Application of genes NGR1 and / or NGR2 in regulating lateral root growth against gravity
By knocking out the soybean NGR1 and/or NGR2 genes through CRISPR/Cas9 technology, shallow-rooted soybeans were formed, which solved the problem of poor growth of soybeans in acidic and low-phosphorus soils, achieved efficient phosphorus absorption and a balance between water and nutrients, and provided a new soybean root variation resource and a theoretical basis for molecular design breeding.
Patent Information
- Application Number
- CN202411627408.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-14
- Publication Date
- 2025-10-03
- Estimated Expiration
- 2044-11-14
AI Technical Summary
In the existing technology, soybeans grow poorly in acidic, low-phosphorus soils, and it is difficult to balance the absorption of shallow phosphorus with the absorption of water and nutrients in deep soil layers. The functions of NGR1 and NGR2 genes in soybean roots are not fully utilized.
The soybean genes NGR1 and/or NGR2 were knocked out using CRISPR/Cas9 technology, resulting in functional loss, promoting the anti-gravity growth of lateral roots and the downward growth of the main root, forming a shallow root system. The CRISPR-P2.0 tool was used to design gene editing targets, construct CRISPR/Cas9 editing vectors, and obtain mutant materials.
The mutant material significantly improves the phosphorus absorption efficiency in a growth environment that simulates the phosphorus content distribution in the natural environment, achieving efficient absorption of shallow phosphorus and deep water and nutrients, and is suitable for the breeding of shallow-root phosphorus-efficient soybean varieties.
Smart Images

Figure CN119193621B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of plant genetic engineering, and in particular relates to the application of genes NGR1 and / or NGR2 in regulating the anti-gravity growth of lateral roots. Background Art
[0002] Soybeans are an important grain and oil crop cultivated by our ancestors, with a history of over 5,000 years of cultivation and consumption in my country. However, my country's current soybean self-sufficiency rate is seriously insufficient.
[0003] Acidic, low-phosphorus soils are prevalent in South China, but these conditions are detrimental to soybean growth. Phosphorus in soils exists in two main forms: total phosphorus and available phosphorus. Total phosphorus refers to all phosphorus in the soil, including both organic and inorganic phosphorus, not all of which can be absorbed and utilized by plants. Available phosphorus refers to phosphorus that can be absorbed and utilized by plants, including inorganic phosphorus and a small amount of organic phosphorus. In soil, phosphorus tends to be distributed more in the surface layer. Therefore, based on the distribution of phosphorus in soil and leveraging current genetic knowledge related to plant root responses and root architecture, we are manipulating the key factors that control root gravity responses and root architecture in soybeans. This will allow us to create a shallow-rooted soybean that balances shallow phosphorus uptake with water and nutrient absorption from deeper soil layers. This will not only establish a new soybean root variation resource but also provide theoretical guidance and a practical foundation for molecular design breeding of phosphorus-efficient soybeans.
[0004] The paper "Negative gravitropism in plant roots" reports that knocking out the Arabidopsis thaliana genes AtNGR1, AtNGR2, and AtNGR3 individually does not alter the root system. However, knocking out all three genes together results in a root system that exhibits an anti-gravity growth phenotype. Therefore, AtNGR1, AtNGR2, and AtNGR3, as Arabidopsis root growth regulatory genes, are functionally redundant in Arabidopsis. Soybeans have four copies of the NGR gene, and the functions of these four genes in soybean roots have not yet been reported. Therefore, exploring whether they can be used to create a soybean that balances shallow phosphorus absorption with water and nutrient absorption in deeper soil layers is of great significance. Summary of the Invention
[0005] The purpose of the present invention is to overcome the above-mentioned defects and deficiencies in the prior art and to provide the application of soybean genes NGR1 and / or NGR2 in regulating the anti-gravity growth of soybean lateral roots.
[0006] The second object of the present invention is to provide the use of soybean genes NGR1 and / or NGR2 in cultivating shallow-rooted soybeans with lateral roots growing against gravity.
[0007] The third object of the present invention is to provide an application of an agent for knocking out the soybean genes NGR1 and / or NGR2 in cultivating shallow-rooted soybeans with lateral roots growing against gravity.
[0008] The fourth object of the present invention is to provide a method for creating shallow-root soybeans.
[0009] The above-mentioned object of the present invention is achieved through the following technical solutions:
[0010] The present invention selected NGR1 and NGR2 from the four soybean NGR genes, designed gene editing knockout targets for NGR1 (Glyma.07G040800) and NGR2 (Glyma.16G009400) in soybean using the online CRISPR-P2.0 tool (http: / / cbi.hzau.edu.cn / crispr / ), constructed a CRISPR / Cas9 editing vector, and performed genotypic identification and phenotypic observation on the obtained mutant materials. It was found that the functional loss of NGR1 and / or NGR2 causes the lateral roots in the soybean root system to grow against gravity, but the main root continues to grow downward, and the roots are largely distributed in the shallow layer, resulting in shallow-rooted soybeans.
[0011] Therefore, the present invention provides the use of soybean genes NGR1 and / or NGR2 in regulating the anti-gravity growth of soybean lateral roots. The nucleotide sequence of NGR1 is shown in SEQ ID No. 1; the nucleotide sequence of NGR2 is shown in SEQ ID No. 2.
[0012] The present invention also provides the use of soybean genes NGR1 and / or NGR2 in cultivating shallow-rooted soybeans with lateral roots growing against gravity. The nucleotide sequence of NGR1 is shown in SEQ ID No. 1; the nucleotide sequence of NGR2 is shown in SEQ ID No. 2.
[0013] Furthermore, it is specifically used in cultivating shallow-root soybeans with main roots growing downward and lateral roots growing upward, and with a large number of roots distributed in the shallow layer of soil.
[0014] Furthermore, the shallow-rooted soybeans can take into account both the absorption of phosphorus in the shallow soil and the absorption of water and nutrients in the deep soil.
[0015] The present invention also provides the use of a reagent for knocking out soybean genes NGR1 and / or NGR2 in cultivating shallow-rooted soybeans with lateral roots growing against gravity. The nucleotide sequence of NGR1 is shown in SEQ ID No. 1; the nucleotide sequence of NGR2 is shown in SEQ ID No. 2.
[0016] Because in the soil, phosphorus tends to be distributed in the surface layer of the soil, and the phosphorus content in the 0-20 cm soil layer is several times higher than that in the 20-40 and 40-60 cm soil layers. Based on the distribution of phosphorus in the soil, using the current genetic knowledge system related to plant root response and root architecture determination, manipulating the key factors NGR1 and NGR2 that control root gravity response and root architecture in soybeans, it is of great significance to create a soybean that takes into account both shallow phosphorus absorption and water and nutrient absorption in deep soil. The present invention measured and found that there was no significant difference in phosphorus absorption efficiency of NGR1 and / or NGR2 mutant materials in low phosphorus (-P) and normal phosphorus (+P) environments, but in a growth environment that simulates the phosphorus content distribution in the natural environment (+P / -P), the mutant material had a significantly higher phosphorus absorption efficiency than the wild type (Young), indicating that the mutant material can efficiently absorb phosphorus in a growth environment that simulates the phosphorus content distribution in the natural environment.
[0017] Therefore, the present invention provides a method for creating shallow-root soybeans, which comprises knocking out the NGR1 and / or NGR2 genes in soybeans to obtain mutant materials with functional loss of the target genes.
[0018] Furthermore, the knockout method is to perform gene editing on the conserved domains of soybean genes NGR1 and / or NGR2 using CRISPR / Cas9 technology, so that the target gene mutates, resulting in premature termination of protein translation, and obtaining a mutant material with loss of target gene function.
[0019] Furthermore, the knockout target of the NGR1 conserved domain is sgRNA1 and / or sgRNA2; the nucleotide sequences of sgRNA1 and sgRNA2 are shown in SEQ ID No. 3 to 4.
[0020] Furthermore, the knockout target of the NGR2 conserved domain is sgRNA3 and / or sgRNA4; the nucleotide sequences of sgRNA3 and sgRNA4 are shown in SEQ ID No. 5 to 6.
[0021] Preferably, the sequences of the knockout target sgRNA1 and sgRNA2 amplification primers are shown as SEQ ID No. 7 to 10.
[0022] Preferably, the sequences of the knockout target sgRNA3 and sgRNA4 amplification primers are shown as SEQ ID Nos. 11 to 14.
[0023] More specifically, the following steps are included:
[0024] 1) Synthesizing target gene fragments of soybean NGR1 and / or NGR2, connecting the target gene fragments to a CRISPR / Cas9 vector, constructing a recombinant plasmid containing the target gene fragments, and transforming Agrobacterium to obtain Agrobacterium containing the recombinant plasmid containing the target gene fragments;
[0025] 2) Infecting soybean explants with the Agrobacterium solution containing the recombinant vector in step 1), and after continuous breeding, screening for strains that do not contain Cas9 protein and whose NGR1 and / or NGR2 genes have been successfully edited and are homozygous, to obtain homozygous transgenic strains.
[0026] The results of this study show that knocking out either NGR1 or NGR2 alone, or both, affects soybean lateral root growth, resulting in plants with lateral roots growing against gravity and taproots growing downward. These plants are also able to efficiently absorb phosphorus in a growth environment that mimics the natural distribution of phosphorus, demonstrating an ideal root architecture. Therefore, this method can be used to breed soybean varieties with shallow roots and efficient phosphorus absorption.
[0027] Compared with the prior art, the present invention has the following beneficial effects:
[0028] The present invention discloses the use of soybean genes NGR1 and / or NGR2 in regulating the anti-gravity growth of soybean lateral roots. The present invention utilizes gene editing technology to knock out the NGR1 and / or NGR2 genes in soybeans. The resulting mutant material exhibits lateral roots that can grow against gravity while the main root continues to grow downward. Furthermore, in a growth environment that simulates the phosphorus content distribution in the natural environment, the mutant material exhibits a phosphorus absorption efficiency that is greater than that of the wild type. Therefore, the present invention provides a method for regulating the anti-gravity growth of soybean lateral roots through the soybean genes NGR1 and / or NGR2, thereby promoting the rapid absorption of phosphorus from shallow soil by the soybean root system. This provides a new approach for the breeding of shallow-root, phosphorus-efficient soybean varieties. BRIEF DESCRIPTION OF THE DRAWINGS
[0029] Figure 1 Schematic diagram of the NGR1 and NGR2 target sites. Note: The sgRNA target sequence is underlined in black. The PAM sequence is highlighted in red.
[0030] Figure 2 Schematic diagram of the CRISPR-Cas9 vector structure of NGR1 and NGR2 genes.
[0031] Figure 3 It is the soybean genetic transformation step and PCR identification of positive lines and herbicide resistance screening. Figure 3Figure a represents the genetic transformation process of the soybean cotyledonary node; b represents the results of screening for herbicide resistance in the T2 generation transgenic lines. Four transgenic lines were obtained in the figure and were not resistant to herbicides; c represents PCR identification of the T2 transgenic lines. M is a 100 bp DNA ladder, and the sizes are as indicated. Lanes 1 to 11 represent the PCR identification results of the NGR1 gene of different transgenic lines, and lanes 12 to 22 represent the PCR identification results of the NGR2 gene of different transgenic lines.
[0032] Figure 4 The target site mutation types are shown for one ngr1 single knockout mutant line, one ngr2 single knockout mutant line, and one ngr1 / 2 double knockout mutant line. Note: The WT sequence is shown at the top of the figure, with the red short dashed line indicating the deletion. Sequencing peaks are shown.
[0033] Figure 5 The root phenotype and lateral root angle of the NGR gene knockout mutant. Figure 5 Figure (a) shows the root phenotype of the wild type (Young, left) and ngr1, ngr2, and ngr1 / 2 mutants (right) after approximately 15 days of growth in a rhizotron chamber filled with substrate. The seeds were placed in the chamber at a 30° angle with the surface facing downward. Scale bar, 5 cm. Figure (b) shows the root phenotype of the wild type (Young, left) and ngr1, ngr2, and ngr1 / 2 mutants (right) after approximately 15 days of growth in the rhizotron chamber filled with substrate. Scale bar, 5 cm. Figure (c) shows the lateral root angles of the wild type (Young, left) and ngr1, ngr2, and ngr1 / 2 mutants (right). Vertically downward is defined as 0°. n represents the number of samples. Student's t-test was used for analysis. **** indicates significant differences (P < 0.0001) between samples.
[0034] Figure 6Diagram showing the experimental design for planting wild-type and mutant materials under different phosphorus treatments. Note: The first row in the figure represents the low-phosphorus treatment. The soil used was a 3:1 mixture of low-phosphorus red soil and coconut coir. A 13 cm layer of low-phosphorus soil was placed at the bottom, a 2 cm layer of perlite was placed in the middle, and a 5 cm layer of low-phosphorus soil was placed on top. The second row represents the stratified phosphorus treatment. A 13 cm layer of low-phosphorus soil was placed at the bottom, a 2 cm layer of perlite was placed in the middle as a buffer layer to prevent the infiltration of the phosphorus-containing Hoagland nutrient solution, and a 5 cm layer of normal-phosphorus soil (low-phosphorus red soil supplemented with 1 mM potassium dihydrogen phosphate solution) was placed on top to simulate the phosphorus stratification of soils in the natural environment. The third row represents the normal-phosphorus treatment, which used low-phosphorus red soil drenched with the phosphorus-containing Hoagland nutrient solution. Similarly, a 13 cm layer of low-phosphorus red soil drenched with the phosphorus-containing Hoagland nutrient solution was placed at the bottom, a 2 cm layer of perlite was placed in the middle, and a 5 cm layer of low-phosphorus red soil drenched with the phosphorus-containing Hoagland nutrient solution was placed on top. Each pot was divided into two chambers, with the wild type (Young) planted in the left chamber and the mutants ngr1, ngr2 and ngr1 / 2 planted in the right chamber. Twenty plants were planted in each line for 30 days.
[0035] Figure 7 The phosphorus content of mutant materials under different phosphorus treatments. Note: In the figure, WT represents the wild type (Young), ngr1, ngr2, and ngr1 / 2 represent mutant materials. Plants were collected 30 days after planting in low-phosphorus red soil (-P), stratified phosphorus red soil (+P / -P), and normal phosphorus soil (+P) for phosphorus content determination. The data in the figure are 3 replicates ± standard error. One-way analysis of variance was used. ns indicates no significant difference between samples (P>0.05), * indicates significant difference between samples (P<0.05), *** indicates significant difference between samples (P<0.001), and **** indicates significant difference between samples (P<0.0001). DETAILED DESCRIPTION
[0036] The present invention will be further described below with reference to the accompanying drawings and specific examples, but the examples do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.
[0037] Unless otherwise specified, the reagents and materials used in the following examples were commercially available.
[0038] Example 1 CRISPR / Cas9 vector construction
[0039] 1. Gene editing knockout targets for NGR in soybean were designed using the online CRISPR-P 2.0 tool (http: / / cbi.hzau.edu.cn / crispr / ). Two target sites, sgRNA1 and sgRNA2, were designed for the NGR1 (Glyma.07G040800) gene (nucleotide sequence as shown in SEQ ID No. 1), located in the third exon region. Two target sites, sgRNA3 and sgRNA4, were designed for the NGR2 (Glyma.16G009400) gene (nucleotide sequence as shown in SEQ ID No. 2), located in the third exon region (as shown in Figure 1 shown).
[0040] sgRNA1: 5'- AGACGACCAAAATACACAAG AGG-3'
[0041] sgRNA2: 5'- TAACTGCCCTTCAAGCTTGG AGG-3'
[0042] sgRNA3: 5'- GGATGACCAAAATACACAAG AGG-3'
[0043] sgRNA4: 5'- AGAGGATCCATCTTCTTCAG AGG-3'
[0044] (The underlined sequence is the 20 bp sgRNA).
[0045] 2. After the target is designed, it needs to be integrated into the vector. First, synthesize the target primers of NGR1 and NGR2 genes. The primer sequences are:
[0046] sgRNA1-F: 5'-GGATTGGACGACCAAAATACACAAG-3'
[0047] sgRNA1-R: 5'-AAACCTTGTGTATTTTGGTCGTCCA-3'
[0048] sgRNA2-F: 5'-GGATTGAACTGCCCTTCAAGCTTGG-3'
[0049] sgRNA2-R: 5'-AAACCCCAAGCTTGAAGGGCAGTTCA-3'
[0050] sgRNA3-F: 5'-GGATTGGATGACCAAAATACACAAG-3'
[0051] sgRNA3-R: 5'-AAACCTTGTGTATTTTGGTCATCCA-3'
[0052] sgRNA4-F: 5'-GGATTGGAGGATCCATCTTCTTCAG-3'
[0053] sgRNA4-R: 5'-AAACCTGAAGAAGATGGATCCTCCA-3'
[0054] To a 10 μL system, 1 μL each of sgRNA1-F and sgRNA1-R primers (primer concentration: 10 μM) were added, along with 8 μL of Anneal Buffer (TE + 50 mM NaCl). The mixture was annealed at 95°C, 0.1°C / s, and then annealed to 16°C. After annealing, the annealed product of sgRNA1 with blunt ends was obtained. The same procedures were followed for sgRNA2-F, sgRNA2-R, sgRNA3-F, sgRNA3-R, sgRNA4-F, and sgRNA4-R. Upon completion, the annealed products of the NGR1 target site with blunt ends, sgRNA1 and sgRNA2, and the annealed products of the NGR2 target site with blunt ends, sgRNA3 and sgRNA4, were obtained, respectively.
[0055] 3. Construction of CRISPR / Cas9 Editing Vector
[0056] 1) Use the restriction endonuclease BsaI-HF to digest the intermediate vectors PUC1, PUC3, PUC5, and PUC6, and recover the digested vectors PUC1, PUC3, PUC5, and PUC6.
[0057] 2) In a 20 μL system, add 10 μL of the annealed product of sgRNA1, 6 μL of ddH2O, 2 μL of 10× T4 buffer, 1 μL of the digested intermediate vector PUC1, and 1 μL of T4 ligase. Incubate the reaction at 25°C for 2 h. Ligate sgRNA2, sgRNA3, and sgRNA4 to the intermediate vectors PUC3, PUC5, and PUC6, respectively, following the above procedure.
[0058] 3) The ligation products of sgRNA1, sgRNA2, sgRNA3, and sgRNA4 were transformed into competent E. coli DH5α, respectively, and spread on LB+Amp solid medium. Single clones were picked and, after correct sequencing, plasmids sgRNA1, sgRNA2, sgRNA3, and sgRNA4 were extracted and the plasmid concentrations were tested.
[0059] 4. In a 20 μL system, add 100 ng each of plasmids sgRNA1, sgRNA2, sgRNA3, and sgRNA4, 50 ng of CRISPR / Cas9 vector pCas9 plasmid, 1 μL of 10×T4 ligation buffer, 0.4 μL of 50×oligo, 1 μL of AarI restriction endonuclease, and 1 μL of T4 ligase. Finally, add ddH2O to make up to 20 μL.
[0060] The PCR amplification reaction steps are as follows: 37°C for 5 min, 25°C for 10 min, 15 cycles; 50°C for 5 min; 80°C for 10 min; 16°C forever.
[0061] 5. The CRISPR / Cas9 ligation product was transformed into E. coli competent DH5α, spread on LB+Kan solid medium, picked a single clone, and after sequencing was correct, extracted the recombinant plasmid CRISPR / Cas9 and named Cas9-NGR1 / 2 (such as Figure 2 and then transformed into Agrobacterium competent cells AGL1.
[0062] Example 2 Soybean genetic transformation
[0063] The successfully constructed Cas9-NGR1 / 2 was transformed into soybean variety Young using Agrobacterium-mediated method. The specific steps are as follows (e.g. Figure 3 a):
[0064] 1. Seed disinfection
[0065] 1) Select young soybean seeds of the soybean variety that are free of pests, spots, and spots, have plump, uniform grains, and are dry. Place them in a 500 mL conical flask and rinse several times with deionized water. Then, fill the flask with deionized water to cover the soybeans. Place the flask on a horizontal shaker at 80 rpm and allow to swell overnight.
[0066] 2) After the soybeans in the conical flask have completely swelled, excess water is poured off, 15% sodium hypochlorite aqueous solution is added, the flask is sealed, and the flask is shaken on a horizontal shaker at 80 rpm for 10 minutes. The flask is then transferred to a laminar flow bench and the soybeans are rinsed with sterile water.
[0067] 2. Preparation of infection solution
[0068] 1) Cultivate Cas9-NGR1 / 2 Agrobacterium in 300 mL of LB liquid medium containing Kan and Rif at 28°C and 200 rpm on a shaker. When the bacterial solution OD600 nm = 0.6-0.8, divide the bacterial solution into 50 mL centrifuge tubes in a clean bench and centrifuge at 5000 rpm for 10 min to collect the bacteria. Discard the supernatant and divide 300 mL of the prepared co-culture infection liquid medium into 50 mL centrifuge tubes for collecting the bacteria. Resuspend the culture for later use.
[0069] 2) After cleaning the soybeans, use a scalpel to separate the two cotyledons along the dorsal seam of the soybeans in a laminar flow hood. Peel off the seed coat, retaining the cotyledon with the intact hypocotyl. Cut off a portion of the hypocotyl and gently score the connection between the hypocotyl and cotyledon 3-4 times with the tip of the scalpel. Transfer the cut soybean cotyledons to a 50 mL Erlenmeyer flask filled with sterile water.
[0070] 3) After all soybeans have been harvested, discard the sterile water from the 50mL Erlenmeyer flask. Pour the resuspended bacterial solution from the 50mL centrifuge tube into the 50mL Erlenmeyer flask, seal the flask with parafilm, and sonicate for 3 minutes, shaking the flask every 30 seconds. After sonication, wipe the flask dry and evacuate to -60 kPa. After standing under vacuum for 10 minutes, repeat the evacuation process. After evacuation, place the flask on a horizontal shaker at 80 rpm and inoculate for 30 minutes.
[0071] 4) Transfer the infected soybean cotyledons to a laminar flow hood, air dry, and then spread them flat on a co-cultivation solid medium covered with sterile filter paper with the cut surface (smooth side) facing upwards. Incubate in the dark at 21°C for 2 days.
[0072] 5) Two days later, transfer to 21°C, 16 hours light / 8 hours dark conditions and incubate until the cotyledons turn green. Then, transfer the explants to cluster shoot induction medium and incubate at 21°C, 16 hours light / 8 hours dark conditions for 15 days. After 15 days, remove the explants, remove new shoots, and partially cut off the cotyledons. Then, transfer the treated explants to selection medium containing the herbicide and continue incubation for 15 days.
[0073] 6) After 15 days of screening and induction, the explants produced a large number of adventitious buds. Remove the brown or yellow leaves and cut off some cotyledons. Transfer the treated explants to elongation medium and culture them at 21°C with 16 h light / 8 h dark for 15 days.
[0074] 7) When the clustered shoots have grown to approximately 5 cm in the elongation medium, they can be cut obliquely from the base of the shoots (the cut is an oblique surface). After soaking the stem base in a 1 mg / ml IBA solution for 1 minute, transfer the stem to a rooting medium and incubate at 21°C, 16 h light / 8 h dark for 7 days. After a large number of roots have grown from the stem base, transplant the plant into a pot. The resulting plant is the T0 generation transformed soybean.
[0075] Example 3 Identification of edited plants
[0076] 1. Screening T0 generation plants for herbicide resistance
[0077] Since the knockout vector contains the herbicide resistance marker gene Bar, herbicides can be used to screen positive plants containing the knockout vector.
[0078] 0.4% glyphosate herbicide was applied to the surface of a leaf of the T0 generation plant and marked. If the marked leaf did not turn yellow or wither after 4-5 days, it was determined to be a transgenic positive plant.
[0079] 2. Molecular Identification of T0 Edited Plants
[0080] DNA from leaves of T0 generation herbicide-resistant plants was used as a template for PCR detection, with wild-type soybean (Young) as a control.
[0081] PCR primers were designed near the target sites of the NGR1 and NGR2 genes, and PCR amplification and sequencing analysis were performed to identify the editing types of the T0 generation plants.
[0082] The primer sequences for amplifying the NGR1 gene were F: 5′-GATCTTGCAAAACAAGAGCCTAGA-3′ and R: 5′-GACTCTTGAAGGGTATCTCTTAGGCTA-3′.
[0083] The primer sequences for amplifying the NGR2 gene were F: 5′-GATTGGAACATTTGGAAACAAGACTGC-3′ and R: 5′-CTCTTGAAGGGTATCTCTAAGGCTT-3′.
[0084] PCR reaction system: 2× Rapid Taq Master Mix 12.5 μL, F 0.5 μL, R (10 μM) 0.5 μL, DNA 1 μL, ddH2O 11 μL, total volume 25 μL.
[0085] The PCR amplification reaction steps are as follows: 94°C for 30s; 98°C for 10s, 58°C for 30s, 72°C for 1min, 40 cycles; 72°C for 2min; 16°C forever.
[0086] The PCR product was sent to the company for sequencing verification. Sequencing results revealed overlapping peaks at the target site, indicating a heterozygous edited plant, designated T0 transgenic ngr soybean.
[0087] 3. Next generation group separation
[0088] Based on the results of PCR identification, heterozygous edited plants were selected and harvested for planting to obtain T1 plants. T1 plants were identified and herbicide-resistant heterozygous edited plants were selected and harvested for planting to obtain T2 plants.
[0089] The test results of T2 generation plants are as follows Figure 3 As shown in bc, it means that the screened plants do not contain the herbicide-resistant marker gene and have undergone gene mutation.
[0090] The T2 generation mutant plants with various ngr gene mutation types are further cultivated until T3 generation mutant plants are obtained.
[0091] The sequencing results are as follows Figure 4 As shown, homozygous mutant plants were obtained, including ngr1 single mutants, ngr2 single mutants, and ngr1 / 2 double mutants. These mutant plants had the following mutations at the target sites of the NGR1 and NGR2 genes, causing premature termination of protein translation. The base mutation type at the target site of the NGR1 gene was -2 bp, and the base mutation type at the target site of the NGR2 gene was -5 bp.
[0092] Example 4 Phenotypic Analysis of Mutant Materials
[0093] 1. Analysis of the root tilt angle of mutants
[0094] Wild-type (Young) and mutant accessions ngr1, ngr2, and ngr1 / 2 were planted in transparent rhizoboxes measuring 40 cm long, 1.5 cm wide, and 50 cm high. The rhizoboxes were divided into two chambers: the left chamber held the wild-type accession and the right chamber held the mutant accession. The rhizoboxes were tilted 60° with the seed-adherent side facing downward. After 15 days of growth in a greenhouse, the root architecture of the mutant accessions was observed, and the lateral root angle was measured, with a vertical downward angle defined as 0°.
[0095] The results are as follows Figure 5 As shown, the lateral root angles of ngr1, ngr2, and ngr1 / 2 are significantly larger than those of the wild type. Measurements show that the lateral root angles of the ngr1 mutant are close to 90°, while those of the ngr2 mutant are almost perpendicular to the direction of gravity at 90°. The lateral roots of ngr1 / 2 exceed 90° and grow toward the soil surface, demonstrating an anti-gravity phenomenon.
[0096] 2. Determination of Phosphorus Content in Mutants
[0097] (1) Material planting (such as Figure 6 shown)
[0098] Black rectangular flower pots were 40.5 cm long, 22 cm wide, and 21 cm high, with a central divider dividing the pots into evenly spaced chambers. Three pots were filled with low-phosphorus red soil. The lower layer contained a 13 cm layer of low-phosphorus soil, thoroughly watered with Hoagland's nutrient solution containing 1 mM potassium dihydrogen phosphate. The center layer was covered with a 2 cm thick layer of perlite, and then covered with a 5 cm thick layer of low-phosphorus red soil thoroughly watered with Hoagland's nutrient solution containing 1 mM potassium dihydrogen phosphate. Three pots were filled with low-phosphorus red soil. The lower layer contained a 13 cm layer of low-phosphorus red soil, thoroughly watered with Hoagland's nutrient solution containing phosphorus deficiency. The center layer was covered with a 2 cm thick layer of perlite, and then covered with a 5 cm thick layer of low-phosphorus red soil thoroughly watered with Hoagland's nutrient solution containing phosphorus deficiency. Three pots simulated environmental soil phosphorus distribution. The lower layer contained a 13 cm layer of low-phosphorus red soil, thoroughly watered with Hoagland's nutrient solution containing phosphorus deficiency. The center layer was covered with a 2 cm thick layer of perlite, and then covered with a 5 cm thick layer of low-phosphorus red soil thoroughly watered with Hoagland's nutrient solution containing 1 mM potassium dihydrogen phosphate. Each treatment consisted of wild-type (Young) soybeans planted on one side and transgenic soybeans planted on the other. Twenty seeds were evenly planted on each side, and uniform seedlings were retained after emergence. Plants were grown in a growing room with a photoperiod of 16:8 hours daylight:darkness, a temperature of 21°C, and a relative humidity of 70%. Pots were rotated every five days and watered every other day with Hoagland's nutrient solution. In the high-phosphorus treatment, trays were watered with 500 mL of Hoagland's nutrient solution containing 1 mM potassium dihydrogen phosphate, and 100 mL of Hoagland's nutrient solution containing 1 mM potassium dihydrogen phosphate was added to the soil surface on both sides. In the low-phosphorus treatment, trays were watered with 500 mL of Hoagland's nutrient solution containing 1 mM potassium dihydrogen phosphate, and 100 mL of Hoagland's nutrient solution containing 1 mM potassium dihydrogen phosphate was added to the soil surface on both sides. In the treatment designed to simulate soil phosphorus distribution, trays were watered with 500 mL of Hoagland's nutrient solution containing 1 mM potassium dihydrogen phosphate, and 100 mL of Hoagland's nutrient solution containing 1 mM potassium dihydrogen phosphate was added to the soil surface on both sides. One month after planting, the entire plant was harvested for total phosphorus content determination.
[0099] (2) Sample preparation
[0100] First, wipe the freshly collected plants clean of any surface impurities with a damp cotton cloth. Rinse once or twice with clean water and quickly dry. Next, chop the cleaned plants into small pieces and weigh them in a glass dish that has been dried to a constant weight. After recording the data, quickly place the sample in a forced-air drying oven at 80°C to 90°C and bake for 15 to 30 minutes to remove the dead green. Then, lower the temperature to 60°C to 70°C and continue drying until the plants become brittle. Once the sample has cooled slightly, crush it immediately, ensuring that all particles pass through a 0.25mm sieve. Finally, seal and store for future use.
[0101] (3) Determination of moisture content
[0102] Weigh 2 g of sample (accurate to 0.0001 g) from the collected plant samples, place them in a glass dish of known mass, and oven-dry at (105 ± 2)°C for 2 h. Immediately transfer the sample to a desiccator, cool to room temperature, weigh it, and calculate the moisture content.
[0103] (4) Preparation of test solution
[0104] Accurately weigh 0.25g (accurate to 0.0001g) of the crushed and sieved sample and place it at the bottom of the digestion tube, ensuring that the sample does not adhere to the tube walls. First, soak the sample with 3mL of distilled water. Let it sit for 10 minutes, then add 8mL of sulfuric acid and gently shake to mix thoroughly. Place a small curved-neck funnel at the mouth of the tube, cover with plastic wrap, and let it sit overnight. Next, heat the sample in a digestion furnace at 250°C for approximately 10 minutes. When a large amount of white smoke emerges from the digestion tube, increase the temperature to 380°C and continue heating until the digestion solution turns a uniform brown-brown color. After the solution cools slightly, begin adding approximately 2mL of hydrogen peroxide dropwise to the bottom of the digestion tube, shaking evenly. Next, heat the sample to a slight boil for approximately 10 minutes, then remove the tube and cool. Add another 1mL of hydrogen peroxide and continue digestion. Repeat this process multiple times, adding gradually smaller amounts of hydrogen peroxide each time, until the solution becomes clear. Finally, heat the solution again for at least 30 minutes to ensure complete decomposition of any remaining hydrogen peroxide. Remove the digestion tube and cool to room temperature. Rinse the funnel with a small amount of distilled water, ensuring that the wash solution flows into the digestion tube. Transfer the digestion solution to a 100 mL volumetric flask, cool to volume, and shake well. Finally, dry filter using phosphate-free filter paper for subsequent analysis.
[0105] (5) Test solution determination
[0106] Take 5.00 mL of the test solution obtained in (4), place it in a 50 mL volumetric flask, and add water to about 30 mL scale. Then, add 2 drops of dinitrophenol indicator and carefully adjust with sodium hydroxide solution or sulfuric acid solution until the solution appears slightly yellow. Then, add 5.00 mL of molybdenum antimony anti-color developer and dilute to the scale with distilled water. Let this solution stand in an environment above 20°C for 30 minutes to ensure that the color reaction is complete. Finally, use an enzyme marker to adjust the zero point according to the zero point of the standard curve at a wavelength of 700 nm, and then perform colorimetric determination.
[0107] (6) Blank sample
[0108] Except for not adding the sample, the rest of the operations are carried out according to the provisions of steps (4) and (5).
[0109] (7) Standard curve drawing
[0110] Accurately pipette 0.00mL, 1.00mL, 2.00mL, 4.00mL, 6.00mL, 8.00mL, and 10.00mL of phosphorus standard solution into separate 50mL volumetric flasks. Then, add the same volume of blank digestion solution as used for the sample measurement to each flask, and add water to approximately 30mL. Next, add two drops of dinitrophenol indicator and carefully adjust with sodium hydroxide or sulfuric acid until the solution turns slightly yellow. Then, add 5.00mL of molybdenum antimony anticolorimetric reagent to each flask and bring to volume with distilled water. The concentrations of this series of standard solutions are 0.00mg / L, 0.10mg / L, 0.20mg / L, 0.40mg / L, 0.60mg / L, 0.80mg / L, and 1.00mg / L, respectively. After measuring the absorbance values, construct a standard curve based on these data for subsequent analysis.
[0111] (9) Result calculation
[0112] The total phosphorus (P) content in the plant is expressed as mass fraction (g / kg) and is calculated according to the following formula
[0113]
[0114] Where:
[0115] ρ—the phosphorus concentration in the colorimetric solution obtained from the standard curve, in milligrams per liter (mg / L);
[0116] ρ0—Phosphorus concentration in the blank sample obtained from the standard curve, in milligrams per liter (mg / L);
[0117] V—measured volume, in milliliters (mL);
[0118] D—dispensing multiple, the ratio of the fixed volume to the dispensed volume;
[0119] 10 -3 —mL to L conversion factor;
[0120] m—sample mass, in grams (g)
[0121] f—Moisture content of the sample.
[0122] The results of parallel determinations were expressed as arithmetic mean with two decimal places.
[0123] (10) Results analysis
[0124] The results of phosphorus content determination of mutants are as follows Figure 7As shown, the analysis showed that there was no significant difference in the phosphorus absorption efficiency of the mutant material in low phosphorus (-P) and normal phosphorus (+P) environments, but the phosphorus absorption efficiency in the growth environment (+P / -P) simulating the phosphorus content distribution in the natural environment was significantly higher than that of the wild type (Young), indicating that the mutant material can efficiently absorb phosphorus in the growth environment simulating the phosphorus content distribution in the natural environment.
[0125] Experiments conducted in the present invention demonstrate that the soybean genes NGR1 and / or NGR2 can regulate the anti-gravity growth of soybean lateral roots. Using CRISPR / Cas9 technology, conserved domains of the soybean NGR1 and / or NGR2 genes were edited and deleted, resulting in mutations in the target genes that led to premature termination of protein translation, resulting in mutant materials with loss of target gene function. Observation revealed that the mutants exhibited anti-gravity growth of their lateral roots, i.e., a root configuration in which lateral roots grow toward the sky and the main root grows downward. Furthermore, the mutants exhibited greater phosphorus absorption efficiency than the wild type (Young) in a growth environment that simulates the phosphorus distribution in the natural environment. This provides new material for the breeding of shallow-root, phosphorus-efficient soybean varieties.
Claims
1. Knockout of soybean genes NGR1 and / or NGR2 The application of the method in promoting the anti-gravity growth of soybean lateral roots is characterized in that: described NGR1 The nucleotide sequence is shown in SEQ ID No.1; NGR2 The nucleotide sequence is shown in SEQ ID No.
2.
2. Knockout of soybean genes NGR1 and / or NGR2 The application of the method in cultivating shallow-root soybeans with lateral roots growing against gravity is characterized in that: described NGR1 The nucleotide sequence is shown in SEQ ID No.1; NGR2 The nucleotide sequence is shown in SEQ ID No.
2.
3. A method for cultivating shallow-rooted soybeans with lateral roots growing against gravity, characterized in that: Genes in soybean NGR1 and / or NGR2 Knockout is performed to obtain mutant materials with loss of function of the target gene; described NGR1 The nucleotide sequence is shown in SEQ ID No. 1; NGR2 The nucleotide sequence is shown in SEQ ID No.
2.
4. The method according to claim 3, characterized in that The knockout method is to use CRISPR / Cas9 technology to knock out soybean genes NGR1 and / or NGR2 Gene editing is performed on the conserved domain to cause mutations in the target gene, resulting in premature termination of protein translation and obtaining mutant materials with loss of target gene function.
5. The method according to claim 4, characterized in that: described NGR1 The knockout target of the conserved domain is sgRNA1 and / or sgRNA2; the nucleotide sequence of the sgRNA1 is shown in SEQ ID No.3; the nucleotide sequence of the sgRNA2 is shown in SEQ ID No.
4.
6. The method according to claim 4, characterized in that: described NGR2 The knockout target of the conserved domain is sgRNA3 and / or sgRNA4; the nucleotide sequence of the sgRNA3 is shown in SEQ ID No. 5; the nucleotide sequence of the sgRNA4 is shown in SEQ ID No.
6.
7. The method according to claim 5, characterized in that The F-terminal sequence of the knockout target sgRNA1 amplification primer is shown as SEQ ID No. 7, and the R-terminal sequence of the knockout target sgRNA1 amplification primer is shown as SEQ ID No. 8; the F-terminal sequence of the knockout target sgRNA2 amplification primer is shown as SEQ ID No. 9, and the R-terminal sequence of the knockout target sgRNA2 amplification primer is shown as SEQ ID No.
10.
8. The method according to claim 6, characterized in that The F-terminal sequence of the knockout target sgRNA3 amplification primer is shown as SEQ ID No. 11, and the R-terminal sequence of the knockout target sgRNA3 amplification primer is shown as SEQ ID No. 12; the F-terminal sequence of the knockout target sgRNA4 amplification primer is shown as SEQ ID No. 13, and the R-terminal sequence of the knockout target sgRNA4 amplification primer is shown as SEQ ID No.
14.
9. The method according to any one of claims 3 to 8, characterized in that: The steps include: 1) Synthetic Soy NGR1 and / or NGR2 The target gene fragment is connected to the CRISPR / Cas9 vector to construct a recombinant plasmid containing the target gene fragment, and the Agrobacterium is transformed to obtain Agrobacterium containing the recombinant plasmid of the target gene fragment; 2) Infect soybean explants with the Agrobacterium solution containing the recombinant vector from step 1), and screen for soybean explants that do not contain Cas9 protein and NGR1 and / or NGR2 The gene has been successfully edited and is homozygous, obtaining a homozygous transgenic strain.
Citation Information
Patent Citations
Method for increasing phosphorus absorptivity of soybeans
CN117143911A
Plant with improved deep-rootedness
WO2023203988A1