Construction method of macrophage specific fluorescence report mouse model

Abstract

The invention relates to a construction method of a macrophage specific fluorescence report mouse model, and belongs to the technical field of genetic engineering and genetic modification. According to the invention, a brand-new C1qc-CreChy gene knock-in mouse model is obtained after a C1qc gene locus is edited through a CRISPR / Cas9 genome editing technology for the first time, the expression of Cre and mCherry is directly driven by a C1qc promoter, and flow cytometry verifies that mCherry has very high expression quantity only in microglial cells in the brain of a mouse and macrophages in the spleen of the mouse. And mCherry expression is not detected in other immune cells, so that the two macrophages are traced and used for researching the functions of the macrophages. The invention provides a usable animal model for researching heterogeneity of macrophages, and provides a new animal model for researching complex immune functions in a body.

Description

Technical Field

[0001] The invention relates to a method for constructing a macrophage-specific fluorescent reporter mouse model, and belongs to the technical field of genetic engineering and genetic modification. Background Art

[0002] Macrophages are a type of immune cell in the body that has phagocytic function. They are essentially white blood cells located in tissues and participate in nonspecific defense (innate immunity) and specific defense (cellular immunity) in vertebrates. Their main function is to remove cell debris in the body and phagocytize invading pathogens in the form of fixed cells or free cells, and activate lymphocytes or other immune cells to respond to pathogens. Macrophages are immune cells with multiple functions and are important subjects for studying cellular phagocytosis, cellular immunity and analytical immunology.

[0003] However, macrophages are a highly heterogeneous cell population that exhibit unique phenotypes and functions in different tissues and organs as well as in complex microenvironments in the body. For example, microglia are macrophages resident in the central nervous system (CNS) that can rapidly initiate immune responses in the face of tissue damage and disease, primarily by presenting antigens, secreting pro-inflammatory or anti-inflammatory cytokines and chemokines, and phagocytosing pathogens or apoptotic cells. The most important macrophages in the liver are liver-resident macrophages (Kupffer cells, KCs). KCs have innate immune functions that can maintain immune tolerance and eliminate pathogenic microorganisms. They can undergo functional differentiation when stimulated by different signals and subsequently activate pro-inflammatory responses. The most important macrophage population in the spleen is red pulp macrophages (RPMs), which are located in the red pulp of the spleen. Their main function is to clear aging red blood cells and play a role in controlling infection and inducing innate and adaptive immunity. Therefore, in order to further study the functions of macrophages in different tissues and organs and realize real-time tracking of macrophages, it is necessary to construct a macrophage-specific fluorescent reporter mouse genetic model, which is of great significance for the study of macrophage function. Summary of the invention

[0004] The purpose of the present invention is to provide a method for constructing a macrophage-specific fluorescent reporter mouse model, and to provide a mouse model capable of tracing microglia in the mouse brain and macrophage subpopulations in the spleen for the prior art.

[0005] In order to achieve the above object, the technical solution of the method for constructing a macrophage-specific fluorescent reporter mouse model of the present invention is: A method for constructing a macrophage-specific fluorescent reporter mouse model comprises the following steps: using CRISPR / Cas9 genome editing technology, inserting a Cre-P2A-mCherry element into the mouse C1qc gene site to obtain a macrophage-specific fluorescent reporter mouse model.

[0006] The beneficial effect of the above technical solution is that: the method for constructing a macrophage-specific fluorescent reporter mouse model is a pioneering invention. The present invention first edited the C1qc gene site through CRISPR / Cas9 genome editing technology to obtain a new C1qc-CreChy gene knock-in mouse model (i.e., a macrophage-specific fluorescent reporter mouse model), realizing that the expression of Cre and mCherry is directly driven by the C1qc promoter, and verified by flow cytometry that mCherry has a high expression level only in microglia in the mouse brain and macrophages in the spleen, while no mCherry expression was detected in other immune cells, thereby tracing these two macrophages for studying their functions. The present invention provides an animal model that can be used to study the heterogeneity of macrophages, and provides a new animal model for studying complex immune functions in the body.

[0007] Furthermore, the mouse model prepared by the present invention can be used to prepare a mouse model with conditional gene knockout in macrophages, laying a foundation for studying complex immune functions and immune changes in vivo.

[0008] As a further improvement, the target sequence of the mouse C1qc gene locus is: C1qc-sgRNA: 5'-TGGGTCCAACGACCATCCTGAGG-3' (shown in SEQ ID NO.1).

[0009] The beneficial effect of the above technical solution is that the above sgRNA can be used to achieve stable, successful and efficient knock-in of gene elements, laying the foundation for the successful construction of a mouse model.

[0010] Furthermore, the present invention directly inserts the Cre-P2A-mCherry element after the start codon of the C1qc gene and before exon 1. Compared with the traditional method of directly inserting the expression element in front of the stop codon, while not destroying the expression of the internal gene C1qc, it can also ensure that Cre and mCherry have higher expression levels, so that Cre has better activity and mCherry has higher fluorescence brightness.

[0011] As a further improvement, the Cre-P2A-mCherry element further includes a 5' homology arm sequence and a 3' homology arm sequence.

[0012] As a further improvement, the nucleotide sequence of the Cre-P2A-mCherry element is shown in SEQ ID NO.2.

[0013] As a further improvement, during site-specific insertion, the Cas9 mRNA, sgRNA and Cre-P2A-mCherry element DNA were mixed and injected into mouse fertilized eggs, and the surviving fertilized egg cells were further transplanted into the fallopian tubes of pseudopregnant mice to obtain Founder mice.

[0014] As a further improvement, the construction method includes performing genotype detection on founder mice, screening out mouse individuals in which the Cre-P2A-mCherry element sequence is inserted in the genome and the insertion site is correct, and obtaining a macrophage-specific fluorescent reporter mouse model. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 The strategy for constructing C1qc-CreChy knock-in mice in Example 1 of the present invention; Figure 2 The sequencing results of the C1qc-CreChy gene knock-in mice in Example 1 of the present invention; Figure 3 Detection of mCherry expression in the spleen of C1qc-CreChy gene knock-in mice in Example 2 of the present invention (wherein, (A) is a schematic diagram of gates for detecting different cell populations in the spleen of C1qc-CreChy gene knock-in mice by flow cytometry; (B) is an overlay of peak graphs of mCherry expression levels in B cells, neutrophils, monocytes and macrophages in the spleen of C1qc-CreChy gene knock-in mice); Figure 4 This is a schematic diagram of the gates of different cell populations in the brain of C1qc-CreChy gene knock-in mice in Example 3 of the present invention and the detection of the expression levels of mCherry in different cell populations. DETAILED DESCRIPTION

[0016] Macrophages are an important type of immune cell in mammals. They have strong heterogeneity and exhibit unique phenotypes and functions in different tissues and organs and in complex microenvironments in the body. Therefore, constructing an animal model that can track them in real time is of great significance for studying the functions of macrophages in different tissues and organs. Based on this, the present invention provides a method for constructing a macrophage-specific fluorescent reporter mouse model.

[0017] The present invention has found through a large number of previous studies that the C1qc gene is a specific expression gene of mouse brain microglia and spleen red pulp macrophages, and it is speculated that it can be used as a marker for real-time tracking of macrophages. Subsequently, the present invention first edits the C1qc gene site by CRISPR / Cas9 genome editing technology to obtain a C1qc-CreChy gene knock-in mouse model; then the C1qc-CreChy gene knock-in mouse model (i.e., macrophage-specific fluorescent reporter mouse model) is subjected to flow cytometry detection to analyze the expression pattern of mCherry. It was found that mCherry has a high expression level only in spleen macrophages and brain microglia, while mCherry expression was not detected in other cell populations, which fully demonstrates that the C1qc-CreChy gene knock-in mouse model can also achieve the specific expression of Cre recombinase in these two macrophages. The construction of the macrophage-specific expression mCherry fluorescent reporter mouse genetic model of the present invention provides a better animal genetic model for the elucidation of the function of macrophages in various diseases.

[0018] The present invention will be further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto; however, these embodiments are only examples and do not constitute any limitation to the scope of the present invention. The details and forms of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but these modifications and replacements all fall within the protection scope of the present invention. The experimental methods in the following embodiments, if not otherwise specified, are conventional methods, such as referring to the molecular cloning laboratory manual (Sambrook J & Russell DW. Molecular cloning: a laboratory manual. 2001) compiled by Sambrook et al., or the instructions provided by the product manufacturer, etc. The experimental materials used in the following embodiments, if not otherwise specified, are purchased from conventional biochemical reagent manufacturers.

[0019] A specific embodiment of the method for constructing a macrophage-specific fluorescent reporter mouse model of the present invention: The present invention firstly edited the C1qc gene locus through CRISPR / Cas9 genome editing technology to obtain a new C1qc-CreChy gene knock-in mouse model, realizing that the expression of Cre and mCherry is directly driven by the C1qc promoter, and verified by flow cytometry that mCherry is only highly expressed in microglia in the mouse brain and macrophages in the spleen, while no mCherry expression is detected in other immune cells, thereby tracing these two macrophages for studying their functions. The specific implementation operations are as follows: Example 1 Construction of C1qc-CreChy gene knock-in mouse model In this example, a targeting sgRNA is designed for the mouse C1qc start codon site, and a homologous recombination template is synthesized. After being injected into a mouse fertilized egg, the homologous recombination template can be inserted into the target site through homologous recombination to complete the construction of a C1qc-CreChy gene knock-in mouse, which specifically includes the following steps: 1. Determination of the targeting sequence A large number of experiments and analyses were conducted in the early stage of the present invention, and it was found that the C1qc gene was only expressed in mouse brain microglia and spleen red pulp macrophages, but not in other immune cells. Therefore, the C1qc gene was selected as the gene editing site.

[0020] In order to insert the Cre-P2A-mCherry element into the C1qc gene locus to achieve the simultaneous expression of Cre and mCherry with C1qc, a targeting site was designed near the start codon of the C1qc gene. Using the online design website CRISPOR (http: / / crispor.tefor.net / ), a sgRNA was designed (the selection principle is: close to the start codon, good specificity, and high efficiency). The sequence of the sgRNA is as follows: C1qc-sgRNA: 5′-TGGGTCCAACGACCATCCTGAGG -3′ (shown in SEQ ID NO. 1).

[0021] 2. Obtaining recombinant template DNA Design the recombination template DNA sequence, including the following elements, such as Figure 1 As shown: (1) 5' homology arm and 3' homology arm sequences: The homology arms serve as templates during homologous recombination and can ensure that the exogenous DNA sequence is accurately inserted into the target site; (2) P2A linker sequence: By inserting the P2A peptide sequence between two genes, the protein can be automatically cleaved during the translation process, thereby achieving independent expression of multiple proteins. In the embodiment, by inserting P2A between the Cre, mCherry and C1qc genes, it can be ensured that the three genes Cre, mCherry and C1qc can be translated and cleaved normally to form three independent proteins, and each of them can perform normal biological functions. If the P2A sequence is not added, the three genes Cre, mCherry and C1qc will be translated into a large protein and will not be able to perform normal biological functions; (3) Cre sequence: Cre recombinase is an enzyme protein derived from bacteriophage P1 with a molecular weight of approximately 38 kDa. It has the ability to recognize and catalyze homologous recombination between two LoxP sites, thereby leading to DNA deletion, translocation, etc. (4) mCherry sequence: mCherry is a red fluorescent dye widely used in biotechnology. It is mainly used as a tracer, including molecular labeling and localization of cellular components. This dye is not only used for living cell imaging and tracking experiments, but can also be used as a reporter gene to study the level and pattern of gene expression.

[0022] The nucleotide sequence of the recombinant template DNA is shown in SEQ ID NO. 2. Among them, the 1st to 752nd positions from the 5' end are the 5' homology arm sequence; the 753rd to 1805th positions from the 5' end are the Cre sequence; the 1806th to 1871th positions from the 5' end are the P2A linker sequence; the 1872th to 2579th positions from the 5' end are the mCherry sequence; the 2580th to 2645th positions from the 5' end are the P2A linker sequence; and the 2646th to 3399th positions from the 5' end are the 3' homology arm sequence. It was synthesized and provided by GenScript Biotech Co., Ltd.

[0023] 3. Microinjection Founder mice with C1qc-CreChy gene knock-in were obtained by microinjection: Cas9 mRNA, sgRNA and recombinant template DNA were mixed to make the final concentrations: sgRNA (50 ng / µL), Cas9 mRNA (50 ng / µL), template DNA (10 ng / µL); then they were injected into the pronucleus of mouse fertilized egg cells through the microinjection operating system. sgRNA will guide Cas9 protein to cut the double-stranded DNA at the target site, forming a double-stranded DNA break. In the presence of homologous recombination template DNA, the body will use its own HDR repair mechanism to repair the broken DNA double-strands, thereby inserting the exogenous DNA sequence into the target site; the surviving fertilized egg cells were transplanted into the oviduct of pseudo-pregnant mice, and founder mice were obtained 20 days later.

[0024] 4. Sequencing verification of C1qc-CreChy gene knock-in mice After the founder mice are separated into cages, obtain the genomic DNA of the founder mice in step 3 and use primers to perform PCR amplification on the target sequence.

[0025] The primer sequences used for PCR are as follows: F: ATGGATGTTTCTAGACTAAGGCCC (shown in SEQ ID NO.3); R: GAAAGCACCCACACTCATAAAGG (shown in SEQ ID NO. 4).

[0026] The PCR system was as follows: 0.2 μL each of F and R primers, 5 μL of 2× Phusion Flash II DNA polymerase (ThermoFisher Scientific: F548S), 1 μL of genomic DNA, and H O added to a total volume of 10 μL.

[0027] The PCR reaction program was as follows: pre-denaturation at 98°C for 10 sec; denaturation at 98°C for 10 sec, annealing at 60°C for 30 sec, extension at 72°C for 60 sec, 35 cycles; termination reaction at 72°C for 10 min.

[0028] The target amplification band size was 3545 bp. The PCR products with the target amplification band were sent for sequencing (Wuhan Jinkairui Bioengineering Co., Ltd.), and the individuals with the correct insertion of the target sequence were selected, which were the C1qc-CreChy gene knock-in model mice. The sequencing results showed that the target insertion sequence was completely correct, and the insertion site was completely consistent with the designed site (such as Figure 2 As shown in the figure, it was shown that the above method successfully constructed the C1qc-CreChy gene knock-in mouse model.

[0029] Example 2 Detection of mCherry expression in the spleen of C1qc-CreChy gene knock-in mice In this example, the C1qc-CreChy knock-in mouse constructed in Example 1 was used as the research object, spleen tissue was obtained by dissection, single cell suspension was obtained, immune cells were labeled with specific antibodies, and then the mCherry expression levels in different cells were detected by flow cytometry, which specifically included the following steps: The C1qc-CreChy knock-in mouse constructed in Example 1 was taken and dissected to obtain spleen tissue, which was fully ground and then filtered using a 70 μm pore size filter to obtain a spleen cell single cell suspension.

[0030] Count, take 1 million spleen cells, add 100 μL antibody mixture (antibodies include: anti-CD45 APC-eFluor780, anti-CD5 eFlour450, anti-CD19PerCP-Cy5.5, anti-Ly6G Alexa700, anti-CD115 Super Bright 600, anti-F4 / 80 PE-Cy7, anti-CD11b FITC), mix well, incubate on ice in the dark for 30 minutes; then add 1000 μL FACS buffer (containing 2mM EDTA) to wash the cells once; finally, resuspend the cells in FACS buffer containing sytox blue. Data were collected by flow cytometer Attune (ThermoFisher Scientific, USA), and further analyzed by Flowjo 10.0 software.

[0031] Specific test results such as Figure 3 As shown, CD19 + For B cells, Ly6G + Neutrophils, CD11b + CD115 + Monocytes, CD11b - F4 / 80 + Macrophages (Macrophage) Figure 3 A). The results showed that the expression of mCherry could not be detected in B cells, neutrophils, monocytes and macrophages in the spleen of wild-type mice; the expression of mCherry could not be detected in B cells, neutrophils and monocytes in the spleen of C1qc-CreChy gene knock-in mice, but mCherry was detected in macrophages with a high expression level ( Figure 3 B).

[0032] Example 3 Detection of mCherry expression in the brain of C1qc-CreChy gene knock-in mice In this example, the C1qc-CreChy knock-in mouse constructed in Example 1 was used as the research object, and brain tissue was obtained by dissecting it, obtaining a single cell suspension of immune cells, using specific antibodies to label the immune cells, and then using flow cytometry to detect the expression of mCherry in different cell populations, which specifically includes the following steps: The C1qc-CreChy knock-in mouse constructed in Example 1 was taken and dissected to obtain brain tissue, which was placed in a digestion solution containing collagenase IV and DNase-I, and then fully ground using gentleMACS. The sample was placed in a shaker at 37°C, 200RPM, for 15 min. After digestion, the cells were subjected to gradient density centrifugation using percoll, the cells in the middle white film layer were retained, and the cells were filtered using a 70 μm pore size filter to obtain a single cell suspension of brain immune cells.

[0033] Count, take 200,000 cells, add 100 μL antibody mixture (antibodies include: anti-CD45 APC-eFluor780, anti-Ly6C eFlour450, anti-F4 / 80 PE-Cy7 and anti-CD11b APC), mix well, incubate on ice and away from light for 30 minutes; then add 1000 μL FACS buffer (containing 2mM EDTA) to wash the cells once; finally, resuspend the cells in FACS buffer containing sytox blue. Data were collected by flow cytometer Attune (ThermoFisherScientific, USA), and further analyzed by Flowjo 10.0 software.

[0034] Specific test results such as Figure 4 As shown, CD45 expresses CD11b - F4 / 80 + Ly6C - The results showed that the expression of mCherry could not be detected in the microglia in the brains of wild-type mice, while the expression level of mCherry could be detected in the microglia in the brains of C1qc-CreChy knock-in mice.

[0035] Finally, it is noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for constructing a macrophage-specific fluorescent reporter mouse model, characterized in that: The following steps are involved: Through CRISPR / Cas9 genome editing technology, the Cre-P2A-mCherry element was site-specifically inserted into the mouse C1qc gene locus to obtain a macrophage-specific fluorescent reporter mouse model.

2. The method for constructing a macrophage-specific fluorescent reporter mouse model according to claim 1, characterized in that: The target sequence of the mouse C1qc gene locus is: C1qc-sgRNA: 5′-TGGGTCCAACGACCATCCTGAGG-3′ (shown in SEQ ID NO. 1).

3. The method for constructing a macrophage-specific fluorescent reporter mouse model according to claim 1 or 2, characterized in that: The Cre-P2A-mCherry element further includes a 5' homology arm sequence and a 3' homology arm sequence.

4. The method for constructing a macrophage-specific fluorescent reporter mouse model according to claim 3, characterized in that: The nucleotide sequence of the Cre-P2A-mCherry element is shown in SEQ ID NO.

2.

5. The method for constructing a macrophage-specific fluorescent reporter mouse model according to claim 4, characterized in that: During site-specific insertion, Cas9 mRNA, sgRNA and Cre-P2A-mCherry element DNA were mixed and injected into mouse fertilized eggs, and the surviving fertilized egg cells were further transplanted into the fallopian tubes of pseudopregnant mice to obtain Founder mice.

6. The method for constructing a macrophage-specific fluorescent reporter mouse model according to claim 5, characterized in that: The construction method includes performing genotype detection on founder mice, screening out mouse individuals in which the Cre-P2A-mCherry element sequence is inserted in the genome and the insertion site is correct, and obtaining a macrophage-specific fluorescent reporter mouse model.

Images