Small RNA for predicting pterygium recurrence

Abstract

The invention discloses application of three small RNA (Ribonucleic Acid) markers, namely i-tRF-8: 26-Glu-TTC-9, 5 'tiRNA-31-GlyGCC-1 and tRF5-30-GlyCCC-3, in preparation of a reagent for predicting pterygium relapse. When the expression quantity of more than one of the three markers in pterygium tissues is too high, the pterygium relapse risk is basically judged to exist, and corresponding clinical treatment preparations or prevention measures are prompted to be taken.

Description

Technical Field

[0001] The invention belongs to the field of biological detection, and relates to the application of small RNA marker molecules i-tRF-8:26-Glu-TTC-9, 5'tiRNA-31-GlyGCC-1 and tRF5-30-GlyCCC-3 in preparing a reagent for predicting the recurrence of pterygium. Background Art

[0002] Pterygium is a common benign ocular surface disease, the phenotype of which is the proliferation of fibrovascular tissue from the conjunctiva and extension to the cornea, leading to inflammation, irregular corneal astigmatism, and visual impairment. The incidence of pterygium is 1.4% in Asian populations and 2.1% in Chinese populations. Many studies have shown that ultraviolet exposure, chronic irritation, inflammation, and genetic factors are associated with the occurrence and development of pterygium. However, its exact pathogenesis has not been fully elucidated. Currently, the conventional treatment for pterygium is surgical excision combined with conjunctival autotransplantation, but the recurrence rate ranges from 2% to 39%. In order to develop strategies for non-surgical treatment or prevention of postoperative recurrence, it is very important to understand the molecular mechanism of pterygium.

[0003] In recent years, many small noncoding RNA molecules have been proposed to contribute significantly to a variety of cellular biological processes and the treatment and prevention of human diseases. Transfer RNA-derived small RNA (tsRNA) is a new type of small noncoding RNA molecule (small RNA), which is divided into tRNA-derived fragments (tRFs) and tRNA-derived stress-induced RNA (tiRNAs), ranging from 14 to 30 nucleotides in length. Studies have shown that, similar to miRNAs, tRFs can bind to Argonaute proteins and Piwi proteins and regulate gene expression by targeting the 3'UTR region. In contrast, tiRNAs are produced by specific cleavage at specific sites in the tRNA anticodon loop. Accumulating evidence shows that tsRNA plays a role in a variety of biological functions, including RNA processing, translation inhibition, DNA damage response regulation, mRNA stability inhibition, apoptosis, and stress response. Some studies have shown that abnormal expression of tsRNA is associated with a variety of pathological conditions, including cancer, neurodegenerative diseases, metabolic disorders, and vascular-related diseases. However, the specific role of tsRNA in the pathogenesis of pterygium remains unclear. Summary of the invention

[0004] In our study of tsRNA (also referred to as small RNA in this article) related to the pathogenesis of pterygium, we used Arrarystar small RNA microarray technology to analyze the tsRNA expression profile in pterygium tissue. Based on the small RNA expression data, a total of 358 tsRNAs were significantly differentially expressed in the pterygium group. Subsequently, the expression levels of significantly dysregulated genes were verified experimentally. We constructed a tsRNA-mRNA regulatory network to predict possible regulatory relationships, which is expected to provide clues to the unknown pathogenesis of RNA and ultimately find potential therapeutic targets for pterygium. By detecting the differentially expressed tsRNA in pterygium tissue, it was found that three tsRNA molecules i-tRF-8:26-Glu-TTC-9, 5'tiRNA-31-GlyGCC-1 and tRF5-30-GlyCCC-3 were highly expressed, suggesting that these three tsRNA molecules can be used as marker small RNA to assess the recurrence risk of pterygium, provide clinicians with personalized treatment plans, reduce the recurrence rate of pterygium, and improve the quality of life of patients. Therefore, the present invention includes the following technical solutions:

[0005] One aspect of the present invention provides the use of three small RNA (ie, tsRNA) molecular markers i-tRF-8:26-Glu-TTC-9, 5'tiRNA-31-GlyGCC-1 and tRF5-30-GlyCCC-3 in the preparation of a reagent for predicting the recurrence of pterygium.

[0006] Among them, the nucleotide sequence of i-tRF-8:26-Glu-TTC-9 is:

[0007] TGGTTCAGTGGTAGAATT(SEQ ID NO:7);

[0008] The nucleotide sequence of 5'tiRNA-31-GlyGCC-1 is:

[0009] GCATGGGTGGTTCAGTGGTAGAATTCTCGCC (SEQ ID NO:8);

[0010] The nucleotide sequence of tRF5-30-GlyCCC-3 is:

[0011] GCATTGGTGGTTCAATGGTAGAATTCTCGC (SEQ ID NO:9).

[0012] Specifically, the reagent is used to detect the expression levels of three small RNA molecules i-tRF-8:26-Glu-TTC-9, 5'tiRNA-31-GlyGCC-1 and tRF5-30-GlyCCC-3. The expression levels of the markers especially refer to the expression levels of the three tsRNAs in pterygium tissue.

[0013] In one application method, if the expression level of one or more, preferably two or more or three of the three markers is higher than the average level of pterygium tissue that has not recurred within one year after surgery by more than 1.9 times, for example, more than 2 times, preferably more than 3 times, and more preferably more than 5 times, then it is determined that there is a risk of pterygium recurrence.

[0014] For example, if the expression of the marker i-tRF-8:26-Glu-TTC-9 is more than 230% higher than the normal level, it is judged to be at risk of pterygium recurrence;

[0015] The expression level of the marker 5'tiRNA-31-GlyGCC-1 is higher than the normal level by more than 205%, which indicates a risk of pterygium recurrence; or

[0016] The expression level of the marker tRF5-30-GlyCCC-3 is more than 190% higher than the normal level, which is judged as a risk of pterygium recurrence.

[0017] Preferably, the above reagent can be a kit, namely, i-tRF-8:26-Glu-TTC-9, 5'tiRNA-31-GlyGCC-1 and tRF5-30-GlyCCC-3 detection kit.

[0018] The above-mentioned kit can be used to detect the expression levels of tsRNA molecules i-tRF-8:26-Glu-TTC-9, 5'tiRNA-31-GlyGCC-1 and tRF5-30-GlyCCC-3 in pterygium tissue.

[0019] In a specific embodiment, the kit includes: an RNA extraction and separation system for extracting and isolating total RNA from a pterygium tissue sample; a reverse transcription system for reverse transcribing total RNA into cDNA; and primers for detecting i-tRF-8:26-Glu-TTC-9, 5'tiRNA-31-GlyGCC-1 and tRF5-30-GlyCCC-3 and internal reference genes.

[0020] The above-mentioned internal reference gene is selected from U6, ACTB, GAPDH or 18sRNA, more preferably U6.

[0021] Furthermore, the above kit also includes common biochemical reagents for qRT-PCR reaction for detecting the expression levels of i-tRF-8:26-Glu-TTC-9, 5'tiRNA-31-GlyGCC-1 and tRF5-30-GlyCCC-3.

[0022] The above primers are used to amplify the small RNA molecule and the internal reference gene U6 by fluorescent real-time quantitative PCR, including:

[0023] i-tRF-8:26-Glu-TTC-9 forward primer: 5'-GCGGAATTCAGGCTGGTGGT-3' (SEQ ID NO: 1),

[0024] 5'tiRNA-31-GlyGCC-1 forward primer: 5'-CGGGAATTCAGGCTGGTGGT-3' (SEQ ID NO: 2),

[0025] tRF5-30-GlyCCC-3 forward primer: 5'-GCGGAATTCAGGCTGGTGGT-3' (SEQ ID NO: 3),

[0026] Internal reference U6 forward primer: 5'-CTCGCTTCGGCAGCACA-3' (SEQ ID NO: 4),

[0027] Internal reference U6 reverse primer: 5'-AACGCTTCACGAATTTGCGT-3' (SEQ ID NO: 5),

[0028] Small RNA universal reverse primer: 5'-AGTGCAGGGTCCGAGGTATT-3' (SEQ ID NO: 6).

[0029] Preferably, the above-mentioned kit further comprises a carrier recording a mathematical model for predicting the risk of recurrence of pterygium, wherein the mathematical model is:

[0030] Relative expression of target gene = 2 -△△CT , △CT=CT (目的基因) -CT (U6) , △△CT=△CT (实验组) -△CT (对照组) The target genes included i-tRF-8:26-Glu-TTC-9, 5'tiRNA-31-GlyGCC-1 and tRF5-30-GlyCCC-3, the "experimental group" was the pterygium tissue that recurred within 1 year after surgery, and the "control group" was the pterygium tissue that did not recur within 1 year after surgery.

[0031] The mathematical model is based on the commonly used formula in fluorescence quantitative PCR analysis: △△CT(n)=△Ct(n)-△Ct(1), where n refers to the sample to be tested, 1 specifically refers to the control sample, △△CT(n)=△CT(n)-△CT(control), and the final formula is expression level=2^(-△△CT). There is ready-made calculation software for this formula, and researchers can simply input experimental data into a computer or PCR instrument to obtain the calculation results.

[0032] In one embodiment, the carrier is an instruction manual, which can be written on a bottle, test tube, and the like, or on a separate piece of paper, or on the outside or inside of a container, such as a paper with an operation demonstration video APP download window such as a QR code. The instruction manual can also be in the form of multimedia, such as a CD, U disk, network disk, etc.

[0033] Optionally, the reagent used for reverse transcription in the above kit is MicroRNA Reverse Transcription Kit (EZBmiRT4, China), and the reaction system includes: Total RNA, Stem-loop primer, miRNA L-RT Solution mix, miRNA L-RT Enzyme mix, RNase-free water;

[0034] The reagents used for RT-qPCR reactions included EZ-probe qPCR Master Mix (EZB-miRprobe-R2, China).

[0035] Furthermore, the above-mentioned kit also includes a total RNA mixed sample extracted from pterygium tissue that has not recurred within 1 year after surgery, and its PCR detection value is used as a reference value for normal expression.

[0036] The second aspect of the present invention provides the use of the above three small RNA marker molecules i-tRF-8:26-Glu-TTC-9, 5'tiRNA-31-GlyGCC-1 and tRF5-30-GlyCCC-3 in screening drugs for treating or preventing pterygium and / or treating or preventing the recurrence of pterygium, wherein one or more, for example, two or more or three of them are used as drug targets.

[0037] The above-mentioned drug is a substance that inhibits the expression of i-tRF-8:26-Glu-TTC-9, 5'tiRNA-31-GlyGCC-1 or tRF5-30-GlyCCC-3, that is, an inhibitor of i-tRF-8:26-Glu-TTC-9, 5'tiRNA-31-GlyGCC-1 or tRF5-30-GlyCCC-3 expression.

[0038] The present invention found that three tsRNA molecules are highly expressed in recurrent pterygium tissues and can be used as markers for high risk of pterygium recurrence. By detecting the expression levels of three tsRNA molecules in pterygium tissues, the risk of pterygium recurrence can be evaluated, providing clinicians with personalized treatment plans, reducing the recurrence rate of postoperative pterygium, and improving the quality of life of patients. In addition, it has important clinical significance and application value for the development of drugs for treating and preventing pterygium recurrence. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 It is a statistical graph of the expression levels of three tsRNA molecules i-tRF-8:26-Glu-TTC-9, 5'tiRNA-31-GlyGCC-1 and tRF5-30-GlyCCC-3 in pterygium tissues of the normal test group and the pterygium recurrence group in the embodiment. DETAILED DESCRIPTION

[0040] tsRNA is a new type of biomarker. Different from traditional biomarkers, it is not only stable, minimally invasive, easy to detect, but also quantitatively precise.

[0041] In the clinical surgical practice and postoperative follow-up of pterygium and the study of pterygium recurrence, we used a gene analysis strategy to focus on the analysis and detection of differentially expressed tsRNA in pterygium tissue, compared the expression levels of many tsRNA molecules in pterygium tissue of patients with no recurrence of pterygium after surgery and patients with recurrence of pterygium after surgery, and obtained a database of differentially expressed small RNA expression and specific markers in pterygium tissue. Among them, the expression differences of the three tsRNA molecules i-tRF-8:26-Glu-TTC-9, 5'tiRNA-31-GlyGCC-1, and tRF5-30-GlyCCC-3 were the most significant, and they can basically be identified as pterygium recurrence markers. Based on them, a detection kit can be constructed to determine the risk of pterygium recurrence in clinical practice. Furthermore, they can be used as drug targets to screen drug candidates for the treatment and prevention of pterygium recurrence.

[0042] The kit of the present invention includes RNA extraction reagents and biochemical reagents commonly used in qRT-PCR reactions, as well as specific primers and probes for qRT-PCR. For example, reagents for RNA extraction include: TRIzol reagent (Ambion), mirVanamiRNA Isolation Kit (Ambion, TX, USA), which is used to extract total RNA from pterygium tissue. Reagents for reverse transcription include: MicroRNA Reverse Transcription Kit (EZBmiRT4, China), which contains reverse transcription buffer (5×), high-efficiency reverse transcriptase, dNTP mixture, Stem-loop primer (20×), and DEPC water. The reagents used for qRT-PCR reaction include: EZ-probe qPCR Master Mix (EZB-miRprobe-R2, China), SYBR Green fluorescent dye mixture (2×), ROX reference dye, DEPC water; specific primers and probes, including but not limited to i-tRF-8:26-Glu-TTC-9, 5'tiRNA-31-GlyGCC-1, tRF5-30-GlyCCC-3, etc.; and also include universal internal reference PCR primers. Among them, in order to facilitate detection and avoid detection errors caused by confusion of primer reagents, the present invention cleverly designs a universal reverse PCR primer, that is, i-tRF-8:26-Glu-TTC-9, 5'tiRNA-31-GlyGCC-1, tRF5-30-GlyCCC-3 and the reverse PCR primer of the internal reference U6 share one. In addition, the kit also includes a mixed sample of total RNA extracted from pterygium tissue, and its detection value is used as a reference value for normal expression. After the kit detects the expression levels of three small RNA molecules in pterygium tissue, the recurrence risk of pterygium can be evaluated.

[0043] It is easy for those skilled in the art to understand that the kit of the present invention may also include at least one of the following items: a carrying tool, whose space is divided into a limited space that can accommodate one or more containers, 96-well plates or strips, such as reagent kits, medicine bottles, test tubes, and the like, each of which contains a separate component for the method of the present invention; instructions, which can be written on bottles, test tubes and the like, or on a separate piece of paper, or on the outside or inside of the container, such as a paper with an operation demonstration video APP download window such as a QR code, and the instructions can also be in the tangible or intangible form of multimedia, such as a USB flash drive, a network disk, etc.

[0044] In this paper, real-time quantitative PCR amplification and melting curve analysis were used to obtain the threshold cycle (CT) value and the derived values ​​△CT and △△CT to establish a mathematical model for judging the recurrence risk of pterygium, and the relative expression level of the target gene was corrected by the internal reference gene.

[0045] As a specific application of the above mathematical model, it allows to be input into the information processing module of a gene detection device such as a gene sequencer, or input into the information processing module of a PCR instrument in the form of computer software (computer program). Moreover, the above mathematical model also allows to be input into an intelligent medical system or a doctor's computer in the form of computer software (computer program) to help doctors determine whether patients have a risk of pterygium recurrence, implement corresponding preventive measures, and formulate a return visit plan.

[0046] When the expression level (or expression amount) of one, two or three of the three tsRNA markers in pterygium tissue increases significantly, it indicates that there may be a risk of pterygium recurrence, and necessary preventive measures need to be taken. As used herein, "(expression level) increase", "enhancement" or "increase" can mean an increase of at least 20% compared to a reference level (such as pterygium tissue that has not recurred within 1 day after surgery), for example, an increase of at least about 40%, or at least about 60%, or at least about 80%, or at least about 100%, or any increase between 50% and 200%, or an increase of at least about 2 times, or at least about 3 times, or at least about 4 times, or at least about 5 times, or at least about 10 times compared to a reference level.

[0047] It should be understood that when expressing numerical characteristics in this article, the terms "about", "approximately" or "around" mean that the number represented may have an error range or floating range of ±10%, ±8%, ±6%, ±4% or ±2%.

[0048] In the description of the technical solutions of the present invention, the term "and / or" used in terms such as "A and / or B", "A and / or B" is intended to include both A and B; A or B; A (alone); and B (alone). Similarly, the term "and / or" used in phrases such as "A, B and / or C" is intended to cover each of the following embodiments: A, B and C; A, B or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); C (alone).

[0049] The method for using the kit of the present invention may include, for example, the following steps:

[0050] (1) Total RNA was extracted from surgically removed tissues of patients with pterygium, including total RNA from pterygium tissue control samples of patients who had been cured by surgery and had no recurrence within 1 year after surgery and patients with recurrence;

[0051] (2) using a reverse transcription reagent to reverse transcribe the RNA obtained in step (1) into cDNA;

[0052] (3) Detect the expression levels of three tsRNA markers using qRT-PCR reagents and specific primers;

[0053] (4) quantification of tsRNA expression levels by the 2^-ΔΔCt method, normalized to U6 for quantification;

[0054] (5) If the expression level of one or more of the three tsRNA markers is abnormally elevated (for example, the expression level of i-tRF-8:26-Glu-TTC-9 is more than 230% higher than the normal level, the expression level of 5'tiRNA-31-GlyGCC-1 is more than 205% higher than the normal level, and / or the expression level of tRF5-30-GlyCCC-3 is more than 190% higher than the normal level), it is determined that there is a risk of pterygium recurrence, and the patient is advised to take necessary preventive measures and develop a follow-up plan.

[0055] Through the above steps, the recurrence risk of pterygium can be accurately assessed, providing clinicians with personalized treatment plans, reducing the recurrence rate of pterygium, and improving the quality of life of patients.

[0056] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are only for illustrative purposes and are not intended to limit the present invention.

[0057] Example

[0058] This article involves the addition amount, content and concentration of various substances, and the percentages mentioned here refer to the mass percentages unless otherwise specified.

[0059] The primers in the examples were synthesized and provided by Sangon Biotech (Shanghai) Co., Ltd. The commercial kits used in the examples were operated according to their instructions.

[0060] Example 1: Sample collection and tsRNA content determination

[0061] 1. Sample collection and processing: All conjunctival tissues were obtained from patients with primary pterygium who underwent surgical resection in the Department of Ophthalmology, Zhongshan Hospital Affiliated to Fudan University. The samples were divided into pterygium tissue and normal conjunctival tissue, the latter of which was obtained from the nasal bulbar conjunctiva close to the limbus. The excised tissues were stored at -80°C until RNA extraction. Among them, there were 3 cases of pterygium tissue from patients who had been cured by surgery and had no recurrence within 1 year after surgery (Group 1, Non-recurrence), and 3 cases of primary pterygium from patients who had been cured by surgery and had recurrence within 1 year after surgery (Group 2, recurrence).

[0062] 2. RNA extraction: Total RNA was extracted from three pairs of pterygium tissues and normal conjunctival tissues using the mirVana miRNA Isolation Kit (Ambion, TX, USA). The specific steps are as follows:

[0063] (1) Grind the tissue sample into powder in liquid nitrogen.

[0064] (2) Add 1.5 mL of TRIzol reagent and mix thoroughly.

[0065] (3) Incubate at room temperature for 5 minutes.

[0066] (4) Add 0.3 mL of chloroform and shake vigorously for 15 seconds.

[0067] (5) Incubate at room temperature for 3 minutes.

[0068] (6) Centrifuge at 12000 rpm for 15 min at 4°C.

[0069] (7) Collect the supernatant, add 0.5 mL of isopropanol, and mix well.

[0070] (8) Incubate at room temperature for 10 minutes.

[0071] (9) Centrifuge at 12,000 rpm for 10 min at 4°C.

[0072] (10) Discard the supernatant and wash the precipitate with 1 mL of 75% ethanol.

[0073] (11) Centrifuge at 7500 rpm for 5 min at 4°C.

[0074] (12) Discard the supernatant and air-dry the precipitate.

[0075] (13) Dissolve RNA in DEPC water and measure its concentration and purity.

[0076] 3. RNA reverse transcription and amplification reaction conditions:

[0077] Reverse transcription reaction: using the kit MicroRNA Reverse Transcription Kit (EZBmiRT4, China), the total reaction system is 15μL, including: Total RNA 3.4μg, Stem-loop primer (10μM) 2μL, miRNAL-RT Solution mix 4μL, miRNA L-RT Enzyme mix 1μL, RNase-free water to 15μL. Reaction conditions: 16℃30 minutes, 42℃30 minutes, 85℃5 minutes.

[0078] 4. tsRNA fluorescence quantitative RT-PCR reaction system and reaction conditions:

[0079] PCR reaction: EZ-probe qPCR Master Mix (EZB-miRprobe-R2, China) was used, and the total reaction system was 20 μL, including: SYBR Green Mix (2×) 10 μL, cDNA template 1 μL, specific primer (10 μM) 0.8 μL, universal reverse primer (10 μM) 0.8 μL, RNase-free water to 20 μL. Reaction conditions: 95°C pre-denaturation for 10 minutes; 95°C for 15 seconds, 60°C for 1 minute, a total of 40 cycles. The tsRNA expression level was quantified by the 2^-ΔΔCt method and normalized to U6.

[0080] Among them, the primer nucleotide sequence information is as follows:

[0081] i-tRF-8:26-Glu-TTC-9 forward primer: 5'-GCGGAATTCAGGCTGGTGGT-3'

[0082] 5' tiRNA-31-GlyGCC-1 forward primer: 5'-CGGGAATTCAGGCTGGTGGT-3'

[0083] tRF5-30-GlyCCC-3 forward primer: 5'-GCGGAATTCAGGCTGGTGGT-3'

[0084] Internal reference U6 forward primer: 5'-CTCGCTTCGGCAGCACA-3'

[0085] Internal reference U6 reverse primer: 5'-AACGCTTCACGAATTTGCGT-3'.

[0086] Results and Discussion

[0087] The statistical results of the expression levels of three tsRNA molecules i-tRF-8:26-Glu-TTC-9, 5'tiRNA-31-GlyGCC-1 and tRF5-30-GlyCCC-3 in surgically resected tissues of patients with pterygium are shown in Table 1 .

[0088] Table 1. Average expression levels of three tsRNAs in pterygium tissues of normal subjects and pterygium recurrence group

[0089] Grouping i-tRF-8:26-Glu-TTC-9 5'tiRNA-31-GlyGCC-1 tRF5-30-GlyCCC-3 Group 1 1.08333333 1.4 0.95333333 Group 2 5.33333333 4.35333333 3.54333333

[0090] As can be seen from Table 1, the i-tRF-8:26-Glu-TTC-9 level in the recurrence group was 237.3703063% higher than that in the non-recurrence group; the 5'tiRNA-31-GlyGCC-1 level in the recurrence group was 205.3760671% higher than that in the non-recurrence group; and the tRF5-30-GlyCCC-3 level in the recurrence group was 192.9620246% higher than that in the non-recurrence group.

[0091] It should be understood that after reading the above content of the present invention, those skilled in the art may make various changes or modifications to the present invention, and these equivalent forms also fall within the protection scope of the present invention.

Claims

1. Application of small RNA molecular markers i-tRF-8:26-Glu-TTC-9, 5'tiRNA-31-GlyGCC-1 and tRF5-30-GlyCCC-3 in the preparation of reagents for predicting the recurrence of pterygium.

2. The use according to claim 1, characterized in that The reagent is used to detect the expression levels of the small RNA molecules i-tRF-8:26-Glu-TTC-9, 5'tiRNA-31-GlyGCC-1 and tRF5-30-GlyCCC-3, and the expression level of the marker refers to the expression level in pterygium tissue.

3. The use according to claim 2, characterized in that If the expression level of one or more, preferably two or more or three of the three markers is more than 1.9 times higher than the average level of pterygium tissue that has not recurred within 1 year after surgery, it is determined that there is a risk of pterygium recurrence.

4. The use according to claim 2, characterized in that The reagent is a kit, namely, i-tRF-8:26-Glu-TTC-9, 5'tiRNA-31-GlyGCC-1 and tRF5-30-GlyCCC-3 detection kit.

5. The kit according to claim 5, characterized in that include: An RNA extraction and isolation system for extracting and isolating total RNA from pterygium tissue samples; a reverse transcription system for reverse transcribing total RNA into cDNA; primers for detecting i-tRF-8:26-Glu-TTC-9, 5'tiRNA-31-GlyGCC-1 and tRF5-30-GlyCCC-3 and internal reference genes.

6. The kit according to claim 5, characterized in that The primers are used to amplify the small RNA molecule and the internal reference gene U6 by fluorescent real-time quantitative PCR, including: i-tRF-8:26-Glu-TTC-9 forward primer: 5'-GCGGAATTCAGGCTGGTGGT-3' (SEQ ID NO: 1), 5'tiRNA-31-GlyGCC-1 forward primer: 5'-CGGGAATTCAGGCTGGTGGT-3' (SEQ ID NO: 2), tRF5-30-GlyCCC-3 forward primer: 5'-GCGGAATTCAGGCTGGTGGT-3' (SEQ ID NO: 3), Internal reference U6 forward primer: 5'-CTCGCTTCGGCAGCACA-3' (SEQ ID NO: 4), Internal reference U6 reverse primer: 5'-AACGCTTCACGAATTTGCGT-3' (SEQ ID NO: 5), Small RNA universal reverse primer: 5'-AGTGCAGGGTCCGAGGTATT-3' (SEQ ID NO: 6).

7. The kit according to claim 5, characterized in that Also included is a vector recording a mathematical model for predicting the risk of recurrence of pterygium, wherein the mathematical model is: Relative expression of target gene = 2 -△△CT , △CT=CT (目的基因) -CT (U6) , △△CT=△CT (实验组) -△CT (对照组) The target genes included i-tRF-8:26-Glu-TTC-9, 5'tiRNA-31-GlyGCC-1 and tRF5-30-GlyCCC-3. The "experimental group" was the pterygium tissue that recurred 1 year after surgery, and the "control group" was the pterygium tissue that did not recur within 1 year after surgery.

8. The kit according to claim 7, characterized in that It also includes mixed total RNA samples extracted from pterygium tissues that did not recur within 1 year after surgery, and its PCR detection value is used as a reference value for normal expression.

9. Use of small RNA marker molecules i-tRF-8:26-Glu-TTC-9, 5'tiRNA-31-GlyGCC-1 and tRF5-30-GlyCCC-3 in screening drugs for treating or preventing pterygium and / or treating or preventing the recurrence of pterygium, characterized in that: One or more of them serve as drug targets.

10. The use according to claim 11, characterized in that The drug is a substance that inhibits the expression of i-tRF-8:26-Glu-TTC-9, 5'tiRNA-31-GlyGCC-1 or tRF5-30-GlyCCC-3, that is, an inhibitor of i-tRF-8:26-Glu-TTC-9, 5'tiRNA-31-GlyGCC-1 or tRF5-30-GlyCCC-3 expression.

Images