A SNP molecular marker associated with resistance to frog iridovirus disease in largemouth bass and its application

Abstract

The present invention relates to a SNP molecular marker related to the trait of largemouth black bass against frog iridescence virus disease and its application, belonging to the technical field of molecular markers. The present invention provides a SNP molecular marker related to the trait of largemouth black bass against frog iridescence virus, the SNP molecular marker is located at g38928188 of chromosome 3 of the largemouth black bass genome, is a G / T allele mutation, and has genotypes of GG, GT and TT. The GenBank accession number of the largemouth black bass genome is: ASM1485139v1. The present invention determines a SNP molecular marker g 38928188G>T on chromosome 3 of largemouth black bass, and the SNP marker of the present invention is closely related to the resistance and susceptibility of largemouth black bass to frog iridescence virus. Selecting individuals with a resistant genotype in parent breeding is conducive to improving the disease resistance of offspring and accelerating the cultivation process of disease-resistant fine varieties of largemouth black bass.

Description

Technical Field

[0001] The invention relates to the technical field of molecular markers, and in particular to a SNP molecular marker related to the resistance of largemouth bass to frog iridovirus disease and an application thereof. Background Art

[0002] Largemouth bass ranavirus (LMBV) is a cytoplasmic DNA virus belonging to the family Iridoviridae and the genus Ranavirus. The main symptoms of largemouth bass infected with LMBV are muscle necrosis, ulceration on the body surface, bright red ulceration, redness and swelling at the base of the fins, and secondary bacterial and fungal infections, or blood clots in the heart cavity, and dilation and congestion of the branchial arteries to form "blood sinuses". At present, the main treatment methods are water disinfection, application of Chinese herbal medicine to enhance the resistance of largemouth bass, and fish drugs, but it is difficult to enhance the resistance of largemouth bass to LMBV from the root.

[0003] Patent CN102816868A discloses a dual PCR method for detecting largemouth bass iridovirus, which can simultaneously detect and identify two iridoviruses, frog virus and cytomegalovirus. Patents CN118127178A, CN117965755A and CN117947179A disclose a series of SNP markers related to the antiviral properties of largemouth bass and their applications, which are used to screen largemouth bass parents with resistance to viral infection, so that individuals with strong antiviral ability and genetic stability can be quickly obtained for production and breeding. However, there is currently a lack of SNP molecular markers for identifying largemouth bass resistance to frog iridovirus, making it difficult to identify and breed largemouth bass with high resistance to frog iridovirus. Summary of the invention

[0004] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a SNP molecular marker related to the resistance of largemouth bass to frog iridovirus disease and its application.

[0005] To achieve the above object, the technical solution adopted by the present invention is:

[0006] In the first aspect, the present invention provides a SNP molecular marker related to the frog iris virus resistance trait of largemouth bass. The SNP molecular marker is located at g 38928188 of chromosome 3 of the largemouth bass genome, is a G / T allele mutation, and the genotypes are GG, GT and TT. The GenBank accession number of the largemouth bass genome is: ASM1485139v1.

[0007] The present invention determines and verifies a SNP molecular marker associated with the largemouth bass's resistance to frog iridescence virus through genome wide association study (GWAS), and determines the largemouth bass's resistance to frog iridescence virus by detecting the genotype of the SNP molecular marker.

[0008] In a second aspect, the present invention provides a reagent for detecting the genotype of the SNP molecular marker, wherein the reagent is a primer set, and the nucleotide sequence of the primer set is shown in SEQ ID NOs: 1-3.

[0009] In a third aspect, the present invention provides the use of the reagent in preparing a product for detecting the resistance of largemouth bass to frog iridovirus.

[0010] In a fourth aspect, the present invention provides the use of the reagent in detecting the resistance of largemouth bass to frog iridovirus.

[0011] In a fifth aspect, the present invention provides the use of the reagent in breeding largemouth bass varieties resistant to frog iris virus.

[0012] In a sixth aspect, the present invention provides a kit for detecting the anti-frog iridovirus trait of largemouth bass, wherein the kit contains the reagent.

[0013] In a specific embodiment of the present invention, the kit contains Flu-Arms 2×PCR Mix.

[0014] In a specific embodiment of the present invention, the kit contains water.

[0015] In the seventh aspect, the present invention provides a method for detecting the frog iridescence virus resistance of largemouth bass, detecting the genotype of the SNP molecular marker of the largemouth bass sample, the SNP molecular marker is located at g38928188 of chromosome 3 of the largemouth bass genome, is a G / T allele mutation, and the frog iridescence virus resistance of the sample with the genotype of GG is significantly better than that of the GT and TT genotypes, and the GenBank accession number of the largemouth bass genome is: ASM1485139v1.

[0016] Furthermore, the reagent or the kit is used to detect the genotype of the SNP molecular marker of the largemouth bass sample.

[0017] Furthermore, the method comprises the following steps:

[0018] S1: Extract genomic DNA of largemouth bass to be tested;

[0019] S2: using the genomic DNA in step S1 as a template, performing PCR amplification to obtain a PCR amplification product;

[0020] S3: Determine the genotype of the SNP molecular marker of the largemouth bass to be tested in the PCR amplification product of step S2.

[0021] Furthermore, PCR amplification is performed using the genomic DNA of step S1 as a template and primers having nucleotide sequences shown in SEQ ID NOs: 1 to 3 to obtain a PCR amplification product. The nucleotide sequence of the PCR amplification product is shown in SEQ ID NO: 7.

[0022] The PCR amplification program was as follows: 95°C for 10 min; 95°C for 15 s, gradient annealing from 61 to 55°C for 60 s (-0.6°C / cycle, decreasing by 0.6°C each cycle), for 10 cycles; 95°C for 15 s, 55°C for 60 s, for a total of 30 cycles; 30°C for 30 s.

[0023] The PCR amplification system can be: DNA template 5ng~250ng, Flu-Arms 2×PCR Mix 5.0μL, upstream typing primer F1 (10μM) 0.05μL~0.25μL, downstream typing primer F2 (10μM) 0.05μL~0.25μL, downstream universal primer R (10μM) 0.1μL~0.5μL, supplemented with ddH2O to 10μL.

[0024] In a specific embodiment of the present invention, the PCR amplification system is: 5ng to 50ng DNA template, 5μL Flu-Arms2×PCRMix, 0.1μL upstream typing primer F1 (10μM), 0.1μL downstream typing primer F2 (10μM), 0.3μL downstream universal primer R (10μM), supplemented with ddH2O to 10μL.

[0025] The SNP molecular marker was located at the 25bp at the 5' end of the amplified product (i.e., g 38928188 of chromosome 3 of the reference largemouth bass genome with GenBank accession number: ASM1485139v1). Largemouth bass samples with the GG genotype were significantly more resistant to frog iris virus than those with the GT and TT genotypes, and survived longer after infection with frog iris virus.

[0026] In an eighth aspect, the present invention provides a method for breeding a largemouth bass variety resistant to frog iris virus, wherein the method is used to detect the genotype of the SNP molecular marker of a largemouth bass sample, and a largemouth bass with the SNP molecular marker genotype of GG is obtained as a parent, and the parents are bred to obtain a largemouth bass variety resistant to frog iris virus.

[0027] Compared with the prior art, the present invention has the following beneficial effects:

[0028] The present invention takes largemouth bass as the research object, and determines a SNP molecular marker g 38928188G>T on chromosome 3 of largemouth bass. The SNP marker of the present invention is closely related to the resistance and susceptibility of largemouth bass to frog iris virus, and the resistance and susceptibility of samples with genotype GG to frog iris virus are significantly better than GT and TT genotypes. The SNP molecular marker of the present invention is closely related to the resistance and susceptibility of largemouth bass to frog iris virus. Selecting individuals with resistant genotypes in parent breeding is conducive to improving the disease resistance of offspring. The marker of the present invention is used for auxiliary breeding to accelerate the cultivation process of disease-resistant fine varieties of largemouth bass. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 Comparison of the survival rates of largemouth bass between the experimental group and the control group.

[0030] Figure 2 The symptoms of largemouth bass before and after poisoning. A is a healthy largemouth bass; B is a largemouth bass that became ill after poisoning.

[0031] Figure 3 is the distribution density of SNP molecular markers on the chromosomes of largemouth bass.

[0032] Figure 4 The results of genome-wide association analysis of largemouth bass resistant to frog iridovirus genotypes. A is a Manhattan plot; B is a quantile-quantile plot.

[0033] Figure 5 The fluorescence signal diagram of different genotypes of SNP1 and SNP2 molecular markers in PCR detection of largemouth bass, where A is g 38928188G>T; B is g 38943495G>A.

[0034] Figure 6 The survival time statistics of different genotypes of SNP1 and SNP2 molecular markers in largemouth bass. A is g38928188G>T; B is g38943495G>A. DETAILED DESCRIPTION

[0035] To better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific examples. Other materials, reagents, etc. used in the examples, unless otherwise specified, can be obtained from commercial sources.

[0036] Example 1 A kit for detecting resistance to iridovirus of largemouth bass frog

[0037] 1. Composition of the kit

[0038] (1) Primer set:

[0039] F1: GAAGGTGACCAAGTTCATGCTATACAAGAGAGAAAAGTCTCTATC G (SEQ ID NO: 1);

[0040] F2: GAAGGTCGGAGTCAACGGATTATACAAGAGAGAAAAGTCTCTATC T (SEQ ID NO: 2);

[0041] R: AGGAGAAATCTGCACTCTGAAACTCAGAG (SEQ ID NO: 3)

[0042] (2) Other reagents: Flu-Arms 2×PCR Mix and water.

[0043] 2. How to use the kit

[0044] (1) extracting genomic DNA of largemouth bass to be tested and using it as a DNA template for PCR detection;

[0045] (2) Perform PCR detection to obtain a PCR amplification product, the nucleotide sequence of which is shown in SEQ ID NO: 4.

[0046] The PCR detection system is shown in Table 1, and the PCR detection conditions are shown in Table 2.

[0047] Table 1

[0048]

[0049]

[0050] Table 2

[0051]

[0052] (3) Determine the genotype of the SNP molecular marker in the amplified product to determine the resistance of the largemouth bass to frog iridovirus.

[0053] 3. Interpretation of results

[0054] When the SNP molecular marker was located at the 25 bp at the 5' end of the amplified product (SEQ ID NO: 7) (i.e., g 38928188 of chromosome 3 of the reference largemouth bass genome with GenBank accession number: ASM1485139v1), largemouth bass samples with GG genotype were significantly more resistant to frog iridovirus than those with GT and TT genotypes, and survived longer after infection with frog iridovirus.

[0055] Example 2 A method for breeding largemouth bass resistant to frog iris virus

[0056] The genotype of the largemouth bass was detected using the kit of Example 1, and the largemouth bass with the SNP molecular marker GG genotype was selected as the parent, and the offspring was cultivated to obtain the largemouth bass variety resistant to frog iris virus.

[0057] Example 3 Verification of the breeding method for largemouth bass resistant to frog iris virus

[0058] The method of Example 2 was used to obtain a largemouth bass variety resistant to frog iris virus, and 1000 largemouth bass varieties resistant to frog iris virus with a body length of 4 to 5 cm were selected as the experimental group; and 1000 offspring produced by a common largemouth bass population with a body length of 4 to 5 cm were selected as the control group.

[0059] Virus challenge and record: Each group of largemouth bass was intraperitoneally injected with artificial largemouth bass frog iris virus (LMBV), with a virus dose of 10 4 TCID 50 / fish, and the water temperature for breeding is 28℃.

[0060] After the infection, the fish were observed once in the morning, noon and evening every day, the disease situation of largemouth bass was recorded, and the survival rate 14 days after the infection was calculated.

[0061] A few of the selected offspring showed slight ulceration on their bodies, while the non-selected offspring had severe ulceration on their back muscles.

[0062] like Figure 1 As shown, the survival rate of largemouth bass in the experimental group could reach 36.73%, which was significantly higher than that in the control group.

[0063] Example 4 Determination of SNP sites

[0064] 1. Conduct poison attack on largemouth bass and collect samples

[0065] (1) Sample selection: 1000 healthy largemouth bass of the species “Youyu No. 3” with a body length of approximately 5.5 cm were selected.

[0066] (2) Virus challenge and recording: Largemouth bass were artificially infected with largemouth bass frog iris virus (LMBV) by intraperitoneal injection, with a virus dose of 10 4 TCID 50 / fish, and the water temperature for breeding is 28℃.

[0067] After infection, the fish were observed once in the morning, noon and evening every day, and the time of onset and death of largemouth seabass was recorded. The tail fins of largemouth seabass were collected and stored in anhydrous ethanol for testing.

[0068] (3) Poisoning situation: The peak mortality period of largemouth bass was 3-4 days after poisoning. Figure 2 A and Figure 2As shown in B, the main symptoms of dead largemouth bass include dragging stool, roaming, circling, bleeding on the edge of the gill cover and fin rays, and enlarged spleen.

[0069] 2. Sequencing the Largemouth Bass Genome

[0070] (1) Extraction of genomic DNA: After the infection in step 1, 100 infected largemouth bass were selected, of which 50 were the first to die after infection with largemouth bass frog iridovirus and were used as the susceptible group, and the other 50 were the individuals that survived 14 days after infection with largemouth bass frog iridovirus and were used as the resistant group.

[0071] The genomic DNA of 100 largemouth bass challenged with the virus was extracted and whole genome resequencing was performed. The OD260 / OD280 of the genomic DNA was 1.8-2.0, and the concentration was >100 ng / μL.

[0072] (2) Screening of high-quality SNPs:

[0073] The genomic DNA is randomly broken into short DNA fragments using enzymes, the ends are repaired, dA tails are connected to both ends of the short DNA fragments, and sequencing adapters are connected to obtain DNA fragments with sequencing adapters.

[0074] The DNA fragments with sequencing adapters were purified using AMPure XP magnetic beads, and DNA fragments of 300 to 400 bp were selected for PCR amplification to obtain the library to be sequenced.

[0075] The library to be sequenced was purified and checked, and sequenced using the whole genome sequencer Hiseq X10 PE150 with a sequencing depth of 10×.

[0076] After preliminary quality control, each largemouth bass genome sample to be tested obtained 10,556,429,233bp of high-quality data, with high-quality bases (Q value>30) accounting for 92.48%, an average GC content of 42.45%, and raw reads.

[0077] The largemouth bass genome (GenBank accession number: ASM1485139v1) released by NCBI was used as the reference genome. The raw reads were quality controlled and short sequence alignment was performed with the reference genome to obtain the variant sites of each sample. The obtained variant sites were quality controlled and filtered using plink2 software to remove non-diallelic sites, sites with a second allele frequency less than 0.05, sites with a deletion rate greater than 0.5, and sites with a heterozygous ratio greater than 0.8. A total of 2,902,562 SNP molecular markers were obtained. Further quality control filtering was performed to obtain 2,064,240 high-quality SNP molecular markers.

[0078] like Figure 3 Figure 2 shows the distribution of high-quality SNP molecular markers on 22 chromosomes. The density of SNP molecular markers is lowest on chromosome 15 (chr 15) and highest on chromosome 1 (chr 1).

[0079] 3. Genome wide association study (GWAS) screening of SNP molecular markers

[0080] (1) The generalized linear model (GLM) (Q) was calculated using gemma software (v0.98.1), and association analysis of the target trait was performed in the population to locate candidate genes associated with the target trait.

[0081] The GWAS analysis model is expressed as: y=Xα+Qβ+Kμ+e.

[0082] Among them, y: phenotypic vector, that is, the survival time of largemouth bass after being infected with frog iris virus; X: genotype matrix; α: genotype effect vector; Q: fixed effect matrix (which can be information such as population structure); β: fixed effect vector; K: random effect matrix, mainly refers to the kinship matrix; μ: random effect vector; e: residual vector.

[0083] For each SNP site, check whether α is 0, and the probability value of α being 0. p is used to measure the degree of association between the marker genotype and the phenotype. The smaller the p value, the smaller the probability of α being 0, and the more likely the marker is associated with the trait.

[0084] like Figure 4 As shown in A, the susceptible population was assigned a value of 1 and the disease-resistant population was assigned a value of 0 as the phenotypic trait, and the association analysis was performed with the genotype obtained by resequencing. A total of 2348 SNP molecular markers associated with LMBV disease resistance were obtained under the threshold line of -log10 p=4.0. Among them, the most significant SNP molecular marker was located on chromosome 3 of the largemouth bass genome. Figure 4 As shown in B, a quantile-quantile (QQ) plot was drawn using R to visualize the results of the association analysis.

[0085] The results showed that the p-value (-log10p=4) of the significant SNP molecular marker was greater than its expected value, indicating that the GLM model was reliable for the sample data.

[0086] Thus, two SNP molecular markers were obtained, namely:

[0087] SNP1: g 38928188G>T on chromosome 3 of the largemouth bass genome, which is a G / T allele mutation, with genotypes of GG, GT, and TT;

[0088] SNP2: g38943495G>A on chromosome 3 of the largemouth bass genome is a G / A allele mutation, and the genotypes are AA, AG and GG.

[0089] Example 5 PCR Amplification and Verification Analysis of SNP Molecular Markers Related to the Resistance Traits of Largemouth Bass and Frog Iridescent Virus

[0090] 1. Experimental Methods

[0091] (1) Based on the gene sequence of the largemouth bass genome (GenBank accession number: ASM1485139v1) and the two SNP molecular markers determined in Example 4, a PCR detection primer combination was designed.

[0092] The primer sequence of the upstream typing primer F1 for detecting SNP1 is: GAAGGTGACCAAGTTCATGCTATACAAGAGAGAAAAGTCTCTATCG (SEQ ID NO: 1);

[0093] The primer sequence for detecting the SNP1 downstream typing primer F2 is: GAAGGTCGGAGTCAACGGATTATACAAGAGAGAAAAGTCTCTATCT (SEQ ID NO: 2);

[0094] The primer sequence for detecting the universal primer R downstream of SNP1 is: AGGAGAAATCTGCACTCTGAAACTCAGAG (SEQ ID NO: 3)

[0095] The primer sequence for detecting the upstream typing primer F1 of SNP2 is: GAAGGTGACCAAGTTCATGCTACATTAAAATATCACATGACATAAG (SEQ ID NO: 4);

[0096] The primer sequence for detecting the SNP2 downstream typing primer F2 is: GAAGGTCGGAGTCAACGGATTACATTAAAATATCACATGACATAAA (SEQ ID NO: 5);

[0097] The primer sequence for detecting the universal primer R downstream of SNP2 is: TTTCAGCTCTGGTTTGGTTGTAAGAGTAT (SEQ ID NO: 6).

[0098] (2) 311 healthy largemouth bass were selected and the primers designed in this example were used for verification.

[0099] Setting the absolute lethal viral dose of largemouth bass frog iridovirus 10 4.5 TCID 50 / , the virus was challenged according to the method of Example 4, and genomic DNA of 311 largemouth bass was extracted and used as a DNA template for PCR detection to obtain the genotypes of SNP1 and SNP2 in different samples. According to the genotyping results, the number of individuals with different genotypes at each site was counted, the gene frequency and genotype frequency of different SNP sites were calculated, and the frequencies were correlated with the survival time of largemouth bass after the virus challenge.

[0100] The PCR detection system and conditions are shown in Table 1 and Table 2 of Example 1, and PCR detection was performed using the relevant primers of SNP1 and SNP2, respectively.

[0101] 2. Experimental Results

[0102] The nucleotide sequence of the PCR amplification product of the primer combination for detecting SNP1 is shown in SEQ ID NO: 7 (atacaagagagaaaagtctctatcggcctttctctgagtttcagagtgcagatttctcct). Figure 5 A and Figure 5 Shown in B is the fluorescence signal diagram of different genotypes of SNP1 and SNP2 molecular markers in PCR detection.

[0103] As shown in Table 3 and Figure 6 As shown in A, SNP1 is significantly correlated with the resistance of largemouth bass to frog iridovirus. The resistance of largemouth bass to frog iridovirus (i.e., the survival time after infection with frog iridovirus) of GG genotype of SNP1 is significantly higher than that of GT and TT genotypes (p<0.01). Figure 6 As shown in B, there is no significant difference between the genotypes of SNP2 in the resistance of largemouth bass to frog iris virus.

[0104] Table 3

[0105]

[0106] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the essence and scope of the technical solution of the present invention.

Claims

1. A reagent for detecting the SNP molecular marker genotype associated with the resistance of largemouth bass to frog iridovirus, characterized in that: The reagent is a primer set, and the nucleotide sequence of the primer set is shown in SEQ ID NOs: 1 to 3; The SNP molecular marker is located at the 25 bp at the 5' end of the amplified product, is a G / T allele mutation, and the genotypes are GG, GT and TT. The nucleotide sequence of the amplified product is shown in SEQ ID NO: 7; The GenBank accession number of the largemouth bass genome is: ASM1485139v1.

2. Use of the reagent according to claim 1 in preparing a product for detecting the anti-frog iridovirus trait of largemouth bass.

3. Use of the reagent according to claim 1 in detecting the resistance of largemouth bass to frog iridovirus.

4. Use of the reagent according to claim 1 in breeding largemouth bass varieties resistant to frog iris virus.

5. A kit for detecting the anti-frog iridovirus trait of largemouth bass, characterized in that: The kit contains the reagent according to claim 1.

6. The kit according to claim 5, characterized in that The kit contains Flu-Arms 2×PCRMix.

7. The kit according to claim 6, characterized in that The kit contains water.

8. A method for detecting the anti-frog iridovirus trait of largemouth bass, characterized in that: The genotype of the SNP molecular marker of the largemouth bass sample was detected. The SNP molecular marker was located at the 25bp at the 5' end of the amplified product, which was a G / T allele mutation. The samples with the GG genotype had significantly better resistance to frog iris virus than the GT and TT genotypes. The nucleotide sequence of the amplified product was shown in SEQ ID NO: 7, and the GenBank accession number of the largemouth bass genome was: ASM1485139v1.

9. A method for breeding a largemouth bass variety resistant to frog iris virus, characterized in that: The method of claim 8 is used to detect the genotype of the SNP molecular marker of the largemouth bass sample, and the largemouth bass with the SNP molecular marker genotype of GG is obtained as a parent. The parent is cultivated to obtain a largemouth bass variety resistant to frog iris virus.

Images