A genetic transformation method for taro

Abstract

The present invention discloses a taro genetic transformation method, belonging to the technical field of biological breeding. The method includes: taking embryogenic callus induced from taro shoot tips for propagation, infecting the embryogenic callus induced from taro shoot tips with Agrobacterium, carrying out co-culture, screening for resistant buds, inducing test-tube taro, and acclimatizing and transplanting seedlings to obtain taro genetic transformation seedlings; wherein, the Agrobacterium is the Agrobacterium strain GV3101 transformed with the pRI101-CeSUC3 recombinant plasmid. By screening and comparing the infection method during the taro genetic transformation process, the culture conditions after infection, the hormone combination and concentration during the bud induction process, and whether to induce test-tube taro, the present invention has established an efficient and stable taro genetic transformation system suitable for different genotype taro varieties, overcome the problems such as difficult taro genetic transformation, and laid a foundation for the biological breeding of taro.

Description

Technical Field

[0001] The present invention belongs to the technical field of biological breeding, and particularly relates to a genetic transformation method for taro. Background Art

[0002] Taro ( Colocasia esculenta (L). Schott) is a traditional crop with dual functions of medicine and food. Its corms are rich in many physiologically active substances, which can relieve various sub-healthy symptoms of the human body and are deeply favored by consumers. Due to its typical asexual reproduction characteristics and narrow genetic background, it is difficult to breed breakthrough new varieties. Genetic transformation technology is the basis of biological breeding and can be used for the rapid and precise improvement of crop varieties. However, there is currently no relevant report on the genetic transformation technology of taro.

[0003] The genetic transformation method mediated by Agrobacterium has an important role in plant transgenic breeding due to its advantages of high efficiency, stability, and simple operation. Transgenic breeding can provide a rapid, efficient, and precise way for the cultivation of breakthrough new varieties of taro. Therefore, the development of taro genetic transformation technology can not only enrich the breeding methods of taro but also support the transformation of taro from traditional breeding to biological breeding. Summary of the Invention

[0004] The purpose of the present invention is to solve at least one of the technical problems existing in the prior art and provide a genetic transformation method for taro.

[0005] The technical solution of the present invention is as follows:

[0006] To achieve the above-mentioned invention purpose, the technical scheme adopted by the present invention is as follows:

[0007] The present invention provides a genetic transformation method for taro, which specifically includes the following steps:

[0008] S1. Take the embryogenic callus induced from the taro shoot tip, propagate it to obtain newly proliferated embryogenic callus; infect the newly proliferated embryogenic callus with Agrobacterium, and then transfer it to a co-culture medium for cultivation;

[0009] S2. Transfer the embryogenic callus after co-cultivation to a differentiation screening medium to obtain resistant shoots;

[0010] S3. Select strong differentiated shoots and transfer them to a seedling medium to obtain resistant seedlings;

[0011] S4. Select resistant seedlings with a height of 5 - 7 cm and transfer them to a test-tube taro induction medium to obtain resistant test-tube taro;

[0012] S5. Acclimatize the resistant test-tube taro and plant it in a greenhouse.

[0013] Among them, the Agrobacterium is the Agrobacterium strain GV3101 that transforms the recombinant plasmid pRI101-CeSUC3.

[0014] Optionally, the method for obtaining the Agrobacterium strain GV3101 that transforms the recombinant plasmid pRI101-CeSUC3 includes the following steps:

[0015] Perform amplification using taro cDNA as a template. The system is as follows: 2 μL of DNA template, 8 μL of DNA polymerase, 0.5 μL of upstream primer, 0.5 μL of downstream primer, and ddH2O is added to make up to 20 μL; the program is as follows: pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 54°C for 20 s, extension at 72°C for 45 s, 36 cycles, final extension at 72°C for 5 min, and preservation at 4°C to obtain the CeSUC3 fragment with homologous recombination sequences added; among them, the upstream primer F (SEQ ID NO: 1): 5’-TCTTCACTGTTGATACATATGATGGACGCCATCTCGATCCG-3’, and the downstream primer R (SEQ ID NO: 2): 5’-AGAGTTGTTGATTCAGAATTCTTAGCCAAATCCATGAAGACCCG-3’;

[0016] Use NdeⅠ and EcoRⅠ restriction endonucleases to digest the overexpression vector pRI101-AN circular plasmid to obtain linearized pRI101-AN;

[0017] Mix the linearized pRI101-AN and the CeSUC3 fragment with homologous recombination sequences added at a molar ratio of 1:3, and incubate at 37°C for 30 min. The system is: 1 μL of linearized pRI101-AN, 3 μL of the CeSUC3 fragment with homologous recombination sequences added, 5 μL of universal enzyme premix, and ddH2O is added to make up to 10 μL;

[0018] Transform the recombinant mixture into Escherichia coli DH5α, coat the plate, pick monoclonal colonies, shake the bacteria, perform colony PCR, select the monoclonal bacterial solution with the target band for sequencing, select the monoclonal with the correct sequence and shake the bacteria again, extract the recombinant plasmid pRI101-CeSUC3, and transform Agrobacterium GV3101 by heat shock at 37°C.

[0019] Optionally, in the above method, the embryogenic callus material induced from the shoot tip in step S1 is from the shoot tip induction of different genotype taro varieties such as Curved Root Taro, Flower and Fruit Taro, Gan Taro No. 1, Gan Taro No. 2, etc.;

[0020] Optionally, in the above method, the proliferation medium in step S1 is MS + 30 g / L sucrose + 2 mg / L TDZ + 0.1 mg / L NAA + 6.5 g / L agar powder, with a pH of 5.8 - 6.0. The conditions for propagation are: culturing under dark conditions at a temperature of 24°C - 26°C;

[0021] Optionally, in the above method, the method of using Agrobacterium to infect the newly proliferated embryogenic callus in step S1 specifically includes:

[0022] Pretreat the Agrobacterium, and then resuspend the bacterial cells with an Agrobacterium infection solution. After resuspension, adjust the bacterial liquid concentration to OD 600 = 0.6 - 0.8;

[0023] Collect the newly proliferated embryogenic callus in a sterile conical flask, pour in the bacterial liquid, seal it with a sterile sealing film. Under room temperature conditions, first infect on a shaker at 100 rpm for 15 min, and then maintain it under a vacuum condition of -0.1 MPa for 15 min. The total infection time is 30 min;

[0024] Among them, the Agrobacterium infection solution includes the following components: 1 / 2 MS + 30 g / L sucrose + 20 µmol / L - 30 µmol / L acetosyringone, with a pH of 5.8 - 6.0,

[0025] Optionally, in the above method, the method of pretreating the Agrobacterium includes:

[0026] Inoculate a single colony of Agrobacterium into 2 mL of YEB medium, add the corresponding antibiotic, and culture it on a shaker at 180 rpm at 28°C for 12 h until the bacterial cells are completely revived;

[0027] Take 500 μL of the revived bacterial liquid and add it to 10 mL of YEB medium, and add the corresponding antibiotic. Culture it on a shaker at 180 rpm at 28°C for 12 h until the OD of the bacterial liquid 600 reaches 0.9 - 1.1;

[0028] Centrifuge at 5000 rpm for 10 min, discard the supernatant, and collect the Agrobacterium cells.

[0029] Optionally, in the above method, the co - culture medium in step S1 includes the following components: MS + 30 g / L sucrose + 20 µmol / L - 30 µmol / L acetosyringone, with a pH of 5.8 - 6.0. The conditions for co - culture are: dark culture at 24°C - 26°C for 3 d - 4 d;

[0030] Optionally, in the above method, the differentiation and screening medium described in step S2 comprises the following components: MS + 6-BA 1.0 mg / L + NAA 0.5 mg / L + sucrose 30 g / L + acetosyringone 20 μmol / L - 30 μmol / L + ticarcillin 250 mg / L + kanamycin 50 mg / L, with a pH of 5.8 - 6.0. The conditions for differentiation culture are: 24°C - 26°C, first dark culture for 7 d - 14 d, then transferred to light conditions for culture, with a light intensity of 2000 Lx - 3000 Lx and a photoperiod of 16 h light and 8 h dark;

[0031] Optionally, in the above method, the seedling-forming medium described in step S3 comprises the following components: MS + 6-BA 1.0 mg / L + NAA 0.5 mg / L + sucrose 30 g / L + ticarcillin 250 mg / L + kanamycin 50 mg / L, with a pH of 5.8 - 6.0. The conditions for seedling-forming culture are: temperature 24°C - 26°C, light intensity of 2000 Lx - 3000 Lx, and a photoperiod of 16 h light and 8 h dark;

[0032] Optionally, in the above method, the test-tube taro induction medium described in step S4 comprises the following components: MS + sucrose 80 g / L + ticarcillin 250 mg / L + kanamycin 50 mg / L, with a pH of 5.8 - 6.0. The conditions for test-tube taro induction culture are: temperature 24°C - 26°C, light intensity of 2000 Lx - 3000 Lx, and a photoperiod of 16 h light and 8 h dark;

[0033] Optionally, in the above method, the resistant test-tube taro is transferred to normal temperature conditions, acclimatized for 3 d - 5 d, then the seedlings are taken out, the basal medium is washed clean, and planted in the substrate. The substrate is peat:vermiculite with a volume ratio of 2:1, bagged and moisturized for 3 d - 5 d, and grown in a greenhouse. The growth conditions are: temperature 20°C - 30°C, light intensity of 2000 Lx - 4000 Lx, and a photoperiod of 12 h - 14 h light and 10 h - 12 h dark, to obtain surviving plants.

[0034] The present invention has at least one of the following beneficial effects:

[0035] 1. Provided is a taro genetic transformation method, which uses Agrobacterium to infect embryogenic callus induced from taro shoot tips, conducts co-culture, resistant bud screening, test-tube taro induction, acclimatization and transplantation to obtain taro genetic transformation seedlings.

[0036] 2. By screening and comparing the infection method, culture conditions, hormone combination and concentration, and induction of test-tube taro, the present invention has established an efficient and stable taro genetic transformation system suitable for different genotype taro varieties, overcome the problems such as difficult taro genetic transformation, and can be used for taro biological breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 It is a physical picture of taro embryogenic callus in Example 1;

[0038] Figure 2 It is a physical picture of the co-culture of embryogenic callus and Agrobacterium in Example 1;

[0039] Figure 3 It is a transformation vector diagram in Example 1;

[0040] Figure 4 It is a physical picture of resistant buds screened from the infected callus in Example 1;

[0041] Figure 5 It is a physical picture of seedlings grown from resistant buds in Example 1;

[0042] Figure 6 It is a physical picture of test-tube taro induced from resistant seedlings in Example 1;

[0043] Figure 7 It is the PCR electrophoresis detection of pRI101-CeSUC3 strain in Example 1;

[0044] Figure 8 It is the PCR electrophoresis detection of pRI101-CeSUC3 strain in Comparative Example 2;

[0045] Figure 9 It is the PCR electrophoresis detection of pRI101-CeSUC3 strain in Comparative Example 3. DETAILED DESCRIPTION OF THE INVENTION

[0046] In order to make the technical problems, technical solutions and beneficial effects solved by the present invention clearer, the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0047] Example 1: Agrobacterium-mediated taro genetic transformation method

[0048] Specifically, it includes the following steps:

[0049] (1) Propagation of shoot tip embryogenic callus

[0050] a. In a laminar flow hood, take the embryogenic callus induced from the shoot tip of Ganyu 2 and inoculate it into the callus proliferation medium. The proliferation medium is MS + 30 g / L sucrose + 2 mg / L thidiazuron (TDZ) + 0.1 mg / L naphthaleneacetic acid (NAA) + 6.5 g / L agar powder, with a pH of 5.8;

[0051] b. Incubate it under dark conditions at a temperature of 25°C;

[0052] (2)Overexpression vector construction

[0053] a. Design specific primers according to the sequence of the taro CeSUC3 gene (gene number: EVM0005823.1) and add homologous recombination sequences (underlined parts of the primers). Forward primer F (SEQ ID NO: 1): 5’- TCTTCACTGTTGATACATATG ATGGACGCCATCTCGATCCG-3’, reverse primer R (SEQ ID NO: 2): 5’- AGAGTTGTTGATTCAGAATTC TTAGCCAAATCCATGAAGACCCG-3’. Use taro cDNA as a template for amplification. The reaction system is as follows: 2 μL DNA template, 8 μL DNA polymerase (PrimeSTAR ® Max DNA Polymerase, R045A, Takara), 0.5 μL forward primer, 0.5 μL reverse primer, and ddH2O is added to make up to 20 μL; The program is as follows: pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 54°C for 20 s, extension at 72°C for 45 s, 36 cycles, final extension at 72°C for 5 min, and storage at 4°C;

[0054] b. Run gel electrophoresis to recover the CeSUC3 target fragment, ligate it to pMD19-T (Takara) for sequencing, and obtain a monoclonal vector with the correct sequence, that is, obtain the CeSUC3 fragment with homologous recombination sequences added;

[0055] c. Use restriction enzymes NdeⅠ and EcoRⅠ (New England Biolabs) to digest the overexpression vector pRI101-AN at 25°C for 1 h to linearize it. The reaction system is: 1 μg pRI101-AN, 1 μL each of NdeⅠ and EcoRⅠ, 1 μL buffer, and ddH2O is added to make up to 20 μL;

[0056] Mix the recycled linearized vector and the CeSUC3 fragment with homologous recombination sequences at a molar ratio of 1:3, and incubate at 37 °C for 30 min. The system is as follows: 1 μL of linearized pRI101-AN, 3 μL of CeSUC3 with homologous recombination sequences, 5 μL of universal enzyme premix (2x Hieff Clone Universal Enzyme Premix, Yeasen Biotechnology Co., Ltd.), and make up to 10 μL with ddH2O;

[0057] d. Transform the recombinant mixture into Escherichia coli DH5α (Huayueyang Biotechnology Co., Ltd.), spread on plates, pick monoclonal colonies, shake the bacteria, perform colony PCR, select the monoclonal bacterial solution with the target band for sequencing, pick the monoclonal with the correct sequence and shake the bacteria again, extract the recombinant plasmid pRI101-CeSUC3, and transform Agrobacterium tumefaciens GV3101 (Huayueyang Biotechnology Co., Ltd.) by heat shock at 37 °C.

[0058] (3)Agrobacterium tumefaciens infection preparation

[0059] a. Pick a single colony of Agrobacterium tumefaciens GV3101 containing the pRI101-CeSUC3 plasmid into 2 mL of YEB medium, add kanamycin and rifampicin with final concentrations of 50 mg / L and 25 mg / L, and culture on a shaker at 180 rpm at 28 °C for 12 h until the bacteria are completely revived;

[0060] b. Take 500 μL of the revived bacterial solution and add it to 10 mL of YEB medium, add kanamycin and rifampicin with final concentrations of 50 mg / L and 25 mg / L, and culture on a shaker at 180 rpm at 28 °C for 12 h until the OD of the bacterial solution 600 reaches about 1.0;

[0061] c. Centrifuge at 5000 rpm for 10 min, collect the bacteria, discard the supernatant, resuspend the bacteria with the infection solution. The infection solution contains the following components: 1 / 2 MS + 30 g / L sucrose + 25 μmol / L acetosyringone, pH 5.8; after resuspension, adjust the bacterial solution concentration to OD 600 = 0.8;

[0062] (4)Agrobacterium tumefaciens infection of embryogenic callus

[0063] a. Collect the embryogenic callus cultured in the dark in step (1) in a 50 mL sterile conical flask, pour the bacterial solution in step (3) into it, seal it with a sterile sealing film, and infect for 15 min. During this process, shake continuously on a shaker at 100 rpm;

[0064] b. Place the tube back in the vacuum device and keep it under -0.1MPa vacuum for 15 minutes to ensure that the callus tissue is in full contact with the bacterial solution;

[0065] c. Discard the bacterial solution in the clean bench, use sterile absorbent paper to absorb the bacterial solution on the surface of the callus tissue, and evenly place it on the co-culture medium for culture. The co-culture medium includes the following components: MS + sucrose 30 g / L + acetosyringone 25 µmol / L, pH 5.8; culture in the dark at 25℃ for 4 days;

[0066] (5) Screening of resistant buds

[0067] a. Place the callus tissue co-cultured for 4 days in step (4) evenly on a differentiation screening medium, which includes the following components: MS + 6-benzylaminoadenine (6-BA) 1.0 mg / L + naphthaleneacetic acid (NAA) 0.5 mg / L + sucrose 30 g / L + acetosyringone 25 µmol / L + timentin 250 mg / L + kanamycin 50 mg / L, pH 5.8;

[0068] b. The culture conditions are 25°C, first cultured in the dark for 14 days, then cultured under light conditions, with a light intensity of 3000 Lx and a photoperiod of 16 hours of light and 8 hours of darkness;

[0069] c. Transfer once every 15 days until the callus differentiates into resistant buds;

[0070] d. Transfer the resistant buds to the seedling medium and grow them to 5cm~7cm. The seedling medium includes the following ingredients: MS + 6-benzylaminoadenine (6-BA) 1.0 mg / L + naphthaleneacetic acid (NAA) 0.5 mg / L + sucrose 30 g / L + timentin 250mg / L + kanamycin 50 mg / L, pH 5.8; the conditions for seedling culture are: temperature 25℃, light intensity 3000 Lx, photoperiod of 16h light and 8h dark.

[0071] (6) Induction of taro in vitro

[0072] a. Transfer the healthy seedlings of 5 cm to 7 cm in height to the induction medium for taro culture. The induction medium for taro culture includes the following ingredients: MS + sucrose 80 g / L + timentin 250 mg / L + kanamycin 50 mg / L, pH 5.8;

[0073] b. The conditions for induction culture of test tube taro are: temperature 25℃, light intensity 3000 Lx, photoperiod 16h light and 8h dark;

[0074] c. The test tube taro expands after 6 - 8 weeks;

[0075] (7)Transplanting of transgenic plants

[0076] a. Transfer the test tube taro to acclimatize at room temperature for 3 days, then take out the seedlings, clean the basal medium, and plant them in the completely moistened substrate (peat moss: vermiculite volume ratio = 2:1), and compact it;

[0077] b. Keep it moist by bagging for 3 days, and grow it in a greenhouse. The growth conditions are: temperature 25°C, light intensity 4000 Lx, photoperiod 12 hours of light and 12 hours of darkness to obtain surviving plants.

[0078] Comparative Example 1: Effects of different differentiation media on bud emergence of taro embryogenic callus

[0079] The genetic transformation of taro is basically the same as that in Example 1, except that in step (5), different concentrations of 6 - BA (1.0, 2.0 mg / L) and TDZ (1.0, 2.0 mg / L) are successively selected and combined with NAA (0.1, 0.3, 0.5 mg / L) respectively for bud induction, and the effects of different concentration ratios on the bud emergence rate of taro are compared.

[0080]

[0081] As can be seen from Table 1, there are obvious differences in the differentiation of taro embryogenic callus under different hormone combinations and concentration conditions. When the cytokinin is TDZ, the bud emergence rate of the callus is relatively stable, between 32.2% - 55.6%. When the cytokinin is 6 - BA, the bud emergence rate of the callus varies greatly, and the lowest is only 15.6%. When the NAA content is 0.5 mg / L and the 6 - BA content is 1.0 mg / L, the differentiation effect is the best, and the bud emergence rate can reach more than 70%.

[0082] Comparative Example 2: Effects of vacuum treatment on the genetic transformation rate of taro

[0083] The genetic transformation of taro is basically the same as that in Example 1, except that in step (4), the embryogenic callus is not kept under a vacuum condition of - 0.1 MPa for 15 minutes during the Agrobacterium tumefaciens infection process, and the effects of the two treatments on the positive transformation rate are compared.

[0084] Comparative Example 3: Effects of dark treatment after callus infection on the genetic transformation rate of taro

[0085] The genetic transformation of taro is basically the same as that in Example 1, except that in step (5), the resistant buds are not first cultured in the dark for 14 days during the screening and transfer to the differentiation screening medium, and the effects of the two treatments on the positive transformation rate are compared.

[0086] Table 2 shows the comparison of the positive conversion rates in Example 1 and Comparative Examples 2-3. After transplanting and survival, the DNA of the regenerated plant leaves was extracted. The untransformed Ganyu No. 2 plant was used as the negative control, and the pRI101-SUC3 plasmid was used as the positive control for PCR detection. The size of the detected fragment was 398 bp. The detection primers were F (SEQ ID NO: 3): 5’-CACGGGGGACTCTAGATACA-3’ and R (SEQ ID NO: 4): 5’-GGCATGTTCAATTCCGAGTGT-3’. The reaction system for PCR detection was: 2 μL of DNA template, 8 μL of universal enzyme premix (2x Hieff Clone Universal Enzyme Premix, Yeasen Biotech Co., Ltd.), 0.5 μL of upstream primer, 0.5 μL of downstream primer, and ddH2O was added to make up to 20 μL. The PCR amplification program was: pre-denaturation at 94 °C for 4 min; denaturation at 98 °C for 10 s, annealing at 54 °C for 30 s, extension at 72 °C for 30 s, for 36 cycles; final extension at 72 °C for 5 min, and stored at 4 °C. The PCR products were detected by agarose gel electrophoresis with a concentration of 1.0% ( Figure 7 ).

[0087] Figure 7 Figure 1 shows the PCR electrophoresis detection map of the pRI101-CeSUC3 line in Example 1. A total of 23 regenerated plants were obtained. Among them, M is the marker (Maker), + is the positive control group, - is the negative control group, 1-23 are the pRI101-CeSUC3 regenerated plants, 100 bp, 250 bp, and 500 bp represent the sizes of the marker bands respectively. Plants with fragments of the same size as the positive control group are positive plants, and plants without bands are negative plants. That is, among the 23 regenerated plants obtained in Example 1, 15 were positive plants and 8 were negative plants.

[0088] Figure 8 Figure 2 shows the PCR electrophoresis detection map of the pRI101-CeSUC3 line in Comparative Example 2. A total of 29 regenerated plants were obtained. Among them, M is the marker (Maker), + is the positive control group, - is the negative control group, 1-29 are the pRI101-CeSUC3 regenerated plants, 100 bp, 250 bp, and 500 bp represent the sizes of the marker bands respectively. Plants with fragments of the same size as the positive control group are positive plants, and plants without bands are negative plants. That is, among the 29 regenerated plants obtained in Comparative Example 2, 2 were positive plants and 27 were negative plants.

[0089] Figure 9PCR electrophoresis detection chart of pRI101-CeSUC3 strain in Comparative Example 3. A total of 8 regenerated plants were obtained. Among them, M is the marker (Maker), + is the positive control group, - is the negative control group, 1-8 are pRI101-CeSUC3 regenerated plants, 100bp, 250bp, and 500bp respectively represent the sizes of the marker bands. Plants with fragments of the same size as the positive control group are positive plants, and plants without bands are negative plants. That is, among the 8 regenerated plants obtained in Comparative Example 3, 3 are positive plants and 5 are negative plants.

[0090] Figure 1 Photograph of the somatic embryogenic callus of taro in Example 1; Figure 2 Photograph of the co-culture of embryogenic callus and Agrobacterium in Example 1; Figure 3 Plasmid map of the genetic expression vector used in Example 1, showing the characteristics of plasmid pRI101-AN; Figure 4 Photograph of the resistant buds screened from the infected callus in Example 1; Figure 5 Photograph of the seedlings grown from the resistant buds in Example 1; Figure 6 Photograph of the test-tube taro induced from the resistant seedlings in Example 1; Figures 1 to 7 It can be seen that the method of Example 1 can obtain transgenic plants, which can be used for the biological breeding of taro.

[0091]

[0092] By comparing Example 1 with Comparative Example 2, it can be concluded that vacuum treatment can improve the positive conversion rate; by comparing Example 1 with Comparative Example 3, it can be concluded that after infecting embryogenic callus with Agrobacterium, dark culture for 14 days can improve the positive conversion rate.

[0093] Comparative Example 4: Effect of inducing test-tube taro on the survival rate of resistant seedlings

[0094] The genetic transformation of taro was basically the same as that in Example 1, except that in step (6), the robust plant lines with a height of 5-7 cm were transferred to the rooting medium for culture. The composition of the rooting medium was as follows: MS + 6-BA 1.0 mg / L + NAA 1.0 mg / L + sucrose 30 g / L + ticarcillin 250 mg / L + kanamycin 50 mg / L, and the pH was 5.8; the conditions for rooting culture were: temperature 25°C, light intensity 3000 Lx, photoperiod 16 h light, 8 h dark, until rooting. The resistant plants obtained in Example 1 and Comparative Example 4 were transplanted, and the survival rate was statistically analyzed after 30 days and the growth trend of the plants was recorded.

[0095]

[0096] As can be seen from Table 3, after inducing test-tube taro and then transplanting it, the survival rate is higher and the growth of the seedlings is better.

[0097] Example 2: Comparison of the positive plant rates of the constructed genetic transformation system in taro varieties with different genotypes

[0098] The genetic transformation of taro was basically the same as that in Example 1, except that embryogenic calli induced from the shoot tips of multiple taro varieties with different genotypes, such as Curved Root Taro, Flower and Fruit Taro, and Gan Taro No. 1, were used in sequence to carry out the genetic transformation experiment according to the steps of Example 1, and the positive plant rates of taro varieties with different genotypes were compared.

[0099]

[0100] As can be seen from Table 4, the developed taro genetic transformation technology can be used in taro varieties with different genotypes. The positive plant rates of multiple varieties are 48.0% - 80.0%, and the positive conversion rates are 2.7% - 5.0%.

[0101] As mentioned above, the above are only the preferred specific embodiments of the present invention, but the protection scope of the present invention is not limited thereto. Any person skilled in the art within the technical scope disclosed by the present invention, according to the technical solution of the present invention and its inventive concept, makes equivalent substitutions or changes, and all should be covered by the protection scope of the present invention.

Claims

1. A method for genetic transformation of taro, characterized in that: The steps include: S1. Taking the embryonic callus induced from the taro stem tip and multiplying it to obtain newly proliferated embryonic callus; using Agrobacterium to infect the newly proliferated embryonic callus, and then transferring it to a co-culture medium for culture; S2. transferring the embryonic callus after co-cultivation to a differentiation screening medium to obtain resistant buds; S3. Select the robust resistant buds and transfer them to the seedling medium to obtain resistant seedlings; S4. Select the resistant seedlings with a height of 5 to 7 cm, transfer them to a test tube taro induction medium, and obtain resistant test tube taro; S5. Hardening the resistant test tube taro and planting it in a greenhouse; Wherein, the embryonic callus induced in the taro stem tip in step S1 is selected from the stem tip induction of any variety of taro, taro with fruit, Ganyu No. 1 and Ganyu No. 2; The Agrobacterium is Agrobacterium strain GV3101 transformed with pRI101-CeSUC3 recombinant plasmid; The method of using Agrobacterium to infect newly propagated embryonic callus in step S1 specifically comprises: Pre-treat Agrobacterium to obtain Agrobacterium cells; then resuspend the Agrobacterium cells in Agrobacterium infection solution. After resuspension, the concentration of the bacterial solution is adjusted to OD 600 = 0.6~0.8; The newly proliferated embryonic callus was collected in a sterile conical flask, and the bacterial solution was poured into the flask, which was sealed with a sterile sealing film. At room temperature, the flask was first infected on a shaking table at 100 rpm for 15 minutes, and then kept at a vacuum condition of -0.1 MPa for 15 minutes, with a total infection time of 30 minutes. The differentiation screening medium described in step S2 includes the following components: MS + 6-BA 1.0 mg / L + NAA 0.5 mg / L + sucrose 30 g / L + acetosyringone 20 µmol / L~30 µmol / L + timentin 250 mg / L + kanamycin 50 mg / L, pH 5.8~6.0, and the conditions for differentiation culture are: 24°C~26°C, first culture in the dark for 7d~14d, and then culture under light conditions, the light intensity is 2000 Lx~3000 Lx, and the photoperiod is 16h light and 8h dark.

2. The method according to claim 1, characterized in that The method for obtaining the Agrobacterium strain GV3101 transformed with the pRI101-CeSUC3 recombinant plasmid comprises the following steps: The amplification was performed using taro cDNA as a template. The system was as follows: 2 μL DNA template, 8 μL DNA polymerase, 0.5 μL upstream primer, 0.5 μL downstream primer, and ddH2O was added to 20 μL. The procedure was as follows: 94°C pre-denaturation for 5 min, 94°C denaturation for 30 s, 54°C annealing for 20 s, 72°C extension for 45 s, 36 cycles, 72°C final extension for 5 min, and storage at 4°C to obtain the CeSUC3 fragment with homologous recombination sequence. Among them, the upstream primer F: 5'-TCTTCACTGTTGATACATATGATGGACGCCATCTCGATCCG-3', the downstream primer R: 5'-AGAGTTGTTGATTCAGAATTCTTAGCCAAATCCATGAAGACCCG-3'; The overexpression vector pRI101-AN circular plasmid was digested with NdeⅠ and EcoRⅠ restriction endonucleases to obtain linearized pRI101-AN; The linearized pRI101-AN and the CeSUC3 fragment with homologous recombination sequence were mixed at a molar ratio of 1:3, and incubated at 37°C for 30 min. The system was: 1 μL linearized pRI101-AN, 3 μL CeSUC3 fragment with homologous recombination sequence, 5 μL universal enzyme premix, and ddH2O was added to 10 μL. The recombinant mixed solution was transformed into Escherichia coli DH5α, plated, single clones were picked, shaken, colony PCR was performed, and the single clone with the target band was selected for sequencing. The single clone with the correct sequence was selected and shaken again to extract the recombinant plasmid pRI101-CeSUC3 and transformed into Agrobacterium GV3101 with heat shock at 37°C.

3. The method according to claim 1, characterized in that The proliferation medium used in step S1 is MS + sucrose 30g / L + TDZ 2 mg / L + NAA 0.1 mg / L + agar powder 6.5 g / L, pH 5.8-6.0, and the propagation conditions are: culture in the dark at a temperature of 24°C-26°C.

4. The method according to claim 1, characterized in that The Agrobacterium infection solution includes the following components: 1 / 2 MS + sucrose 30 g / L + acetosyringone 20 µmol / L~30 µmol / L, and the pH is 5.8~6.

0.

5. The method according to claim 1, characterized in that Methods for pre-treatment of Agrobacterium include: Place a single colony of Agrobacterium in 2 mL of YEB medium, add the corresponding antibiotics, and culture at 28°C with a shaker at 180 rpm for 12 h until the bacteria are fully revived; Take 500 μL of the revived bacterial solution and add it to 10 mL of YEB medium, add the corresponding antibiotics, and culture it in a shaking incubator at 180 rpm at 28°C for 12 h until the bacterial solution OD reaches 600 Reach 0.9~1.1; Centrifuge at 5000 rpm for 10 min, discard the supernatant, and collect the Agrobacterium cells.

6. The method according to claim 1, characterized in that The co-culture medium in step S1 includes the following components: MS + sucrose 30 g / L + acetosyringone 20 µmol / L~30 µmol / L, pH 5.8~6.0, and culture conditions: 24°C~26°C in the dark for 3 d~4 d.

7. The method according to claim 1, characterized in that The seedling culture medium in step S3 includes the following components: MS +6-BA 1.0 mg / L + NAA 0.5 mg / L + sucrose 30 g / L + timentin 250 mg / L + kanamycin 50 mg / L, pH 5.8~6.0, and the conditions for seedling culture are: temperature 24℃~26℃, light intensity 2000 Lx~3000 Lx, and photoperiod of 16h light and 8h dark.

8. The method according to claim 1, characterized in that The test tube taro induction medium described in step S4 includes the following components: MS + sucrose 80 g / L + timentin 250 mg / L + kanamycin 50 mg / L, pH 5.8-6.0, and the conditions for test tube taro induction culture are: temperature 24°C-26°C, light intensity 2000 Lx-3000 Lx, and photoperiod of 16h light and 8h dark.

9. The method according to claim 1, characterized in that In step S5, the resistant test tube taro is moved to normal temperature conditions, hardened for 3 to 5 days, and then the seedlings are taken out, the base culture medium is cleaned, and the seedlings are planted in a matrix, wherein the matrix is ​​peat: vermiculite with a volume ratio of 2:1, bagged for moisture retention for 3 to 5 days, and grown in a greenhouse. The growth conditions are: temperature 20°C to 30°C, light intensity 2000 Lx to 4000 Lx, and photoperiod of 12h to 14h light and 10h to 12h dark, to obtain surviving plants.

Images