Application of FtHDA8 gene in increasing flavonoid content in Arabidopsis thaliana
By specifically overexpressing the FtHDA8 gene, the flavonoid content in Arabidopsis and buckwheat was successfully improved, the problem of insufficient flavonoid content in the existing technology was solved, and biological activity was improved and industrial high-value development was achieved.
Patent Information
- Application Number
- CN202411366505.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-29
- Publication Date
- 2025-06-24
- Estimated Expiration
- 2044-09-29
AI Technical Summary
The prior art is difficult to effectively increase the flavonoid content in buckwheat, affecting its medicinal and economic value.
By specifically overexpressing the FtHDA8 gene, Arabidopsis thaliana materials with high flavonoid content were successfully cultivated, and the flavonoid content in buckwheat was increased through similar mechanisms.
It significantly increased the flavonoid content in Arabidopsis and buckwheat, enhanced its biological activity, enhanced the processing value and market competitiveness of buckwheat, and promoted the high-value development of the buckwheat industry.
Smart Images

Figure CN119193685B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of molecular breeding, and in particular relates to application of the FtHDA8 gene in improving the flavonoid content of Arabidopsis thaliana. Background Art
[0002] Tartary buckwheat, also known as Tatar buckwheat (Fagopyrum tataricum), is an annual or perennial dicotyledonous plant of the genus Fagopyrum Gaertn. in the Polygonaceae family. Widely distributed worldwide, it is a renowned minor grain crop with both medicinal and edible properties. Known as the "king of grains," buckwheat is rich in nutrients such as protein, fat, starch, dietary fiber, vitamins, and minerals. It is also rich in sugar alcohols, terpenes, phenylpropanoid glycosides, phenolic acids, and flavonoids, active ingredients not found in other grass crops. Tartary buckwheat is rich in flavonoids, found in its roots, stems, leaves, flowers, fruits, and seeds. Flavonoid content in each tissue ranges from 0.5% to 6.3%, making it an important potential source of natural flavonoids. Studies have shown that flavonoids are an important component of the health benefits of tartary buckwheat and its processed products. They offer numerous benefits, including antibacterial and anti-inflammatory, antioxidant, antiviral, cardiovascular and cerebrovascular disease prevention and treatment, lipid-lowering, diabetes prevention and treatment, cancer prevention and treatment, as well as immunity enhancement and improvement of sub-health. Their development prospects are promising. Therefore, breeding tartary buckwheat varieties rich in flavonoids could help increase their economic value.
[0003] In buckwheat, the FtHDA8 gene regulates the expression of genes involved in growth, development, and stress response by influencing chromatin compaction. It also participates in regulating metabolic pathways within the plant, such as the synthesis of secondary metabolites, which is crucial for the nutritional and medicinal value of buckwheat. Therefore, understanding the function and regulatory mechanism of the FtHDA8 gene has potential applications in the genetic improvement of buckwheat. As a histone deacetylase in buckwheat, the FtHDA8 gene has important scientific significance for understanding the biological characteristics, adaptability, and potential agricultural applications of buckwheat. Summary of the Invention
[0004] To solve the above technical problems, the present invention proposes the use of the FtHDA8 gene in increasing the flavonoid content of Arabidopsis thaliana. The present invention provides Arabidopsis thaliana materials with high flavonoid content that are successfully cultivated by specifically overexpressing the FtHDA8 gene.
[0005] The present invention provides the following technical solutions:
[0006] Technical solution 1: Application of the FtHDA8 gene in increasing the flavonoid content of plants, the nucleotide sequence of the coding region of the FtHDA8 gene is shown in SEQ ID No. 1.
[0007] Technical solution 2: Use of a recombinant vector containing the FtHDA8 gene in increasing the flavonoid content in plants.
[0008] Technical solution three: Application of the host bacteria containing the recombinant vector in increasing the flavonoid content of plants.
[0009] Furthermore, by overexpressing the FtHDA8 gene, the flavonoid content of the plant increases; and by inhibiting the FtHDA8 gene, the flavonoid content of the plant decreases.
[0010] Technical Solution 4: A method for regulating plant flavonoid content, comprising the steps of regulating the expression level of the FtHDA8 gene or the protein encoded by it in a recipient plant;
[0011] The nucleotide sequence of the coding region of the FtHDA8 gene is shown in SEQ ID No. 1.
[0012] Furthermore, the flavonoid content of the plant is increased by overexpressing the FtHDA8 gene or the protein encoded by it.
[0013] Furthermore, the plants include Arabidopsis thaliana and Tartary Buckwheat.
[0014] Compared with the prior art, the present invention has the following advantages and technical effects:
[0015] Transgenic Arabidopsis thaliana was obtained by inflorescence transformation mediated by positive Agrobacterium GV3101 and screened for kanamycin resistance. The expression level of FtHDA8 in the transgenic Arabidopsis was determined by qRT-PCR, and the flavonoid content of the FtHDA8-overexpressing Arabidopsis was measured. The results showed that the present invention successfully cultivated Arabidopsis thaliana with high flavonoid content by specifically overexpressing the FtHDA8 gene. The high-flavonoid Arabidopsis plants obtained by the present invention had significantly increased flavonoid content compared to wild-type plants, providing an important germplasm resource for the breeding of flavonoid-rich tartary buckwheat varieties and the study of flavonoid biosynthesis mechanisms. The application of this invention is not limited to Arabidopsis thaliana; similar mechanisms can also be used to increase the flavonoid content and enhance the biological activity of tartary buckwheat. By increasing the flavonoid content of tartary buckwheat, the present invention helps to enhance the processing value and market competitiveness of tartary buckwheat, promoting the high-value development of the tartary buckwheat industry. The implementation of this invention can help expand the cultivation area of tartary buckwheat and promote the diversified development of the local agricultural economy. BRIEF DESCRIPTION OF THE DRAWINGS
[0016] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0017] Figure 1 is the expression level of FtHDA8 gene in wild type (WT) and FtHDA8 overexpression (OX-1 and OX-2) strains;
[0018] Figure 2 Comparison of the phenotypes of wild-type (WT) and FtHDA8-overexpressing (OX-1 and OX-2) lines grown for 7 weeks;
[0019] Figure 3 Comparison of flavonoid content in leaves of wild-type (WT) and FtHDA8 overexpression (OX-1 and OX-2) lines. DETAILED DESCRIPTION
[0020] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0021] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each smaller range between any intermediate value within a stated value or stated range and any other stated value or intermediate value within the stated range is also encompassed by the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.
[0022] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.
[0023] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be illustrative only.
[0024] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.
[0025] Example 1
[0026] Experimental methods
[0027] 1. Construction of FtHDA8 gene (FtPinG0006335800.01) overexpression vector
[0028] FtHDA8 CDS (SEQ ID NO. 1) was synthesized by gene synthesis, and an EcoRI restriction site was added to its 5' end and a HindIII restriction site was added to its 3' end.
[0029] The overexpression vector pEGOEP35S-H-eGFP (https: / / doi.org / 10.1016 / j.jhazmat.2024.134625) was double-digested with EcoRI and HindIII and ligated to the FtHDA8 CDS. The ligation product was transformed into competent Escherichia coli DH5a cells by electroporation, and the transformed bacteria were plated on LB selection plates containing 50 mg / L kanamycin. After plaques appeared, single colonies were picked and inoculated into LB liquid medium (containing 50 mg / L kanamycin), cultured overnight, and the plasmid was extracted and sent to the company for sequencing verification. The sequencing-verified recombinant plasmid was used to transform Agrobacterium tumefaciens GV3101 to ensure that the transformed Agrobacterium contained the target gene.
[0030] The FtHDA8 CDS nucleotide sequence is as follows:
[0031] ATGGCCGTGGCCGGTGAGGAATCGGATAAGATTGACGTCTTCTGGGAGGAGAGAAT
[0032] GCTAAAACACGATACGGGACGCGGCGAATTCGACACAGGCATGGATCCAGGCTTCCTCG
[0033] ACGTCCTTGAGAACCACCCTGAGAACGCCGATAGGGTTAGGAATATGGTCTCCATTCTCC
[0034] GGCGAAGCCCCATCTCCCCCTTCCTTTCATGGCACGCTGGTAGGCCAGCTTCCCTCCCCG
[0035] AATTGCTCTCCTTCCATTCTCAAGATTACATCAATGAATTGGATCAGGCAGATAAATCTGG
[0036] CGGAAAGGAACTGTGTTCTGGAACCTTCTTAAACCCTGGTTCCTGGGAATCCGCTCTTT
[0037] TTGCTGCTGGTACCACTCTCGCAGCCATGAAGCACATACTTGACGGCCATAGAAACATA
[0038] GCTTACGCATTGGTTAGACCTCCTGGCCACCATGCCCAACCCACACAAGCTGATGGATAT
[0039] TGTTTCCTCAACAATGCCGGCCTTGCTGTTCAACTGGCCTTAAATGGAGGTTGCGAAAA
[0040] GGTTGCAGTCATCATCATTGATGTTCATTATGGCAATGGTACTGCACAGGGATTCTATGGA
[0041] TCTGATAAAGTTCTTACTGTGTCCCTTCACATGAATCACGGTTCTTGGGGGGCCTCTCAT
[0042] CCTCAAAGGGGCACTATTCATCAGATTGGTGAAGGGGGAGGCTTAGGGTATAACTTGAA
[0043] CATTCCCTTGCCTAATGGAACTGGAGACATTGGATATGGCTATGCTGTTACTGAGTTGGTA
[0044] GTCCCAGCTGTTAACAACTTTAGGCCTGATGTCATCGTTTTTGTTGTTGGACAGGATTCT
[0045] AGTGCTGGAGGTTAA(SEQ ID NO.1)。
[0046] 2. Agrobacterium activation and propagation
[0047] Streak 10 μL of transformed Agrobacterium tumefaciens culture. Once a single colony grows on the plate, inoculate it into 5 mL of liquid LB (50 mg / L kanamycin and 50 mg / L rifampicin (Rif)) and shake at 28°C, 200 rpm, for 6 hours. Inoculate the culture at a 1:100 ratio (e.g., inoculate 500 μL of activated transformed Agrobacterium tumefaciens culture into 50 mL of liquid LB) and shake overnight at 28°C, 200 rpm. Collect the culture at room temperature, centrifuge, and discard the supernatant; resuspend the culture in suspension buffer.
[0048] 3. Planting and transplanting using 1 / 2MS solid culture medium
[0049] Arabidopsis seeds (variety Col-0) were sterilized in a clean bench. After disinfection, the seeds were transferred to a petri dish containing 1 / 2 MS medium using a pipette and cultured in a culture room. When two true leaves appeared, the seeds were transplanted to nutrient soil. After bolting, the seeds were infected during the flowering stage (pre-cut off any siliques and immersed in the transformed Agrobacterium solution for approximately 30 seconds, gently shaking the inflorescence and shaking off any excess solution when removing it). The seeds were cultured in the dark for 2 days, and then the T0 seeds were harvested by normal culture.
[0050] 3. Screening of resistant plants
[0051] After sterilization, the T0 seed was sown on a solid screening medium containing hygromycin and placed in a light culture room (16 h light / 8 h dark, 22 °C, relative humidity 75%, light intensity 100 μmol·m -2 ·s -1 ) were cultured for 7 weeks, and photographed and recorded. The results are shown in Figure 2 .
[0052] 4. Detection
[0053] Positive seedlings will grow two true leaves and roots, while negative seedlings will die after germination or only grow two cotyledons. The positive seedlings will be transplanted into nutrient soil and planted. After growing for about a week, transgenic Arabidopsis OX-1 and OX-2 strains will be obtained, and DNA will be extracted from the leaves for testing.
[0054] 5. Screening of FtHDA8 overexpressing plants
[0055] The expression levels of FtHDA8 in the overexpression lines OX-1 and OX-2, as well as the wild-type line, were detected by qRT-PCR. The qRT-PCR amplification procedure was referred to the instructions of the SYBR (Servicebio) kit. The qRT-PCR amplification primer sequences are as follows: forward primer (FtHDA8-F): 5'-TGGCGGAAAGGAACTGTGTT-3' (SEQ ID NO.2); reverse primer (FtHDA8-R): 5'-GTATGTGCTTCATGGCTGCG-3' (SEQ ID NO.3); internal reference gene AtACTIN2 forward primer: 5'-TCCCTCAGCACATTCCAGCAGAT-3' (SEQ ID NO.4), reverse primer: 5'-AACGATTCCTGGACCTGCCTCATC-3' (SEQ ID NO.5). The expression levels of FtHDA8 in the overexpression lines OX-1 and OX-2, as well as the wild-type line, are shown in Table 2. Figure 1 Table 1 shows the reaction system for qRT-PCR amplification.
[0056] Table 1 Reaction system
[0057] Reagents Addition amount (μL) SYBR Master Mix (2×) 5 Forward primer 2 Reverse primer 2 cDNA 1
[0058] 6. Determination of flavonoid content
[0059] Take the leaves of the overexpression lines OX-1 and OX-2, as well as the wild-type line, freeze-dry or quickly freeze with liquid nitrogen, weigh 0.5g of sample powder and place it in a 10mL centrifuge tube, dilute to 10mL with 70% methanol, extract by ultrasonic for 30min, and centrifuge (8000r / min, 15min), and take the supernatant for later use. Pipette 0.25mL of extract, 4.75mL of 70% methanol solution, 2mL of AlCl3 solution (0.1mol / L) and 3mL of potassium acetate solution (1mol / L), mix them evenly, keep them away from light for 30min, and measure the absorbance of the sample reaction solution at 415nm. Finally, calculate the flavonoid content in the Arabidopsis leaves of each line according to the rutin standard curve (in mg / g). The results are shown in Figure 3 .
[0060] Figure 1 The results showed that the expression level of FtHDA8 in FtHDA8 overexpression (OX-1 and OX-2) lines was significantly higher than that in the wild type (WT); Figure 2 The results showed that there was no significant phenotypic difference between the FtHDA8 overexpression (OX-1 and OX-2) lines and the wild type (WT) after 7 weeks of light culture, indicating that overexpression of FtHDA8 had no significant effect on the growth of Arabidopsis plants. Figure 3The results showed that the flavonoid content in the leaves of FtHDA8 overexpression (OX-1 and OX-2) lines was significantly higher than that of the wild type (WT), indicating that overexpression of FtHDA8 can significantly promote flavonoid synthesis in Arabidopsis plants.
[0061] The present invention provides Arabidopsis thaliana materials with high flavonoid content that have been successfully cultivated by specifically overexpressing the FtHDA8 gene. The Arabidopsis thaliana plants cultivated using the method of the present invention have a significantly higher flavonoid content than the wild type. The application of the present invention is not limited to Arabidopsis thaliana, but can also increase the flavonoid content in tartary buckwheat through a similar mechanism to enhance its biological activity. By increasing the flavonoid content of tartary buckwheat, the present invention helps to enhance the processing value and market competitiveness of tartary buckwheat, and promote the high-value development of the tartary buckwheat industry. The implementation of the present invention helps to expand the planting area of tartary buckwheat and promote the diversified development of the local agricultural economy.
[0062] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.
Claims
1. The application of FtHDA8 gene in increasing the content of flavonoids in plants is characterized by: The nucleotide sequence of the coding region of the FtHDA8 gene is shown in SEQ ID No. 1; the plant is Arabidopsis thaliana or Tartary buckwheat.
2. Use of a recombinant vector containing the FtHDA8 gene as claimed in claim 1 in increasing the content of flavonoids in plants, characterized in that: The plant is Arabidopsis thaliana or Tartary buckwheat.
3. Use of a host bacteria containing the recombinant vector described in claim 2 in increasing the content of plant flavonoids, characterized in that: The plant is Arabidopsis thaliana or Tartary buckwheat.
4. The use according to any one of claims 1 to 3, characterized in that: By overexpressing the FtHDA8 gene, the flavonoid content of the plant is increased.
5. A method for increasing the content of plant flavonoids, characterized in that: The method comprises the steps of overexpressing the FtHDA8 gene or the protein encoded by it in a recipient plant; The nucleotide sequence of the coding region of the FtHDA8 gene is shown in SEQ ID No. 1; The plant is Arabidopsis thaliana or Tartary buckwheat.
6. The method according to claim 5, characterized in that The flavonoid content of the plant is increased by overexpressing the FtHDA8 gene or the protein encoded by it.
Citation Information
Patent Citations
Tartary buckwheat-derived rhamnosyl transferase and encoding gene and application thereof
CN111647574A
Tartary buckwheat-sourced bHLH transcription factor as well as coding gene and application thereof
CN117343156A