Myo6 gene enhancer and application thereof

Abstract

The invention discloses a Myo6 gene enhancer and application thereof, and belongs to the field of gene engineering. The Myo6 gene enhancer can drive the expression capacity of a reporter gene EGFP or Myo6 gene in the inner ear to be obviously enhanced, can be used for biological materials such as recombinant DNA, vectors or adenoviruses and the like, promotes the expression of the Myo6 gene or other genes in the inner ear so as to carry out gene expression regulation and control research, and is expected to be used for gene therapy of deafness.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering, and in particular to a Myo6 gene enhancer and a use thereof. Background Art

[0002] Enhancers are typical cis-regulatory elements in the genome, located upstream, downstream or within the gene transcription start point, and can be far away from or even span hundreds of thousands of base pairs. The core function of enhancers is to enhance the transcriptional activity of target genes by binding to proteins such as transcription factors. They play a key role in the spatiotemporal regulation of gene expression, that is, expressing specific genes at a specific time and space to ensure the normal cell differentiation, organ development and physiological functions. During development, different cell types need to express different genes, and enhancers can precisely regulate the spatiotemporal expression of these genes. The characteristics of enhancers make them have potential application value in cell and gene therapy, and are also conducive to the application research of gene expression regulation.

[0003] The MYO6 gene is located on human chromosome 6 (6q21) and encodes myosin 6 (MYO6), which is a non-traditional myosin with a single head structure. It plays a key role in the transport of organelles (such as endogenous vesicles, endosomes, etc.), the maintenance of cell polarity, and the morphological remodeling of cells. Its mutation or deletion can lead to dysfunction and cell death of hair cells, and then lead to autosomal recessive non-syndromic deafness. Specific general missense mutations may lead to partial loss of MYO6 protein function, usually manifested as mild to moderate deafness; while nonsense mutations or deletions may lead to complete loss of protein function, usually associated with severe or profound deafness. For deafness caused by MYO6 gene mutations, the normal function of the gene can be restored by gene replacement or gene repair to restore hearing.

[0004] In addition to hair cells, the MYO6 gene is also expressed in other cell types. Using only hair cell or neuron-specific enhancers to regulate gene expression cannot meet the requirements of gene therapy for MYO6 genetic defects. The enhancer in the Myo6 gene can regulate the activation of the gene in a specific developmental stage or cell type to ensure that the gene is expressed at the right time and place to avoid its non-specific expression causing harm to the host. However, there has been no relevant research on the Myo6 gene enhancer. Summary of the invention

[0005] In order to solve the above problems, the present invention provides a Myo6 gene enhancer, the nucleotide sequence of the enhancer is shown in SEQ ID No.1.

[0006] The present invention also provides a recombinant vector, which is a plasmid containing an enhancer and a target gene as shown in the nucleotide sequence of SEQ ID No. 1.

[0007] Furthermore, the target gene includes Myo6 gene and / or reporter gene EGFP.

[0008] Furthermore, the plasmid includes a pWHERE vector plasmid vector.

[0009] The present invention also provides the aforementioned enhancer and the use of the aforementioned recombinant vector in preparing a reagent for promoting the specific expression of a target gene in inner and outer hair cells of the cochlea.

[0010] Furthermore, the target gene includes Myo6 gene and / or reporter gene EGFP.

[0011] The present invention also provides the aforementioned enhancer and the use of the aforementioned recombinant vector in preparing a medicine for treating deafness.

[0012] The present invention also provides a method for promoting the specific expression of a target gene in inner and outer hair cells of the cochlea for non-therapeutic purposes, comprising introducing the aforementioned enhancer or the aforementioned recombinant vector into an organism.

[0013] Furthermore, it includes injecting the aforementioned recombinant vector into animal fertilized eggs.

[0014] Finally, the present invention provides an application of the transgenic animal obtained by the above method in the study of gene expression regulation.

[0015] The present invention uses a mouse microinjection system to verify that the nucleotide sequence SEQ ID No. 1 can enhance the expression of the target gene, and at the same time, through genomic positioning analysis, it is an enhancer that is one of the regulatory elements of the Myo6 gene itself. The enhancer can significantly enhance the expression activity of the EGFP gene in the inner ear, and the ability to drive the expression of the reporter gene EGFP or the Myo6 gene in the inner ear is significantly enhanced. It can be used in biological materials such as recombinant DNA, vectors or adenoviruses to promote the expression of the Myo6 gene itself or other genes in the inner ear, so as to conduct research on gene expression regulation, and is also expected to be used for gene therapy of deafness.

[0016] Obviously, according to the above contents of the present invention, in accordance with common technical knowledge and customary means in the art, without departing from the above basic technical ideas of the present invention, other various forms of modification, replacement or change may be made.

[0017] The above contents of the present invention are further described in detail below through specific implementation methods in the form of embodiments. However, this should not be understood as the scope of the above subject matter of the present invention being limited to the following examples. All technologies realized based on the above contents of the present invention belong to the scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 Plasmid map after Myo6 enhancer and EGFP were cloned into pWHERE plasmid;

[0019] Figure 2 Comparison of fluorescence effects in the mouse inner ear when using different enhancers; A: Fluorescence signal of empty vector-EGFP in the mouse cochlea; B: Fluorescence signal of Myo6 gene enhancer-EGFP in the mouse cochlea, whose fluorescence signal is mainly expressed in hair cells and also in neuronal cells. This expression pattern is similar to the expression characteristics of endogenous Myo6 (top: whole inner ear cochlear basilar membrane; middle: magnified view; bottom: side view). DETAILED DESCRIPTION

[0020] The raw materials, reagents and equipment used in the specific embodiments of the present invention are all known products and can be purchased commercially.

[0021] Example 1 Cloning and activity analysis of Myo6 gene enhancer sequence

[0022] 1. Acquisition and localization of Myo6 gene enhancers

[0023] The Myo6 gene (NCBI accession number is LOCUS NC_000075) is mainly expressed in animal hair cells and also in neuronal cells. For this reason, the physical and functional units of the Myo6 gene were studied and analyzed in the early stage, and an enhancer that drives and enhances the expression of the Myo6 gene specifically in the inner ear was found. Its nucleotide sequence is SEQ ID No.1:

[0024] ACCAAGGAAATGAATTCTCCTAATCCTTTAATCTCTCCCCCTTTTATGAAATAGTGCCTTAAAAATTTGGGTAGATCAGGTCGTTACTCGTTTCACATACAAGGTTATACTTGGATAGTATCGCTTCCACATGGTGACGAAGGCACCACTTTTGTATGGCTCAGTCACATCT CAGCAGACCTGCAGAATACGATCCTCTCAGGACTCAAGGCTGCCGGAGCTGCGCTGCCACTGGTAAGGTTAGAGTCTGCTTAGTAACTGGGCCCCAGTTCTTTTGTGTCTAGTAACAGGTGTGGGAGAAAGCACAGGTCACTCCTGGGTCTCCGGAGCACATACACAAGGTGC TGCTGCATTGGCTCCTGTGTGGGGTGCTGGGCTGGCCCTTGTCCCTGGGTGCTTTGTGTGAGGCGAGCTGGCAGATGGCCAGATTGGAAATATACTCTCTCAGGTTGCAAAGGTATCTGGGCTTGTCTGAGGGCGGCGTATGGGATAACAGCACCCACGGGCTTGCTGGCTGA AAGATTAGTCTCCGTCCCTGAGAGTCTACTGCTTCTCCATTGACAGTCGGCAAGCAGGCTGCCAGAGAAAGGTCCGGATATTTGTAAACCTTCACAGAATCCTTACCTTTCCCAGTGAGGCCACTCAAATCTTGAGCTTCTCGGCAAGGTTTGATGCCATGTCATTGTTACT

[0025] According to genomic positioning, the enhancer shown in SEQ ID No. 1 is located in the intron of the Myo6 gene, and it is determined that the enhancer is the Myo6 gene enhancer.

[0026] 2. Validation of enhanced target gene expression

[0027] 1. Methods

[0028] (1) The Hsp68 promoter sequence (vector PCR4-Hsp68::lacZ-H11 from Addgene, Plasmid #139099) was cloned upstream of the reporter gene EGFP, and the activity of the enhancer was tested by detecting the expression of the EGFP gene. The pWHERE vector, EGFP gene, and Hsp68 promoter sequence were connected by Qingke Biotechnology Company, and the successfully connected vector was named pWHERE-promoter vector.

[0029] The nucleotide sequence of the reporter gene EGFP (SEQ ID No.2) is: ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGG CCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACAC CCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCG CCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAA

[0030] (2) DNA was extracted from the inner ear tissue of mice and the Myo6 gene enhancer sequence (shown in SEQ ID No. 1) was amplified.

[0031] The primer pairs used for PCR amplification of the Myo6 gene enhancer region are as follows:

[0032] Myo6-F:5'-CGCGGATCCACCAAGGAAATGAATTCTCC-3'(SEQ ID No.3)Myo6-R:5'-CCGCTCGAGAGTAACAATGACATGGCATC-3'(SEQ ID No.4)

[0033] (3) The enhancer sequence was transferred into the pWHERE-promoter vector using the BamHI and XhoI restriction sites. The constructed plasmid is shown in Figure 1 .

[0034] (4) Preparation of linearized transgenic DNA: Use restriction endonuclease PacI to cut the plasmid to linearize the exogenous DNA from the vector, and then purify the exogenous DNA to remove impurities and enzymes. Finally, dissolve the purified DNA in TE buffer and adjust the concentration to 1-2 ng / μL, and store at 4°C for future use.

[0035] (5) Obtaining mouse fertilized eggs: Select healthy, age-appropriate female mice (usually 3-4 weeks old) and treat them with superovulation. 12-14 hours after superovulation, mate these female mice with healthy, sexually mature male mice. The next morning, dissect the female mice and collect the fertilized eggs in their oviducts.

[0036] (6) Microinjection of exogenous DNA: The collected fertilized eggs are placed in a culture medium containing HEPES buffer, and the DNA solution is directly injected into the fertilized eggs using a microinjection needle. After the injection is completed, the fertilized eggs are transferred to a culture dish containing an appropriate culture medium and continue to incubate. They are implanted into the oviduct of a pseudopregnant mouse, usually 10-20 fertilized eggs are implanted into each mouse. After the transplantation is completed, the mouse is raised alone and its pregnancy status is observed. At the same time, a control is set up, that is, exogenous DNA linearized with the pWHERE-promoter vector without the Myo6 gene enhancer sequence is microinjected in the same way as a control.

[0037] (7) Identification of transgenic mice: After successful embryo transfer, wait for the required period to take out the mouse embryo for testing. Cut off the head of the mouse embryo, open the skull, remove the brain tissue, expose the temporal bone and remove the cochlea. After the cochlea is removed, move it into a culture dish containing pre-cooled 1XPBS; under a dissecting microscope, use a sharp needle to pick up the bone wall of the volute at the apex of the cochlea, and then peel the volute along the gap between the spiral ligament and the volute until the complete spiral ligament is fully exposed; then use a sharp needle or tweezers to separate and remove the entire spiral ligament, and immediately transfer it to a 2ml centrifuge tube containing 4% paraformaldehyde and fix it at 4℃ for 30 minutes. After 30 minutes, remove the spiral ligament under a dissecting microscope, and lay the entire cochlear basement membrane flat on a slide, add DAPI and seal the slide. Finally, under a fluorescence microscope, select the DAPI fluorescence channel to observe the nuclear signal of the basement membrane, the 488nm laser excitation channel to observe the EGFP signal, and take pictures of the entire complete basement membrane, the top, middle and base of the local basement membrane.

[0038] 2. Results

[0039] Figure 2 It can be seen that in the embryos injected with the Myo6 gene enhancer-EGFP, the inner and outer hair cells of the cochlea showed green fluorescence, and it was also expressed in neuronal cells, indicating that the Myo6 enhancer can enhance the specific expression of the EGFP gene in the inner and outer hair cells ( Figure 2 B), this expression pattern is similar to the expression characteristics of endogenous Myo6; in embryos injected with exogenous genes without the Myo6 gene enhancer sequence, there is no fluorescent signal in the inner and outer hair cells of the cochlea ( Figure 2 A), indicating that the exogenous gene EGFP cannot be specifically expressed in inner and outer hair cells without the effect of the Myo6 gene enhancer. The Myo6 gene enhancer is used to enhance the expression characteristics of the EGFP gene, which is consistent with the expression characteristics of Myo6 in existing literature, further verifying that the enhancer is the Myo6 gene enhancer.

[0040] In summary, the present invention has confirmed through a mouse microinjection system experiment that the nucleotide sequence SEQ ID No. 1 can enhance the expression of the target gene, and through positioning analysis, it is an enhancer of one of the regulatory elements of the Myo6 gene itself. The enhancer can significantly enhance the expression activity of the EGFP gene in the inner ear, can drive the reporter gene EGFP or Myo6 gene to significantly enhance its expression ability in the inner ear, can be used in biological materials such as recombinant DNA, vectors or adenoviruses, promote the transcription of the EGFP gene or other genes in the inner ear, so as to conduct gene expression regulation research, and is expected to be used for the treatment of deafness.

Claims

1. A Myo6 gene enhancer, characterized in that: The nucleotide sequence of the enhancer is shown in SEQ ID No.

1.

2. A recombinant vector, characterized in that: It is a plasmid containing an enhancer and a target gene as shown in the nucleotide sequence of SEQ ID No.

1.

3. The recombinant vector according to claim 2, characterized in that: The target gene includes Myo6 gene and / or reporter gene EGFP.

4. The recombinant vector according to claim 2 or 3, characterized in that: The plasmid includes a pWHERE vector plasmid vector.

5. Use of the enhancer according to claim 1 and the recombinant vector according to any one of claims 2 to 4 in the preparation of an agent for promoting the specific expression of a target gene in inner and outer hair cells of the cochlea.

6. The use according to claim 5, characterized in that: The target gene includes Myo6 gene and / or reporter gene EGFP.

7. Use of the enhancer according to claim 1 and the recombinant vector according to any one of claims 2 to 4 in the preparation of a drug for treating deafness.

8. A method for promoting the specific expression of a target gene in inner and outer hair cells of the cochlea for non-therapeutic purposes, characterized in that: The method comprises introducing the enhancer according to claim 1 or the recombinant vector according to any one of claims 2 to 4 into an organism.

9. The method according to claim 8, characterized in that: The method comprises injecting the recombinant vector according to any one of claims 2 to 4 into an animal fertilized egg.

10. Use of the transgenic animal obtained by the method of claim 8 or 9 in research on gene expression regulation.

Images