl28g / L, ZnSO48g / L, CoCl20.1g / L, N-methylmorpholine oxide NaMo0.1g / L, CuSO46g / L, NiSO46g / L, FeSO420g / L, concentrated H2SO410mL / L, the solvent is water; The fermentation medium has a pH value of 6.0 to 7.5 and comprises: 80 g / L glucose, 10 g / L yeast extract, 10 g / L sodium sulfate, 2 g / L magnesium sulfate, 6 g / L ammonium sulfate, 1 g / L potassium chloride, 0.1 g / L calcium chloride, 0.6 g / L potassium sulfate, 1 g / L potassium dihydrogen phosphate, 20 g / L sodium glutamate, 0.1% trace minerals, 5 mg / L vitamin B6, and 10 g / L vitamin B6. 12 0.5 mg / L, the solvent is water; the above percentages are mass percentages; among them, the formula of trace minerals is: MnCl28g / L, ZnSO48g / L, CoCl20.1g / L, N-methylmorpholine oxide NaMo 0.1g / L, CuSO46g / L, NiSO46g / L, FeSO420g / L, concentrated H2SO410mL / L, and the solvent is water.

Images