Chimeric Cas9 protein variant, gene, vector and application thereof in gene editing

Abstract

The invention belongs to the field of gene engineering, and relates to development and application of a gene editing technology, in particular to a chimeric Cas9 protein variant, a gene, a carrier and application of the chimeric Cas9 protein variant, the gene and the carrier in gene editing. The chimeric Cas9 protein variant is obtained by performing amino acid mutation modification on an Sc + + variant with a sequence as shown in SEQ ID NO.1. The engineered and integrated chimeric Cas9 protein variant disclosed by the invention effectively combines the cutting efficiency of SpCas9 and the PAM recognition capability of ScCas9, can realize efficient and broad-spectrum genome editing, and expands the application of ScCas9 in the field of plant biology.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering and relates to the development and application of gene editing technology, and specifically to chimeric Cas9 protein variants, genes, vectors and their application in gene editing. Background Art

[0002] In recent years, CRISPR / Cas9 genome editing technology has rapidly promoted the development of animal and plant breeding and gene therapy due to its simplicity, high efficiency and low cost. The CRISPR / Cas9 system can find potential target sites in the genome according to the protospacer adjacent motif (PAM) and induce DNA double-strand breaks (DSBs). At present, the most commonly used protein in this system is the SpCas9 protein from Streptococcuspyogenes, which recognizes 5′-NGG-3′PAM, which also greatly limits its targeting range. Other Cas9 proteins that recognize different PAMs, such as Staphylococcus aureus Cas9 (SaCas9), Campylobacterjejuni Cas9 (CjCas9), Streptococcus thermophilus Cas9 (StCas9) and Neisseriameningitides Cas9 (NmCas9), have relatively few applications due to their low editing efficiency in animals and plants due to less research. Based on the CRISPR / Cas9 system, base editors and guide editors have been continuously derived. Common base editors include cytosine base editor (CBE), adenine base editor (ABE) and glycosylase-based base editor (GBE), which can introduce gain-of-function mutations in specific sequences of target genes. However, the editing window of this technology is also limited by the PAM sequence. The guide editor can theoretically achieve 12 types of base substitutions and promote the precise insertion and deletion of small fragments of DNA, but the editing efficiency of this technology depends on the distance between the editing site and the PAM sequence. Therefore, the selectivity and flexibility of the PAM site are crucial to achieving precise gene editing.

[0003] In order to enhance the compatibility of PAM sites, researchers have long been committed to engineering the existing Cas9 protein. Based on SpCas9, the modified xCas9, Cas9-NG, SpG variants that recognize 5′-NG-3′ PAM sequences, and SpRY variants that recognize 5′-NNN-3′ (NRN>NYN) PAMs have significantly improved the targeting range of the gene editing system. However, although these four Cas9 variants have expanded the recognition sites of PAM, they have significantly reduced the editing efficiency of the system. In particular, the SpRY variant, on the basis of limited editing efficiency, has increased the self-editing rate and off-target effects of the system.

[0004] With the help of bioinformatics, mining new and efficient Cas9 proteins can also be used to expand PAM recognition sites. ScCas9 from Streptococcus canis can recognize the 5′-NNG-3′ PAM sequence and is the only Cas nuclease found in nature so far that can recognize a single-base PAM sequence. Through bioinformatics analysis and protein structure prediction, the upgraded Sc++ combines the T1227K positive charge mutation from S.gordonii Cas9 and the positively charged ring (aa 367-376) composed of ten amino acids from S.anginosus Cas9, and shows higher editing efficiency in animal cells compared to xCas9 and SpCas9-NG. At the same time, in plant cells, the Sc++ variant also shows higher editing efficiency than ScCas9. However, the study found that the Sc++ variant showed higher cutting ability at the 5′-NAG-3′ and 5′-NGG-3′ PAM sites, while the efficiency at the 5′-NCG-3′ and 5′-NTG-3′ PAM sites was limited. These results indicate that although the Sc++ variant performs better in DNA cleavage and recognition, its PAM compatibility and editing activity still need to be further improved. Summary of the invention

[0005] To solve the above technical problems, the present invention combines Sc++ and SpCas9 to design and construct a chimeric Cas9 protein variant, which enhances the protein PAM compatibility and improves the gene editing ability.

[0006] Therefore, one of the objects of the present invention is to provide a chimeric Cas9 protein variant, wherein the chimeric Cas9 protein variant is obtained by performing amino acid mutation modification on the Sc++ variant whose sequence is shown in SEQ ID NO.1, and the chimeric Cas9 protein variant is any one of the following methods:

[0007] (1) replacing the REC domain of the Sc++ variant with the REC domain of the SpCas9 protein to obtain a Spc+ variant, mutating the 221st amino acid R to K and the 394th amino acid N to K in the Spc+ variant, recorded as the SpcRN+ variant;

[0008] (2) A positively charged loop from S. anginosus Cas9 was introduced into the SpcRN+ variant, which was denoted as SpcRN++. The positively charged loop was located at positions 367-376 of the SpcRN++, and the amino acid sequence was KKLRKRSGKL.

[0009] Existing literature shows that the introduction of R221K and N394K into SpCas9 can effectively improve the nuclease activity of Cas9. Since ScCas9 has a sequence similarity of 89.2% with the commonly used SpCas9, in order to improve the nuclease activity of ScCas9, we first tried to introduce R221K and N394K double mutations into the Sc++ variant with an amino acid sequence as shown in SEQ ID NO.1, and constructed the ScRN++ variant (amino acid sequence as shown in SEQ ID NO.2). In order to study its nuclease cleavage activity and PAM specificity, we designed 10 rice endogenous genomic sites based on four different PAMs, 5′-NAG-3′, 5′-NGG-3′, 5′-NCG-3′ and 5′-NTG-3′, and introduced Sc++, ScRN++ and sgRNAs into rice protoplasts through PEG mediation, respectively, to detect the editing activity of the variants.

[0010] The REC domain of the Cas9 protein can specifically recognize and guide the RNA backbone to form a gRNA-DNA heteroduplex complex, and plays a vital role in activating the conformational changes of the Cas9 nuclease cleavage domain. In addition, the above R221K / N394K double mutations are both located in the REC domain, further emphasizing the key role of the REC domain in Cas9 DNA cleavage. In addition, at the 5′-NGG-3′PAM site, the commonly used SpCas9 protein exhibits higher editing efficiency than Sc++. Based on the above research foundation, we tried to directly exchange the REC domains of SpCas9 and Sc++ through rational design to construct a chimeric ScCas9 variant-Spc+ variant (amino acid sequence as shown in SEQ ID NO.3). And combined with the R221K / N394K mutation, the SpcRN+ variant (amino acid sequence as shown in SEQ ID NO.4) was constructed. At the same time, a positively charged loop from S. anginosus Cas9 (amino acid sequence as shown in SEQ ID NO.7) was introduced at the same position (367-376) to construct the SpcRN++ variant (amino acid sequence as shown in SEQ ID NO.5). To evaluate the targeted editing activity of this series of engineered chimeric Cas9 proteins, we continued to select 10 target sites using Sc++ and ScRN++ proteins as benchmark controls, and tested the editing efficiency of the system through protoplast transformation. The experimental results showed that, except for the Spc+ protein, the remaining variants showed higher editing activity at different sites compared to Sc++.

[0011] To further evaluate the editing performance of the engineered Sc++ variants in plants, we designed 12 rice endogenous gene target sites, including 5 sites that have been evaluated in rice protoplasts and 7 new sites, and combined Sc++, ScRN++, SpcRN+ and SpcRN++ variants to construct 6 multiple genome editing vectors, respectively, and stably transferred the systems into rice plants through the Agrobacterium-mediated callus transformation system. Each vector produced at least 30-40 T0 transgenic plants, and the mutation efficiency was detected using the High-throughput Tracking of Mutations (Hi-Tom) system.

[0012] For CRISPR / Cas9-mediated genome editing applications, off-target is still an important issue. Therefore, in order to continue to detect the off-target effects of the Sc++ variant constructed by the present invention, we first used the CRISPR-GE online tool to predict potential off-target sites with mismatches ≤3bp for different highly active targets. And for each treatment, multiple double-allelic mutant plants were selected, the corresponding sites were amplified, and the endogenous off-target rate of the system was detected using the Hi-Tom system. At the same time, in order to further detect the targeting specificity of the variant, a mismatch tolerance experiment was subsequently carried out. According to the sequence of the targeting site, single-base mismatches and adjacent double-base mismatch targets at consecutive positions were designed, and the Sc++ variants were introduced into rice protoplasts to detect the off-target effects of the variant.

[0013] A second object of the present invention is to provide a fusion protein obtained by connecting adenosine deaminase TadA8e (J.Li, R.Xu, R.Qin, X.Liu, F.Kong, P.Wei, Genome editing mediated by SpCas9 variants withbroad non-canonical PAM compatibility in plants. Mol.Plant 2021, 14, 352-360.) to the N-terminus of the chimeric Cas9 protein variant containing the D10A mutation.

[0014] The PAM preference of Cas proteins significantly limits the targeting range of base editors. Given that the Sc++ protein and its variants are only restricted by the PAM of a single base, we will continue to evaluate the compatibility of the variants with base editors. The highly active adenosine deaminase TadA8e was connected to the N-terminus of the Sc++ variant protein containing the D10A mutation to construct a series of adenine base editors (ABE8e) based on nSc++, nScRN++, nSpcRN+ and nSpcRN++. Subsequently, multiple endogenous rice gene sites were selected for four different PAM sequences: 5′-NAG-3′, 5′-NGG-3′, 5′-NCG-3′ and 5′-NTG-3′, and the A-to-G conversion efficiency of the system in rice protoplasts was detected by high-throughput sequencing.

[0015] To further clarify the editing performance of the chimeric Cas9 variant-mediated adenine base editors designed by us and its prospects in agricultural trait improvement, we combined the variants with crop improvement applications in order to obtain rice mutant plants with herbicide resistance. Based on the above concept, we designed two sgRNA target sequences to target two key amino acids in the OsACC carboxyltransferase domain, D2089 and I1792. It has been previously shown that similar substitutions of these two amino acids can confer herbicide resistance to L. rigidum weeds. The two sgRNAs were then linked to the ABE8e vectors based on nSc++, nScRN++, nSpcRN+, and nSpcRN++, respectively, and transformed into rice plants by Agrobacterium, and the genotype and herbicide resistance of the regenerated T0 generation plants were tested.

[0016] The third object of the present invention is to provide a polynucleotide sequence that can be transcribed and translated into the chimeric Cas9 protein variant or transcribed and translated into the fusion protein.

[0017] A fourth object of the present invention is to provide a gene editing system, comprising sgRNA and the polynucleotide sequence.

[0018] A fifth object of the present invention is to provide an expression vector containing the gene editing system.

[0019] The sixth object of the present invention is to provide the application of the gene editing system or the expression vector as an editing tool for editing genomic DNA in related editing of plant genomic DNA.

[0020] Furthermore, the editing is base substitution, insertion or deletion.

[0021] The present invention has the following beneficial effects:

[0022] The engineered chimeric Cas9 protein variant of the present invention effectively combines the cutting efficiency of SpCas9 and the PAM recognition ability of ScCas9, can achieve efficient and broad-spectrum genome editing, and expand the application of ScCas9 in the field of plant biology. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 Design of Sc++ variants and characterization of their DNA cleavage efficiency in plant cells.

[0024] (a) Schematic diagram of ScCas9 and its variants, including Sc++, ScRN++, Spc+, SpcRN+, and SpcRN++. (b) The editing efficiency of Sc++ and ScRN++ was detected in rice protoplasts. (c) The cleavage efficiency of Sc++ and ScRN++ with three chimeric nucleases, Spc+, SpcRN+, and SpcRN++, was detected in rice protoplast cells. (d) Comprehensive discussion of the editing efficiency of the five variant proteins Sc++, ScRN++, Spc+, SpcRN+, and SpcRN++. The editing efficiency of each target was normalized to 1 using Sc++, and the editing efficiency of ScRN++, Spc+, SpcRN+, and SpcRN++ was adjusted accordingly. P values ​​were obtained using two-tailed Student's t-test: *P<0.05, **P<0.01.

[0025] Figure 2 Analysis of gene mutation results produced by four ScCas9 variants in rice plants.

[0026] (a) Comparison of mutation efficiencies of four ScCas9 variants in different targets of T0 rice plants. The highest mutation efficiencies and biallelic mutation ratios are highlighted in red and blue, respectively. (b) Analysis of mutation types induced by four ScCas9 variants at different targets. Bi: biallelic mutation; Ho: homozygous mutation; He: heterozygous mutation; Chi: chimera. Seedlings with indels efficiencies ≥ 70% were classified as biallelic mutations or homozygous mutations, 30%-70% were considered heterozygous mutations, and <30% were considered chimeras. (c) Statistics of the average editing efficiencies of ScCas9 variants targeting four PAMs: NAG, NGG, NTG, and NCG. (d) Average editing efficiencies of targeting TCG PAM in T0 transgenic plants.

[0027] Figure 3 Targeting specificity for Sc++, ScRN++, SpcRN+, and SpcRN++ variants. The sgRNA sequence contains mismatched base pairs at consecutive positions. Mismatched bases are marked in red, and PAM is marked in blue.

[0028] Figure 4 Editing efficiency of adenine base editors derived from ScCas9 variants in rice protoplast cells.

[0029] (a) Schematic diagram of the structure of TadA8e fused with nSc++ / nScRN++ / nSpcRN+ / nSpcRN++-ABE8e. (b) Overall comparison of the editing efficiency of nSc++ / nScRN++ / nSpcRN+ / nSpcRN++-ABE8e. (c) The efficiency of gene mutations induced by adenine base editors based on four nSc++ variants in eight target sites in rice protoplasts. The editing efficiency of each target site is the sum of the mutation efficiencies of all sites within the editing window. P values ​​were obtained using a two-tailed Student's t-test: *P<0.05, **P<0.01. (d) Analysis of the editing windows of adenine base editors derived from four ScCas9 variants.

[0030] Figure 5 Application of adenine base editors based on nSc++, nScRN++, nSpcRN+ and nSpcRN++ in rice plants.

[0031] (a) Schematic diagram of the OsACC gene target site. (b) Comparison of the editing efficiency of the adenine base editors derived from the nSc++ variants in the T0 transgenic plants OsACC-D2089 and I1792 target sites. (c) Identification of the editing windows of the four adenine base editors in the two target sites of the OsACC gene. (d) Global analysis of the genotypes of the regenerated T0 rice plants. (e) Analysis of the genotypes of the T0 rice plants regenerated with herbicide resistance targeting the OsACC-D2089 site. (f) Analysis of the genotypes of the T0 rice plants regenerated with herbicide resistance targeting the OsACC-I1792 site. DETAILED DESCRIPTION

[0032] The present invention is described in detail below in conjunction with the accompanying drawings and specific examples, but should not be construed as limiting the present invention. Unless otherwise specified, the technical means used in the following examples are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial sources.

[0033] The primer sequences involved in the following examples are shown in Table 1:

[0034] Table 1 Primer information

[0035]

[0036] Example 1: Construction of ScCas9 variant proteins and detection of the editing efficiency of variants in rice protoplasts

[0037] 1. Construction of ScCas9 variant vectors.

[0038] The ScCas9-sgRNA backbone was chemically synthesized by GenScript (Nanjing, China). The OsU3 promoter of rice was amplified using primers M13-F and OsU3F-R, the ScCas9-sgRNA backbone was amplified using primers Sc-sg-F and Sc-sg-R, and the pHUE411 vector (published in HLXing, L.Dong, ZPWang, HYZhang, CYHan, B.Liu, XCWang, QJChen, A CRISPR / Cas9 toolkit for multiplex genomeediting in plants. BMC Plant Biol. 2014, 14, 327) was amplified using primers gRNA-HindIII-F and HindIII-R. Finally, the three amplification products were fused using over-lap PCR to obtain the OsU3-Sc-sgRNA fragment. The pHUE411 vector and the OsU3-Sc-sgRNA fragment were cut with HindIII restriction endonuclease, respectively, and the vector and the fragment were connected with T4 DNA polymerase to obtain the pHUE-Sc-sg vector.

[0039] ScCas9-sgRNA backbone sequence (SEQ ID NO. 8): GTTTTAGAGCTAGGTACCTAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC.

[0040] (2) Construction of knockout vectors containing ScCas9 variants.

[0041] The codon-optimized Sc++ protein-coding gene sequence was chemically synthesized by GenScript (Nanjing, China), and the sequence is shown in SEQ ID NO.6. First, the SpCas9 protein sequence in the pHUE-Sc-sg vector was excised by double digestion with XmaJI / SacI, and the large fragment vector backbone was recovered. The R221K / N394K double mutation was introduced into the gene sequence of Sc++ by segmented PCR amplification. The specific operation steps are as follows: the Sc++ protein front sequence was amplified using primers 411-Sc-F1 and ScR221K-R, and the R221K point mutation was introduced; the Sc++ protein middle sequence was amplified using ScR221K-F and ScN394K-R, and the N394K point mutation was introduced; the Sc++ protein tail sequence was amplified using primers ScN394K-F and 411-Sc-R1, and the remaining protein sequence was completed. Finally, the three protein fragments and the vector backbone were assembled by Gibson to obtain the pHUE-ScRN++ vector.

[0042] (3) Protoplast transfection.

[0043] The rice variety is Nipponbare. In 1 / 2MS medium, Nipponbare rice seedlings were cultured for 14 days at 28°C, 16h light and 8h dark conditions to obtain rice protoplasts. 20μg of plasmid was delivered to the protoplast cells by PEG-mediated transfection and incubated at 23°C in the dark for 48h. The cells were then collected, the protoplast genomic DNA was extracted using the CTAB method, and the corresponding mutation sites were amplified and sequenced using the NovaSeq PE150 (Novogene) platform to detect the mutation efficiency.

[0044] The present invention first compared the editing efficiency of Sc++ (amino acid sequence as shown in SEQ ID NO.1) and ScRN++ (amino acid sequence as shown in SEQ ID NO.2). A total of 10 rice endogenous targets were designed, including four PAMs: 5′-NAG-3′, 5′-NGG-3′, 5′-NCG-3′ and 5′-NTG-3′. Under the control of rice OsU3 promoter, sgRNAs and Sc++ and ScRN++ with nuclear localization signals driven by maize ZmUbi promoter were delivered to rice protoplasts to detect variant mutation efficiency ( Figure 1 a). Analysis of sequencing results showed that the editing efficiency of ScRN++ was higher than that of Sc++ at 7 out of 10 sites, and the editing efficiency of the remaining three sites was comparable ( Figure 1 b). For 5′-NAG-3′ and 5′-NGG-3′ PAMs, the editing efficiency of Sc++ was between 2.0% and 17.2%, while that of ScRN++ was 6.0% to 21.1%, and the editing efficiency of ScRN++ was increased by an average of 1.7 times (except for the OsHOS66 and OsGAPDH targets). For 5′-NCG-3′ and 5′-NTG-3′ PAMs, the editing efficiency of Sc++ was 0.4% to 1.7%, while that of ScRN++ was 0.8% to 3.8%, and the editing efficiency of ScRN++ was increased by about 2.5 times on average (except for the OsFBK1 target). The results showed that the double mutation of R221K / N394K in ScRN++ enhanced its nuclease activity, and the 5′-NAG-3′ and 5′-NGG-3′ PAM targets showed higher editing efficiency compared with 5′-NTG-3′ and 5′-NCG-3′ PAMs.

[0045] (4) Construct chimeric Sc++ variants and detect mutation efficiency using protoplast cells.

[0046] Primers 411-Sc-F1 and ScAvrll-R1 were used to amplify the RuvC-Ⅰ region and double helix bridge structure (aa1-94) of Sc++, primers spREC-F and spREC-R were used to amplify the REC domain of SpCas9, and primers ScAfIII-F and 411-Sc-R1 were used to amplify the remaining Sc++RuvC region, HNH region and PI domain. The pHUE-Spc+ binary vector was constructed by Gibson assembly fragments and pHUE-Sc-sg vector. In the same segmented method, primers SpcRN+-F and spREC-R were used to amplify the SpCas9 REC domain containing the R221K / N394K double mutation, and pHUE-SpcRN+ was constructed by combining the remaining fragments; based on SpcRN+, a positively charged loop consisting of ten amino acids from S. anginosus Cas9 was inserted after the 367th amino acid of the variant. The specific operation steps are as follows: using the existing pHUE-SpcRN+ as a template, the two sequences of the SpCas9 REC (R221K / N394K) domain containing a positively charged loop and a repeating sequence were amplified using primers SpcRN+-F and SpcRN++-R as well as SpcRN++-F and spREC-R, and then the sequences at both ends were connected by overlap lap PCR to obtain a complete SpCas9REC (R221K / N394K) protein sequence containing a positively charged loop. Finally, the remaining fragments were connected to the vector backbone to construct the pHUE-SpcRN+ vector.

[0047] Based on the above experimental results, three chimeric proteins, Spc+ (amino acid sequence as shown in SEQ ID NO.3), SpcRN+ (amino acid sequence as shown in SEQ ID NO.4) and SpcRN++ (amino acid sequence as shown in SEQ ID NO.5), were engineered and constructed. They were combined with Sc++ and ScRN++, targeting 10 different sites respectively, and were transferred into rice protoplasts in the same way. The mutation efficiency was detected by sequencing. The experimental results showed that compared with Sc++, the activity of the Spc+ variant was significantly reduced, but after the incorporation of the R221K / N394 double mutation, SpcRN+ successfully restored the cutting activity, and the editing efficiency was comparable to that of Sc++. After the positively charged ring was further introduced, the cutting activity of the SpcRN++ variant was significantly better than that of other variants ( Figure 1 c). Among all the 10 targets tested, SpcRN++ had better editing efficiency than Sc++. Meanwhile, ScRN++ also improved the editing efficiency in five targets compared with Sc++ ( Figure 1d). Among them, SpcRN++ had a higher editing efficiency than ScRN++ in eight target sites. Overall, compared with Sc++, the editing efficiency of SpcRN++ increased by about 3.3 times on average (OsSLR1 had the highest increase of 14.2 times), and the editing efficiency of ScRN++ increased by 2.0 times (OsSIP1 had the highest increase of 5.4 times). Previous reports have shown that Sc++ has low editing activity at NTG PAMs targets, while the editing efficiency of SpcRN++ and ScRN++ was improved at such sites. The results show that both SpcRN++ and ScRN++ have high editing activity, among which SpcRN++ has a slightly better editing effect in plant cells.

[0048] Example 2: Detecting the editing activity of ScCas9 variants in rice plants

[0049] 1. Construction of multi-gene knockout vector.

[0050] Using the three-primer method, pCBCMT1T2 vector (published in HLXing, L.Dong, ZPWang, HYZhang, CYHan, B.Liu, XCWang, QJChen, A CRISPR / Cas9 toolkit for multiplexgenome editing in plants. BMC Plant Biol. 2014, 14, 327) was used as a template to connect the double target sites, and the fragments were connected to pHUE-Sc++, pHUE-ScRN++, pHUE-SpcRN+ and pHUE-SpcRN++ by the Gibson method to construct a multi-gene knockout vector. OsU3 and TaU3 were used to start the expression of two sgRNAs, respectively. Using this method, 24 vectors were constructed in total by combining 12 endogenous rice genes.

[0051] 2. Agrobacterium-mediated callus transformation and obtaining T0 generation transgenic rice plants.

[0052] The above 24 vectors were transferred into the EHA105 tumefaciens Agrobacterium strain by heat shock method, and screened overnight on LB medium supplemented with kanamycin (50 mg / L) and rifampicin (25 mg / L) to obtain positive clones. After Sanger sequencing was correct, the bacteria were preserved for use. Mature seeds of the japonica rice variety Nipponbare were used for callus induction. After the above Agrobacterium was used to infect rice embryonic callus, 50 mg / L hygromycin was used for screening and culture for 4 weeks to obtain resistant callus, and then the resistant callus was transferred to a regeneration medium containing 50 mg / L hygromycin, and regenerated T0 generation transgenic seedlings were obtained while continuously screening, and usually 30-40 transgenic mutants were produced for each vector. The specific infection method refers to the research results of Hiei et al.

[0053] 3. Collect three to four leaves from each seedling as a single sample, extract the genomic DNA of the above-mentioned regenerated T0 generation plants by CTAB method, amplify the target sequence using specific primers, and detect the mutation efficiency by Hi-Tom high-throughput sequencing platform. During data analysis, mutation reads of gene knockouts below 3% were ignored.

[0054] Sequencing data showed that for the 5′-NAG-3′ PAMs site, the SpcRN++ variant achieved the highest editing efficiency, 97.1% (OsWSL9) and 94.3% (OsELF1) ( Figure 2 a). However, at the NGG PAMs site, Sc++ had the highest editing efficiency, and the other variants were inferior to Sc++, but SpcRN++ showed the same or higher biallelic mutation rate. At the OsIPA1 site, SpcRN++ produced 88% (22 / 25) homozygous / biallelic mutation rate, while Sc++ was 45.2%, ScRN++ was 46.4%, and SpcRN+ was 12.5% ​​( Figure 2 a and 2b). At the OsSPP2 target site, Sc++, ScRN++, and SpcRN++ showed similar biallelic mutation ratios. For the 5′-NTG-3′ PAMs target site, SpcRN++ showed the highest editing activity among all four tested sites ( Figure 2 c), the editing efficiency was between 33.3% and 63.9% (Sc++ was 5.7-48.6%, ScRN++ was 14.3-42.9%, and SpcRN+ was 6.3-34.4%). But overall, except for one plant with a double-allelic mutation at the OsACC target site obtained by ScRN++, the double-allelic mutation was almost only present in the plants treated with SpcRN++. For the NCG PAMs site, Sc++ and its variants showed different targeting effects. At the OsMTN site containing 5′-NGG-3′PAM, all four variants can be effectively edited, among which SpcRN+ had the highest efficiency, while SpcRN++ had the highest double-allelic mutation rate ( Figure 2 a and 2b). However, in the remaining three 5′-TCG-3′PAMs targets (OsTSV3-T2, OsCCT1, and OsNAL1), the targeting activities of Sc++ and SpcRN+ were negligible, with editing efficiencies of 5.0% to 8.6% for ScRN++ and 5.6% to 13.9% for SpcRN++. Plant results showed that the chimeric SpcRN++ had high editing activity at different 5′-NNG-3′PAMs sites and could be used to obtain genome-edited rice plants.

[0055] Example 3: Detection of off-target effects of Sc++ variants

[0056] 1. Predict off-target sites and detect off-target activity.

[0057] Three highly active plant targets, OsIPA1, OsWSL1 and OsSPP2, were selected, and potential off-target sites were predicted using the CRISPR-GE online tool with ≤3 mismatched bases. The genomic sequences containing the putative off-target regions were amplified by PCR, and their off-target activities in four variants, Sc++, ScRN+, SpcRN+ and SpcRN++, were studied by Hi-Tom sequencing analysis.

[0058] In the present invention, we selected 12 biallelic gene-edited plants for each treatment to detect off-target activity (the T0 generation biallelic mutants contained only two and four strains, respectively, in the two targets of OsIPA1 and OsSPP2 treated with SpcRN+). Sequencing results showed that no off-target mutations were detected at all predicted off-target sites for all tested nucleases.

[0059] 2. Detection of mismatch tolerance of Sc++ variants

[0060] Continuous mismatch detection variant targeting accuracy. The highly active OsWSL1 target was selected as the research object. Single-base and double-base mismatches were introduced at consecutive positions at 1-19bp of the OsWSL1 target sequence, and the mismatch principle was the conversion between purine and pyrimidine (A-to-C or G-to-T) and pyrimidine and purine (C-to-A or T-to-G). Different mismatch targets were designed and synthesized, and connected to four vectors, pHUE-Sc++, pHUE-ScRN++, pHUE-SpcRN+ and pHUE-SpcRN++, respectively, and the mutation efficiency was detected by protoplast transformation.

[0061] The results are as follows Figure 3 As shown in the figure, compared with Sc++, except for the relatively high off-target activity of ScRN++ and SpcRN+ at some targets, the specificity difference between variants is small or slightly reduced overall, which may be due to the enhanced cleavage activity. Based on the above two results, we believe that SpcRN++ maintains the intrinsic sequence specificity of Sc++ to a large extent while improving the editing activity.

[0062] Example 4: Testing the compatibility of Sc++ variants with adenine base editors

[0063] 1. Construction of adenine base editors derived from Sc++ variants

[0064] First, the original SpCas9-sgRNA backbone in the SpG-ABE8e vector (published in J.Li, R.Xu, R.Qin, X.Liu, F.Kong, P.Wei, Genome editing mediated by SpCas9 variants with broad non-canonical PAM compatibility in plants.Mol.Plant 2021,14,352-360.) was removed with HindIII restriction endonuclease. The OsU3 promoter was amplified using M13-F and SpR-R primers with SpG-ABE8e as a template, and the ScCas9-sgRNA backbone was amplified with SpR-Sc-sg-F and ABE-Sc-sg-R as primers and pHUE-Sc-sg vector as a template. The remaining SpG-ABE8e vector backbone was combined and assembled by the Gibson method to construct ABE8e-Sc-sg.

[0065] By specific site mutagenesis, the D10A point mutation was introduced into the Sc++, ScRN++, Spc+, SpcRN+ and SpcRN++ variants using primers 8e-Sc-F and Sc-R, respectively, to obtain nSc++, nScRN++, nSpcRN+ and nSpcRN++ proteins with single-strand cleavage activity. Using SpG-ABE8e vector as template, primers ubi-A3A / 8e-F and 8e-R were used to amplify TadA8e gene sequence, and primers Sc-NLS-F and NLS-ter-R were used to amplify triple nuclear localization signal (NLS). By Gibson method, nSc++ / nScRN++ / nSpcRN+ / nSpcRN++, TadA 8e and 3×NLS were integrated into ABE8e-Sc-sg vector backbone to construct nSc++-ABE8e, nScRN++-ABE8e, nSpcRN+-ABE8e and nSpcRN++-ABE8e vectors ( Figure 4 a).

[0066] 2. Protoplast transformation to detect single base mutation efficiency

[0067] The present invention selected 8 rice endogenous gene sites, designed sgRNA and connected them into four vectors, nSc++-ABE8e, nScRN++-ABE8e, nSpcRN+-ABE8e and nSpcRN++-ABE8e, respectively, to construct 32 different plasmids. Then all of them were transferred into rice protoplast cells, and high-throughput sequencing was used to detect the A-to-G mutation efficiency. The specific rice protoplast transformation steps and detection methods refer to Example 1.

[0068] The results showed that the single-base editing efficiency induced by ABE8e based on nScRN++, nSpcRN+, and nSpcRN++ was comparable to that of nSc++ ( Figure 4 b). However, at sites with relatively low editing efficiency (<10% A-to-G conversion rate), nSpcRN++-ABE8e improved the editing efficiency, increasing it by about 3.4-fold at the OsMTN site ( Figure 4 c). In addition, at sites that nSc++-ABE8e can effectively edit, nSpcRN++-ABE8e also showed an enhanced trend, increasing by 1.4 times at the OsIPA1-T2 site ( Figure 4 c). Further analysis of the mutation results showed that the editing windows of all variants were similar, all at positions 4-10 (the base farthest from the PAM end was the first), and the editing effects of the remaining sites were limited ( Figure 4 d). In summary, the four variants are all very compatible with TadA8e, among which SpcRN++ has the best effect.

[0069] Example 5: Application of adenine base editors derived from Sc++ variants in rice

[0070] 1. Construction of plant transformation vector

[0071] In order to illustrate the potential application of the Sc++ variant constructed in the present invention, two targeting sgRNAs were designed for the two key amino acids D2089 and I1792 in the OsACC carboxyltransferase domain ( Figure 5 a), and were incorporated into nSc++-ABE8e, nScRN++-ABE8e, nSpcRN+-ABE8e and nSpcRN++-ABE8e vectors, respectively, to construct 8 related vectors. Subsequently, the vector was transferred into rice callus tissue through Agrobacterium-mediated callus transformation, and transgenic T0 generation plants were regenerated. About 40 transgenic offspring were obtained for each treatment. Plant genomic DNA was extracted, the corresponding mutation sites were amplified, and Hi-Tom sequencing was used to detect the mutation efficiency and mutant genotype.

[0072] For the OsACC-D2089 locus, 33 of the 37 nSpcRN++-ABE8e regenerated plants contained at least one A-to-G transition at the target site, with a mutation efficiency of 89.2%, which was comparable to the mutation rate of nSpcRN+ (89.2%), but higher than that of nSc++ (48.6%) and nScRN++ (54.1%). At the same time, nSpcRN++-ABE8e produced a higher biallelic mutation rate ( Figure 5 b). At the OsACC-I1792 locus, the single base substitution efficiency of nSpcRN+ and nSpcRN++ was higher than that of nSc++ and nScRN++, and nSpcRN++ showed the highest biallelic mutation ratio ( Figure 5 b). No indels were detected in all tested plants. In addition, among the tested sites, nSpcRN++-ABE8e showed a wider base editing window. At the OsACC-D2089 site, in addition to generating A-to-G conversions within the sixth and eighth main editing windows, nSpcRN+ and nSpcRN++ also successfully introduced mutations in A11 ( Figure 5 c). Interestingly, the base substitutions induced by ABE8e based on nSc++ and nScRN++ at position A6 were always accompanied by mutations at position A8. Only a single A6-to-G6 transition was found in base editing mediated by nSpcRN+ and nSpcRN++. For the OsACC-I1792 locus, ABE8e-nSpcRN++ also extended the editing window to A3-A12 and generated more mutant genotypes ( Figure 5 d).

[0073] 2. Identification of herbicide resistance in T0 generation plants

[0074] In order to analyze the herbicide resistance induced by A-to-G transformation of OsACC-D2089 and OsACC-I1792 targets, the T0 transgenic plants were transferred to Kimura nutrient solution containing 1.08 mg / L fluazifop-ethyl and cultured at 28°C, 16 h light, 8 h dark. After two weeks of constant temperature treatment, the phenotypes were observed and photographed.

[0075] At the OsACC-D2089 target site, A6-to-G6 and A8-to-G8 induced D2089G and S2090G substitutions, respectively. The experimental results showed that the regenerated seedlings containing a single D2089G mutation produced by nSpcRN+ / nSpcRN++-ABE8e treatment were herbicide resistant and could survive normally after treatment ( Figure 5 e). At the OsACC-I1792 locus, almost all plants with herbicide resistance carried the I1792V and N1791G / D double mutations ( Figure 5 f). The present invention demonstrates for the first time that the introduction of D2089G or I1792V mutations into the OsACC gene can produce rice plants with herbicide resistance. In summary, nSpcRN++-ABE8e is an efficient base editing tool that broadens the editing window and is expected to be applied to the improvement of agronomic traits.

[0076] Although the preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

Claims

1. A chimeric Cas9 protein variant, characterized in that The chimeric Cas9 protein variant is obtained by performing amino acid mutation modification on the Sc++ variant as shown in SEQ ID NO.1, and the chimeric Cas9 protein variant is obtained by any one of the following methods: (1) replacing the REC domain of the Sc++ variant with the REC domain of the SpCas9 protein to obtain a Spc+ variant, mutating the 221st amino acid R to K and the 394th amino acid N to K in the Spc+ variant, recorded as the SpcRN+ variant; (2) A positively charged loop from S. anginosus Cas9 was introduced into the SpcRN+ variant, which was recorded as the SpcRN++ variant. The positively charged loop was located at positions 367-376 of the SpcRN++ variant, and the amino acid sequence was KKLRKRSGKL.

2. The chimeric Cas9 protein variant according to claim 1, characterized in that The amino acid sequences of the SpcRN+ variant and the SpcRN++ variant are shown in SEQ ID NO.4 and SEQ ID NO.5 respectively.

3. A fusion protein, characterized in that It is obtained by connecting adenosine deaminase TadA8e to the N-terminus of the chimeric Cas9 protein variant of claim 1 containing the D10A mutation.

4. A polynucleotide sequence, characterized in that It can be transcribed and translated into the chimeric Cas9 protein variant as described in claim 1 or transcribed and translated into the fusion protein as described in claim 3.

5. A gene editing system, characterized in that: Comprising sgRNA and the polynucleotide sequence of claim 4.

6. An expression vector, characterized in that: It contains the gene editing system described in claim 5.

7. Use of the gene editing system as described in claim 5 or the expression vector as described in claim 6 as an editing tool for editing genomic DNA in the related editing of genomic DNA fragments.

8. The use according to claim 7, characterized in that: The editing is a substitution, insertion or deletion of a base.

Images