An SNP molecular marker related to the chicken skin wudu trait and its application

Abstract

The present invention discloses a SNP molecular marker associated with the blackness trait of chicken skin and its application, belonging to the technical field of molecular markers. The present invention obtains a molecular marker significantly associated with the blackness of chicken neck skin by performing whole genome association analysis on 300 individuals randomly selected from the Xugang yellow-red crown black-skinned chicken population, namely Chr.1104716268G>A. The SNP polymorphic site of the molecular marker has three genotypes: GG, GA and AA, wherein the neck skin brightness L* value of the GG genotype is significantly lower than that of the GA and AA genotypes. Therefore, the SNP molecular marker-assisted breeding technology screened by the present invention is used to apply it to the genetic improvement of chicken skin blackness. By selecting individuals with the GG genotype and eliminating individuals with the GA and AA genotypes, the breeding of the neck skin blackness is assisted, thereby accelerating the generation breeding process of the neck skin blackness.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular markers, and in particular to a SNP molecular marker associated with the dark skin trait of chicken skin and an application thereof. Background Art

[0002] Black-bone chickens, also known as black-bone chickens, are a prized medicinal and edible chicken breed in my country. Their black skin and meat are renowned, making them a favorite among consumers. The medicinal value of black-bone chickens is closely linked to melanin. The Compendium of Materia Medica states that "the darker the color, the better for medicinal use." Consumers therefore prefer darker black chickens. In the research, development, and utilization of black-bone chickens, "black skin, black meat, and black bones" are the primary research objectives, with "black skin" being the most prominent characteristic. Therefore, skin blackness is a crucial quality characteristic of black-bone chickens, reflecting not only their edible value and the quality of their farming, but also directly influencing consumer choice. Consumers often judge chicken quality based on the depth of skin blackness, with melanin deposition being the primary cause. Melanin deposition is a complex regulatory system regulated by multiple genes and signaling pathways.

[0003] Numerous studies have shown that the skin brightness L* value reflects the brightness of the skin and muscle surface. The lower the L* value, the darker the skin and muscle color, the higher the blackness, and the higher the melanin content. This establishes that the brightness L* value can be used as a reference indicator for the blackness trait selection and breeding. The melanin deposition in the Red-Crowned Black-Skinned Chicken varies greatly between individuals and between individual body parts, and the uniformity of blackness needs to be improved. Currently, in conventional breeding, skin blackness is usually observed with the naked eye for selection, and generational genetic progress is slow. Therefore, using the method of whole-genome association analysis, we conducted research on the relevant genetic mechanisms focusing on skin blackness selection and breeding, and searched for SNP molecular markers that are significantly associated with the skin blackness of the Red-Crowned Black-Skinned Chicken. This is of great significance for improving the generational selection and breeding progress of the Red-Crowned Black-Skinned Chicken's skin blackness. Summary of the Invention

[0004] The purpose of the present invention is to provide a SNP molecular marker related to the blackness trait of chicken skin and its application to solve the problems existing in the above-mentioned prior art. The use of SNP molecular markers can improve the breeding efficiency of the blackness trait of chicken neck skin and accelerate the breeding process.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] The present invention provides a SNP molecular marker associated with the dark skin trait of chicken skin. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and a G>A mutation exists at the 394th base of the sequence shown in SEQ ID NO.1.

[0007] Preferably, the mutation sites of the SNP molecular marker include GG, GA and AA genotypes.

[0008] The present invention also provides the use of the SNP molecular marker in any of the following:

[0009] Application in the improvement and breeding of chicken skin Udu;

[0010] Application in screening chicken breeds related to chicken skin darkening traits.

[0011] Preferably, the chicken skin blackness includes the blackness of the neck skin of the Red Crowned Black-skinned Chicken.

[0012] The present invention also provides a method for screening chicken skin darkening traits using the SNP molecular marker, comprising the following steps:

[0013] The whole genome DNA of the chicken to be tested is used as a template, and specific primers are used to amplify the SNP molecular marker, and the chicken skin darkness trait is screened according to the genotype of the polymorphic site of the SNP molecular marker; wherein the nucleotide sequence of the specific primer is shown in SEQ ID NO.2-3.

[0014] Preferably, the chicken to be tested whose genotype of the polymorphic site of the SNP molecular marker is GG is retained.

[0015] Preferably, the GG genotype is significantly associated with the darkness of chicken neck skin.

[0016] Preferably, the chicken to be tested includes Red-Crowned Black-Skinned Chicken.

[0017] Preferably, the reaction system for amplification includes the following components: 2.0 μL of DNA template, 7.2 μL of ddH2O, 10 μL of Green Taq Mix, and 0.4 μL each of upstream primer and downstream primer.

[0018] Preferably, the reaction procedure for amplification is pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 30 s, 32 cycles; extension at 72°C for 5 min, and insulation at 12°C.

[0019] The present invention discloses the following technical effects:

[0020] The present invention obtains a molecular marker significantly associated with the blackness of the chicken neck skin by performing genome-wide association analysis on 300 individuals randomly selected from the Xugang yellow-red crown black-skinned chicken population. The molecular marker is located on chromosome 1 of the chicken reference genome Gallus_gallus.GRCg7b version. There is a single nucleotide base mutation of G>A at position 104716268 of the chromosome (named: Chr.1104716268G>A). Experiments have found that the mutation site significantly affects the blackness of the chicken neck skin. Based on the above molecular marker, its effect on skin blackness is verified, and finally an efficient and accurate molecular marker-assisted breeding technology is established and applied to the genetic improvement of chicken skin blackness. In breeding, the GG dominant allele genotype can be used as an important molecular marker for the brightness L* value of the chicken neck skin. By selecting individuals with the GG genotype and eliminating individuals with the GA and AA genotypes, the breeding of the neck skin blackness is assisted, thereby accelerating the generational breeding process of the neck skin blackness. The molecular marker-assisted chicken skin udon breeding screened by the present invention is beneficial to improving selection intensity, reducing breeding cycle, and thus improving breeding efficiency and reducing breeding costs. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0022] Figure 1 This is a genome-wide association study (GWAS) analysis of skin darkening on chicken chromosome 1; the horizontal axis represents the chromosome number of the chicken; the vertical axis represents -log 10 P value;

[0023] Figure 2 Agarose gel electrophoresis results; 1-6 are amplified product samples, M is a standard DNA molecule;

[0024] Figure 3 These are peak graphs of sequencing results for different genotypes of the main effect mutation site Chr.1104716268G>A in chicken skin; among them, (a) represents the peak graph of sequencing results for the GG genotype, (b) represents the peak graph of sequencing results for the GA genotype, and (c) represents the peak graph of sequencing results for the AA genotype. DETAILED DESCRIPTION

[0025] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0026] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0027] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0028] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be illustrative only.

[0029] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0030] Example 1: Determination of in vivo phenotypic traits of experimental chickens and acquisition of molecular markers affecting chicken skin blackness

[0031] 1. Blood sample collection and trait determination of experimental animals

[0032] 1) Blood sample collection

[0033] Three hundred 98-day-old Xugang Yellow-Red-Crowned Black-Skinned Chickens (half male and half female, provided by Foshan Xugang Yellow Chicken Animal Husbandry Co., Ltd.) were randomly selected. Wing numbers were recorded, and 2 mL of blood was collected from the subwing vein using a vacuum anticoagulant tube (with heparin as the internal anticoagulant) and stored at -20°C for subsequent DNA extraction. DNA was extracted using a DNA extraction kit. DNA samples from all 300 individuals were sent to Lianchuan Biological Company for whole-genome sequencing and genome-wide association analysis.

[0034] 2) Determination of skin brightness L* value

[0035] Pluck 1cm of feathers from the neck of a live red-crowned black-skinned chicken2 The left and right areas were wiped with a 75% alcohol cotton ball, and then the lightness L* value of the neck skin was measured using a 3nhNR10QC handheld colorimeter. All skin color measurements were made by the same person, and the measured areas were basically the same.

[0036] 2. Drugs and enzymes

[0037] DNA Marker, ethidium bromide (EB), Shanghai Sangon Biotechnology Co., Ltd.

[0038] Taq enzyme and ddH2O were purchased from Nanjing Novozymes Biotechnology Co., Ltd.

[0039] 3. Main instruments and equipment

[0040] 3nh NR10QC handheld colorimeter;

[0041] MJMini gradient PCR instrument (Bio-Rad, USA).

[0042] 4. Primer design and synthesis

[0043] According to the reported chicken TIAM1 gene sequence (Gene ID: ENSGALG00010011699), primers were designed using NCBI Primer-BLAST and synthesized by Tianyi Huiyuan Biotechnology Co., Ltd. Guangzhou Branch.

[0044] 5. DNA library construction and sequencing

[0045] The library was constructed using the TruSeq Library Construction Kit. The specific steps are as follows: First, the genomic DNA from the qualified DNA samples was randomly sheared into fragments of a target length of approximately 350bp using a Covaris crusher. The DNA fragments were then subjected to end repair, polyA tailing, sequencing adapter addition, purification, and PCR amplification to complete the entire library preparation. After the library was constructed, it was initially quantified using Qubit2.0 and the library was diluted to 1ng / μL. The insert size of the library was then detected using an Agilent 2100. Once the insert size met the expectations, the effective concentration of the library was accurately quantified using q-PCR (the effective concentration of the library was greater than 2nM) to ensure library quality. After passing the library inspection, the library was sequenced based on the effective concentration of the library and data output requirements.

[0046] 6. Detection of intragenomic variations

[0047] 1) Data quality control

[0048] The raw reads obtained from sequencing were first analyzed and evaluated for quality using FastQC software. Based on the data quality, the raw reads were then quality-controlled using Trim Galore software, primarily to remove residual primers and adapters from library construction and sequencing, as well as low-quality reads.

[0049] 2) Sequencing reads alignment and variant detection

[0050] The Gallus gallus genome (Gallus_gallus.GRCg7b) from the Ensembl database was used to index the reference genome using BWA software. High-quality reads after quality control were aligned to the chicken reference genome (Gallus_gallus.GRCg7b) using BWA-MEM. The aligned SAM files were converted into binary BAM files using Picard software. Samtools software was then used to compare the physical positions of the reference genome. The aligned BAM files were sorted and SNP analysis was performed to obtain a SNP dataset. Genotyping was performed using Plink software.

[0051] 3) Genome-wide association analysis

[0052] EMMAX (Efficient Mixed-Model Association eXpedited) is a statistical method used to perform genome-wide association studies (GWAS). The main advantage of EMMAX is that it is very efficient in handling population structure and kinship, thus reducing the risk of false associations. EMMAX was used to conduct an association analysis of skin blackness in the Red-crested Black-skinned Chicken population. The GWAS results were analyzed with a P < 1 × 5 -10 (-log 10 P>5) was used as the screening threshold to screen out SNPs significantly associated with the skin blackness trait of Red-crowned Black-skinned Chicken, and the located candidate genes were compared and functionally annotated. Figure 1 .

[0053] 4) Functional annotation of genomic variants

[0054] Based on the chicken genome annotation information in the Ensembl database, all detected SNP variations were annotated using ANNOVAR software.

[0055] 5) Correlation analysis between different genotypes and neck skin darkening

[0056] As shown in Table 1, the molecular marker SNP site is located at position 104716268 on chromosome 1 of the chicken reference genome Gallus_gallus.GRCg7b. This site contains a single nucleotide base mutation (G>A) (designated: Chr.1104716268G>A). Chr.1104716268G>A is highly significantly correlated with neck skin darkening (P<0.001). The gene in the nearby region is T lymphoma invasion and metastasis inducing factor 1 (TIAM1). This indicates that this molecular marker significantly affects the darkening of chicken neck skin. Assisted selection at this SNP site could improve skin darkening in chickens, thereby accelerating breeding efforts.

[0057] In addition, according to Table 1, it can be seen that the average skin L* value of the neck of the GG type is lower than that of the GA and AA types, indicating that the homozygous GG can improve the average skin blackness. It can be further seen from Table 2 that the skin blackness of the homozygous GG genotype is significantly different from that of the GA and AA genotypes, and is the dominant genotype. This further shows that the homozygous GG is most beneficial for improving the skin blackness and can promote the improvement of the skin blackness uniformity of the Red Crowned Black-skinned Chicken. Therefore, in order to ensure the stable breeding and improvement of skin blackness, it is necessary to eliminate GA and AA type breeding chickens during the breeding process and retain GG type breeding chickens to increase the frequency of this homozygous genotype from generation to generation.

[0058] Table 1 Correlation between molecular marker SNP site Chr.1104716268G>A and skin darkening

[0059]

[0060] Note: "N / N" indicates that the individual is a homozygous wild type at the gene locus, that is, there is no mutation or variation at the locus.

[0061] Table 2 Differences among different genotype groups of molecular marker SNP site Chr.1104716268G>A

[0062]

[0063]

[0064] Example 2 A molecular marker genotyping method affecting chicken skin dark degree

[0065] 1. Experimental Animals

[0066] The experimental chicken group used in the present invention is 200 120-day-old red-crowned black-skinned Ma chicken breeders (100 males and 100 females) from Guangdong Xuganghuang Breeding Co., Ltd., which is the core group of breeders, and the neck skin blackness is measured in vivo.

[0067] 2. Target DNA sequence amplification and sequencing

[0068] 1) Primer design

[0069] The DNA sequence of the T lymphoma invasion and metastasis inducing factor 1 (TIAM1) gene on chicken chromosome 1 was downloaded from the NCBI website, and primers were designed using NCBI Primer-BLAST.

[0070] The DNA sequences of the designed primers are shown below:

[0071] Upstream primer primer-F: 5'-ATCACAGATATCAGCCGCCG-3' (SEQ ID NO: 2);

[0072] Downstream primer primer-R: 5′-GCGTGCAGTGCCATAAAACA-3′ (SEQ ID NO: 3).

[0073] 2) PCR amplification

[0074] To a 20 μL reaction system, add 2.0 μL of DNA template, 7.2 μL of ddH₂O, 10 μL of Green Taq Mix, and 0.4 μL each of primers F and R. PCR reaction conditions were as follows: 94°C pre-denaturation for 3 min; 94°C denaturation for 30 s; 60°C annealing for 30 s; 72°C extension for 30 s; 32 cycles; 72°C extension for 5 min; and 12°C incubation.

[0075] 3) DNA sequence determination

[0076] The PCR amplified products were subjected to agarose gel electrophoresis to detect the PCR products and the results were determined based on the product size: PCR amplified products were detected by electrophoresis on a 1.5% agarose gel containing EB at a voltage of 160 V for 18 min and the bands (871 bp, as shown in the figure) were observed in a gel imaging system. Figure 2 As shown), and finally sequencing (as Figure 3 The sequencing result is shown in SEQ ID NO: 1.

[0077] 3. Genotype analysis of molecular marker SNP site g.104716268G>A

[0078] Table 3 shows that the GG genotype at the molecular marker SNP site g.104716268G>A (i.e., a G>A mutation at base 394 of the sequence shown in SEQ ID NO: 1) in Red-Crowned Black-Skinned Chicken breeders has a higher average skin darkness than GA and AA, indicating that homozygous GG is most beneficial for skin darkness. This further demonstrates that homozygous GG can promote the improvement of skin darkness in chickens.

[0079] Table 3 Differences in skin darkening among different genotypes of molecular marker SNP site g.104716268G>A

[0080]

[0081]

[0082] Example 3 Analysis of the effect of the molecular marker SNP site g.104716268G>A

[0083] The present invention provides a single-nucleotide polymorphism (SNP) molecular marker that can significantly improve chicken skin blackness. Using this SNP molecular marker for marker-assisted selection can significantly accelerate the improvement process of chicken skin blackness. By selecting all GG, GA, and AA-type individuals with molecular markers that affect chicken skin blackness into GG-type individuals, the average neck skin brightness (L*) of a Red-crested Black-skinned Ma chicken breeder population can be reduced by 2.28, significantly improving the neck skin blackness of the breeder chickens.

[0084] The present invention utilizes SNP molecular markers to mark chicken individuals, and by selecting red-crested black-skinned chickens with the dominant allele (G) of the SNP, the economic benefits of commercial chickens can be ultimately improved, thereby increasing the profits of the enterprise.

[0085] Chicken TIAM1 gene PCR product sequence (SEQ ID NO: 1):

[0086] ATCACAGATATCAGCCGCCGCTAATACTCGTGTGTGTTAAATACGATGGAGGGGCTACTTTGTGCACTGCTCTTAACCACGTGGGGCCCTCAGGCCACAAACCTGACCCCGCTCTAGCACAAACAAGCACGGAGAGCGTGCCACGCTACATTCAGCTCCAAAAACAGCCAAAGAAGCTACTCGACCAAAGCAGCAGCAGGTTTACTTCAGGCCTTTGGAGTGCAAGCAGGTATTACAACCTGAGTACAAAGAGAGCCTGAAGTGGCAGCAGCCTCCGATAACAAGAGATTAAAACAGACCCAAACAGCAGAACAAGCCTTGGAGGAATTTAAAGTGAGAAACCCAGGACCTGAGCACCACTTTGATGCCATTGCAGCTTCAGCTATGCGGGTG N ATGGAAAGGTACTGGAGCACGAATTCTCTTACGGCTTTCTGAAAGCTTTACCTTACTCTTTAAGAAGTTACACCTCTCTCCCCTTCTGCATCTCAGTGATTTATCTACAGCAGAGGCTACTTCTGCACAAAGCCTCCAGGGCAGTGCCCCTGCACTGCAGGATGGCTGTAAACGAAACAGGAATGGGAGACCCAACATTTTAGTATCAGCTGTGAGAAACGGTATTTCAGGTGCAGAAAACATCGGCACAGGTTAATAAAAGAGAAACTGATTCAATAGCTTCAAAAGCTTAGAAAGGCAGAACGGCTCTGCTAATGAAAGAGTTTTTAAAGGAAACCACCTTCTGATGAGTGACACTGCTGCATTTAACTTGAAAGATGAGATTCAAGGTTTGCTGGCCGGTGGGTGGAACTCCATTGATATCACCTGTCCTGCCTGCTCACACGGAGCCAGGGCTTGTTTTATGGCACTGCACGC。

[0087] Note: N in the sequence is the mutation site.

[0088] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. A SNP molecular marker associated with chicken skin darkening trait, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and there is a G>A mutation at base 394 of the sequence shown in SEQ ID NO.

1.

2. The SNP molecular marker according to claim 1, wherein The mutation sites of the SNP molecular markers include GG, GA and AA genotypes.

3. Use of the SNP molecular marker according to claim 1 in any of the following: Application in the improvement and breeding of chicken skin Udu; Application in screening chicken breeds related to chicken skin udon traits; The blackness of the chicken skin is the blackness of the neck skin of the red-crowned black-skinned chicken.

4. A method for screening chicken skin darkening traits using the SNP molecular marker according to claim 1 or 2, characterized in that: The following steps are involved: The whole genomic DNA of the chicken to be tested is used as a template, and the SNP molecular marker is amplified using specific primers, and the chicken skin darkness trait is screened according to the genotype of the polymorphic site of the SNP molecular marker; wherein the nucleotide sequence of the specific primer is shown in SEQ ID NO.2-3; The chicken to be tested is a red-crowned black-skinned chicken.

5. The method according to claim 4, wherein The chicken to be tested whose genotype of the polymorphic site of the SNP molecular marker is GG is retained.

6. The method according to claim 5, wherein The GG genotype was significantly associated with the dark degree of chicken neck skin.

7. The method according to claim 4, wherein The amplification reaction system includes the following components: 2.0 μL of DNA template, 7.2 μL of ddH2O, 10 μL of Green Taq Mix, and 0.4 μL each of upstream primer and downstream primer.

8. The method according to claim 4, wherein The reaction procedure for the amplification was as follows: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 30 s, 32 cycles; extension at 72°C for 5 min, and insulation at 12°C.

Images