Primer set for detecting pathogen of urinary system infection and drug resistance gene and application thereof

By employing ultra-multiplex PCR amplification and pathogen-targeted sequencing technologies, the limitations of existing pathogen detection methods and the challenges of NGS technology have been overcome, enabling efficient and low-cost detection of urinary tract infection pathogens and drug resistance genes, thereby improving the sensitivity and coverage of detection.

CN119193884BActive Publication Date: 2025-12-12THE FIRST AFFILIATED HOSPITAL OF GUANGZHOU MEDICAL UNIV (GUANGZHOU RESPIRATORY CENT) +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411584969.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-07
Publication Date
2025-12-12
Estimated Expiration
2044-11-07

AI Technical Summary

Technical Problem

Existing pathogen detection methods have limitations in terms of sensitivity, specificity, timeliness, and information content, making it difficult to quickly identify unknown or rare pathogenic microorganisms. Furthermore, NGS technology faces challenges such as interference from human cell genomes, low detection rates of intracellular bacteria/fungi, low sensitivity of RNA virus detection, and difficulty in detecting drug resistance genes, resulting in low detection content of pathogen nucleic acid sequences and high detection costs.

Method used

This method employs ultramultiplex PCR amplification combined with pathogen-targeted sequencing (tNGS) technology. Specific primer sets are used to amplify the nucleic acid sequences of targeted pathogens, and high-throughput sequencing is used to detect urinary tract infection pathogens and drug resistance genes. Adaptor sequences are used to differentiate samples, reducing human genome interference, improving detection sensitivity, and lowering costs.

Benefits of technology

It enables high-throughput, low-cost detection of multiple pathogens, improves detection sensitivity and coverage, significantly increases the detection rate of bacterial resistance genes, reduces sequencing costs and data volume requirements, and is suitable for multi-sample detection of clinical samples.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119193884B_ABST
    Figure CN119193884B_ABST
Patent Text Reader

Abstract

The application discloses a primer set for detecting urinary system infection pathogens and drug resistance genes and application thereof. The primer set comprises primers with nucleotide sequences shown in SEQ ID NO: 1-208. By using the primer set, multiple PCR amplification and pathogen target sequencing can be simultaneously performed to efficiently detect drug resistance genes and drug resistance gene mutations, and the detection flux, coverage and sensitivity are higher than those of a traditional detection method.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of gene detection, and particularly relates to a primer set for detecting pathogenic bacteria of urinary system infection and drug-resistant genes and application thereof. BACKGROUND

[0002] Infectious diseases are one of the common clinical diseases, which are mostly caused by local or systemic inflammation or organ dysfunction of pathogenic bacteria, viruses and fungi and their products, and have great harmfulness and high mortality. Urinary system infection is one of the common infectious diseases in clinic. According to statistics, there are 130-175 million patients with urinary system infection in the world every year. Urinary system infection includes simple urinary tract infection in children, adults (including the elderly) and infection caused by kidney diseases, urinary calculi, etc. On the basis of quickly and accurately identifying the cause, a reasonable treatment plan can be selected to effectively control the occurrence and development of the disease.

[0003] Clinical epidemiology statistics show that common urinary system infection pathogenic bacteria with positive urine culture include enterobacteriaceae bacteria such as Escherichia coli, Pseudomonas aeruginosa and Klebsiella pneumoniae, as well as enterococci (Enterococcus faecalis, Enterococcus faecium, etc.), Staphylococcus (Staphylococcus aureus, hemolytic Staphylococcus, etc.) and other gram-positive cocci. However, due to the current widespread phenomenon of antibiotic abuse, the increase of drug-resistant strains and the change of urinary flora, more and more mixed infections of multiple bacteria, fungal infections, mixed infections of bacteria and fungi and other situations have occurred, which has brought severe challenges to clinical etiology diagnosis and anti-infection treatment. In addition to conventional bacterial and fungal infections, mycoplasma, chlamydia and viruses can also cause urinary system infection, and due to the difficulty in clinical identification and cultivation of these pathogens, the diagnosis becomes more complex.

[0004] The current etiology routine detection methods include morphological detection, culture isolation method, biochemical detection, immunological detection and nucleic acid detection (PCR method, DNA restriction enzyme cutting analysis method, nucleic acid probe method, etc.). Because these detection methods are simple, fast, have low technical requirements, and have certain diagnostic sensitivity and specificity, they are still widely used in clinic. However, the traditional detection methods have limitations in sensitivity, specificity, timeliness and information amount, and for unknown or rare pathogenic microorganisms, they cannot be quickly identified. For conventional bacterial infection, the traditional culture method cannot distinguish mixed infection, and for virus infection such as polyoma virus, it cannot be detected; the traditional PCR and other molecular biology techniques have low throughput and limited detection of microorganisms; and the antigen-antibody detection has low sensitivity and specificity.

[0005] The new generation of high-throughput sequencing technology (NGS sequencing technology) can quickly obtain pathogen and gene sequence information with the advantages of high throughput, large-scale, parallel sequencing, and fast speed, which can assist and meet the needs of clinical pathogen infection detection. Since 2020, the pathogen metagenomic detection technology (mNGS) based on NGS technology has achieved great success, and has been widely used in the etiological diagnosis of critical and difficult infections, especially in lower respiratory tract infections, bloodstream infections, and central nervous system infections. mNGS has become a second-line or even first-line detection technology.

[0006] There are two main methods for identifying microorganisms based on NGS, including metagenomic sequencing (mNGS) and pathogen-targeted sequencing (tNGS). The mNGS sequencing technology is a non-biased sequencing of all nucleic acids in the sample, combined with a professional pathogenic microorganism database, to detect the pathogenic microorganism sequences contained in the sample, which shows great advantages in diagnosing complex and severe infections such as blood infections, respiratory tract infections, bone and joint infections, and encephalitis.

[0007] Although mNGS has many advantages for clinical pathogen diagnosis, it still faces some challenges, such as the interference of human cell genomes on pathogen-targeted gene detection, low detection rate of intracellular bacteria / fungi, low sensitivity of RNA virus detection, and difficulty in detecting drug-resistant genes. These factors can lead to low detection content of pathogen nucleic acid sequences, false negative results of pathogens, and inability to identify the species of pathogens, and high detection cost also limits the selection of the technology by patients. SUMMARY

[0008] Therefore, it is necessary to provide a primer set for detecting urinary system infection pathogens and drug-resistant genes and an application thereof. Specifically, a primer set for detecting urinary system infection pathogens and drug-resistant genes, a kit for detecting urinary system infection pathogens and drug-resistant genes, and a method for detecting urinary system infection pathogens and drug-resistant genes are provided.

[0009] The first aspect of the present application provides a primer set for detecting urinary system infection pathogens and drug-resistant genes, wherein the primer set comprises primers with nucleotide sequences as shown in SEQ ID NO: 1-208.

[0010] In some embodiments, a linker is further connected to each primer sequence in the primer set, and the nucleotide sequence of the linker is optionally as shown in SEQ ID NO: 209 or SEQ ID NO: 210.

[0011] The second aspect of the present application provides a kit for detecting urinary system infection pathogens and drug-resistant genes, wherein the kit comprises the primer set according to the first aspect of the present application.

[0012] In some embodiments, the kit further comprises a tag primer; the tag primer is present for identifying different samples with a Barcode.

[0013] In some embodiments, the kit further comprises a PCR amplification reagent; optionally, the PCR amplification reagent comprises a multiplex PCR amplification reagent; further optionally, the multiplex PCR amplification reagent comprises one or more of a PCR buffer, a multiplex amplification enzyme, and dNTPs.

[0014] In some embodiments, the kit further comprises an internal reference primer.

[0015] The third aspect of the present application provides a method for detecting a pathogen of urinary system infection and a drug resistance gene, the method comprising the following steps:

[0016] The sample DNA is subjected to PCR amplification library construction by using the kit of the second aspect of the present application, to obtain a library;

[0017] The library is sequenced.

[0018] In some embodiments, the method for detecting a pathogen of urinary system infection and a drug resistance gene satisfies one or more of the following conditions:

[0019] The sequencing is high-throughput sequencing, optionally, the high-throughput sequencing is pathogen-targeted sequencing; and,

[0020] The PCR amplification is multiplex PCR amplification, optionally, the multiplex PCR amplification comprises a first step amplification and a second step amplification.

[0021] In some embodiments, the first step amplification satisfies one or more of the following conditions:

[0022] The reaction system of the PCR amplification comprises the primer set of the first aspect of the present application, sample DNA, nuclease-free water, a multiplex amplification enzyme, a human gene internal reference gene primer, and a PCR buffer; optionally, the final concentration of the primer set in the reaction system is 0.05 μM-0.2 μM; the final concentration of the sample DNA is greater than or equal to 0.2 ng / μL; the final concentration of the multiplex amplification enzyme is 0.9 U / μL-1.1 U / μL; the final concentration of the human gene internal reference gene primer is 0.025 μM-0.1 μM; and,

[0023] The amplification product is purified by magnetic beads.

[0024] In some embodiments, the second step amplification satisfies one or more of the following conditions:

[0025] The reaction system of PCR amplification comprises first amplification product, tag primer, nuclease-free water, and PCR premix; optionally, the final concentration of the first amplification product in the reaction system is 0.01-0.05 μM; the final concentration of the tag primer is 0.5-2 μM; the PCR premix comprises one or more of hot-start enzyme, dNTPs, reaction buffer, and the like; and,

[0026] The amplification product is purified by magnetic beads.

[0027] The fourth aspect of the present application provides an application of the primer group for detecting pathogens and drug-resistant genes of the urinary system infection in the preparation of a product for detecting urinary tract infection.

[0028] By using the aforementioned primer group in combination with multiplex PCR amplification and pathogen-targeted sequencing (tNGS), a plurality of pathogens can be simultaneously detected, and the detection throughput, coverage, and sensitivity are higher than those of the traditional detection method; compared with pathogenic microorganism metagenomics (mNGS) detection, the detection cost is lower, and the detection sensitivity of drug-resistant genes and drug-resistant gene mutations is higher.

[0029] Further, the detection method provided by an embodiment of the present application has a lower data requirement for the detection of clinical samples, and the data requirement of a single sample is as low as 0.4M reads, so that the sequencing cost is relatively low, a plurality of samples can be simultaneously detected, and the method is more suitable for clinical detection of urinary system infection pathogens and drug sensitivity. BRIEF DESCRIPTION OF DRAWINGS

[0030] In order to more clearly illustrate the technical solutions in the embodiments and examples of the present application, more completely understand the present application and its beneficial effects, the drawings needed to be used in the embodiment or example description will be briefly introduced. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor on the basis of these drawings.

[0031] Figure 1 Distribution of the number of detected positive bacterial species in an embodiment of the present application;

[0032] Figure 2 Distribution of the number of detected positive fungal species in an embodiment of the present application. DETAILED DESCRIPTION

[0033] For the purposes of the present application, reference will be made to the accompanying drawings in which: the preferred embodiments of the present application will be presented. It should be understood that the present application can be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete. It will be apparent, however, to one of ordinary skill in the art that the present application can be embodied in other forms without departing from the spirit or scope of the present application.

[0034] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used in the description of the application herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the application. As used in this description, the terms "and / or" includes any and all combinations of one or more of the associated listed items.

[0035] In the present application, "optionally", "optional", "option" means optional, that is, selected from "have" or "no" two parallel schemes. If there are multiple "options" in a technical solution, if there is no special description, and there is no contradiction or mutual restriction, each "option" is independent.

[0036] In the present application, "preferably", "better", "better", "as appropriate" only describe the better effect of the embodiment or embodiment, and it should be understood that it does not constitute a limitation on the scope of protection of the present application.

[0037] The terms "have", "contain", "include" and "comprise" used in the present application are synonymous terms, which are inclusive or open, and do not exclude additional, unmentioned members or features. Members or features, such as materials or components, structures, elements, instruments, etc.; non-limiting examples of members or features, such as actions, conditions, timing, state, etc.

[0038] In the present application, the technical features or technical solutions described in open language include closed technical features or technical solutions composed of listed contents, and also include open technical features or technical solutions containing listed contents.

[0039] In the present application, the unit related to the data range, if only the right end point is followed by a unit, it means that the unit of the left end point and the right end point is the same. For example, 1~3μL means that the unit of the left end point "1" and the right end point "3" is μL, which has the same meaning as 1μL~3μL. In addition, similar descriptions of other parameters are also applicable to the above understanding.

[0040] In the present application, unless otherwise explicitly stated, the execution of the steps involved in the method flow does not have strict order limitation, and can be executed in other order than described. Moreover, any step can include multiple sub-steps or multiple stages, which do not necessarily be executed at the same time, and the execution order is not necessarily sequential, but can be executed alternately or simultaneously with other steps or sub-steps or stages of other steps.

[0041] In the present application, the exemplary description involving "in some embodiments", "in an embodiment", etc. can cover but is not limited to the following meanings: these schemes can be combined with other schemes in a suitable manner to form new technical schemes.

[0042] In the present application, in the terms "first aspect", "second aspect", "third aspect", "fourth aspect", etc., the terms "first", "second", "third", "fourth", etc. are only for description purpose, and cannot be understood as indicating or implying relative importance or quantity, nor can be understood as implicitly indicating the importance or quantity of the indicated technical features. Moreover, "first", "second", "third", "fourth", etc. only play a non-exhaustive enumeration description purpose, and should be understood as not constituting a closed limitation on the quantity.

[0043] In the present application, "greater than or equal to", "greater than or equal to" and "≥" have the same meaning and can be used interchangeably; "less than or equal to", "less than or equal to" and "≤" have the same meaning and can be used interchangeably; "greater than" can be equivalent to ">"; "less than" can be equivalent to "<". In the present application, unless otherwise stated, "greater than or equal to" and "≥" can be considered to also provide two schemes of "greater than" and "equal to". In the present application, unless otherwise stated, "less than or equal to" and "≤" can be considered to also provide two schemes of "less than" and "equal to".

[0044] In this application, when referring to a numerical interval (i.e., a numerical range), the distribution of the selectable values in the numerical interval is considered continuous and includes both numerical endpoints (i.e., the minimum and maximum values) of the numerical interval and every value between the two numerical endpoints, unless otherwise specified. When a numerical interval refers only to integers within the numerical interval, including both endpoints and every integer between the endpoints, it is equivalent to listing each integer directly, unless otherwise specified. When multiple numerical ranges are provided to describe a feature or characteristic, the numerical ranges can be combined. In other words, unless otherwise indicated, numerical ranges disclosed herein are to be understood to include any and all sub-ranges of the same, unless otherwise indicated. A "value" in a numerical interval can be any quantitative value, such as a number, a percentage, a ratio, etc. A "numerical interval" is intended to broadly include numerical interval types such as percentage intervals, ratio intervals, and the like.

[0045] Traditional pathogen detection methods have limitations in sensitivity, specificity, timeliness, information content, and the like, and for unknown or rare pathogenic microorganisms, it is difficult to quickly identify. Although mNGS has many advantages for clinical pathogen diagnosis, it still faces some challenges, such as the interference of human cell genomes on pathogen target gene detection, low detection rate of intracellular bacteria / fungi, low sensitivity of RNA virus detection, and difficulty in detecting drug-resistant genes. These factors can lead to low detection content of pathogen nucleic acid sequences, false negative results of pathogens, and inability to identify the species of pathogens, and high detection costs also limit patient selection of the technology.

[0046] The use of super-multiplex PCR to amplify target pathogen nucleic acid sequences, combined with NGS sequencing to detect common pathogens, can effectively solve the technical and cost disadvantages of mNGS:

[0047] 1) tNGS is not affected by human genes, colonizing bacteria genes, and other background gene fragments, has high data utilization, and greatly reduces sequencing costs;

[0048] 2) Multiple pairs of amplification primers are designed for pathogens to amplify target species, which can effectively enrich the abundance of target pathogens in the sample, greatly improving the detection sensitivity of pathogens compared to traditional PCR technology;

[0049] 3) Bacterial antibiotic resistance-related genes and gene mutations can be effectively enriched, significantly improving the detection rate of bacterial drug resistance genes compared to mNGS technology.

[0050] Based on this, the embodiments of the present application at least provide a primer set for detecting pathogen of urinary system infection and drug resistance gene and application thereof. Specifically, a primer set for detecting pathogen of urinary system infection and drug resistance gene, a kit for detecting pathogen of urinary system infection and drug resistance gene and a method for detecting pathogen of urinary system infection and drug resistance gene are provided.

[0051] In the first aspect of the present application, a primer set for detecting pathogen of urinary system infection and drug resistance gene is provided, and the primer set comprises primers with nucleotide sequences as shown in SEQ ID NO: 1-208.

[0052] In some embodiments, a linker is further connected to each primer in the primer set, and the linker is further connected to the 5' end of each primer.

[0053] In the present application, unless otherwise specified, the linker is added to the 5' end of the primer, and is used for primer binding and sequence determination in the sequencing process.

[0054] In some embodiments, the nucleotide sequence of the linker is as shown in SEQ ID NO: 209 or SEQ ID NO: 210.

[0055] In the second aspect of the present application, a kit for detecting pathogen of urinary system infection and drug resistance gene is provided, and the kit comprises the primer set of the first aspect of the present application.

[0056] In some embodiments, the kit further comprises a tag primer, and the tag primer is used to identify a Barcode of different samples.

[0057] In some embodiments, the nucleotide sequence of the tag primer is as shown in SEQ ID NO: 211 and SEQ ID NO: 212.

[0058] In the present application, unless otherwise specified, the tag primer refers to a molecular tag used to distinguish different samples in high-throughput sequencing, and comprises an upstream primer and a downstream primer.

[0059] In the present application, unless otherwise specified, the Barcode is added to the DNA fragments of each sample as a unique tag, so as to distinguish and attribute the data of each sample after mixed sample sequencing.

[0060] In some embodiments, the kit further comprises a PCR amplification reagent, and optionally, the PCR amplification reagent comprises a multiplex PCR amplification reagent; further, the multiplex PCR amplification reagent comprises one or more of a PCR buffer, a multiplex amplification enzyme and dNTPs.

[0061] In the present application, "multiplex amplification enzyme" refers to a special DNA polymerase used for multiplex PCR, unless otherwise specified.

[0062] In some embodiments, the kit further comprises an internal reference primer, which is selected from, but not limited to, human gene internal reference gene primers.

[0063] In the third aspect of the present application, a method for detecting pathogens and drug-resistant genes of urinary system infection is provided, comprising the following steps:

[0064] S100: performing PCR amplification library construction on sample DNA using the kit of the second aspect of the present application to obtain a library.

[0065] S200: sequencing the library.

[0066] In some embodiments, the sample is treated and nucleic acid is extracted before performing multiplex PCR amplification library construction on the sample DNA, wherein the sample is mainly urine, including one or more of conventional clean midstream urine (morning urine), suprapubic bladder puncture urine, catheterization and bladder catheterization.

[0067] In some embodiments, nucleic acid extraction can be performed by conventional extraction methods in the art, such as, but not limited to, one or more of acid extraction, chloroform extraction or magnetic bead extraction.

[0068] In some embodiments, in step S100, the PCR amplification is multiplex PCR amplification, which further comprises first step amplification and second step amplification.

[0069] In some embodiments, in the first step amplification, the reaction system of PCR amplification comprises the primer set of the first aspect of the present application, sample DNA, nuclease-free water, multiplex amplification enzyme, human gene internal reference gene primer and PCR buffer.

[0070] In some embodiments, in the first step amplification, the final concentration of the primer set is 0.05 μM to 0.2 μM, which can be, but not limited to, 0.05 μM, 0.1 μM, 0.15 μM, 0.2 μM, 0.05 μM or any value or range between any two of the above values.

[0071] In some embodiments, in the first step amplification, the final concentration of the sample DNA is greater than or equal to 0.2 ng / μL. Non-limitingly, the final concentration of the sample DNA can be, but not limited to, 0.2 ng / μL, 0.3 ng / μL, 0.4 ng / μL, 0.5 ng / μL or any value or range between any two of the above values.

[0072] In some embodiments, in the first step amplification, the final concentration of the multiplex amplification enzyme is 0.9-1.1 U / μL. Without limitation, the final concentration of the multiplex amplification enzyme can be 0.9 U / μL, 1.0 U / μL, 1.1 U / μL, or a value or a range between any two of the above values.

[0073] In some embodiments, in the first step amplification, the final concentration of the human gene internal reference gene primer is 0.025 μM-0.1 μM. Without limitation, the final concentration of the human gene internal reference gene primer can be 0.025 μM, 0.05 μM, 0.075 μM, 0.1 μM, or a value or a range between any two of the above values.

[0074] In some embodiments, in the first step amplification, the amplified product is purified by magnetic beads.

[0075] In some embodiments, in the second step amplification, the reaction system comprises the first step amplification product, the tag primer, nuclease-free water, and PCR premix.

[0076] In some embodiments, the PCR premix comprises one or more of a hot start enzyme, dNTPs, and a reaction buffer.

[0077] In some embodiments, in the second step amplification, the final concentration of the first step amplification product is 0.01 μM-0.05 μM. Without limitation, the final concentration of the first step amplification product can be 0.01 μM, 0.02 μM, 0.03 μM, 0.04 μM, 0.05 μM, or a value or a range between any two of the above values.

[0078] In some embodiments, in the second step amplification, the final concentration of the tag primer is 0.5 μM-2 μM. Without limitation, the final concentration of the tag primer can be 0.5 μM, 1 μM, 1.5 μM, 2 μM, or a value or a range between any two of the above values.

[0079] In some embodiments, in the second step amplification, the amplified product is purified by magnetic beads.

[0080] In some embodiments, in step S200, the sequencing is high-throughput sequencing, and further is pathogen-targeted sequencing.

[0081] In some embodiments, in step S200, the sequencing is performed by using the MGISEQ or DNBSEQ sequencing platform of Huada.

[0082] In some embodiments, the library is subjected to DNB amplification before high-throughput sequencing.

[0083] In the present application, "DNB amplification" refers to the amplification of single-stranded circular DNA library to form DNA nanoballs by using the principle of rolling circle amplification (RCA), which can avoid the occurrence of error accumulation during the amplification process and effectively improve the sequencing accuracy.

[0084] In the fourth aspect of the present application, the primer set of the first aspect of the present application or the kit of the second aspect of the present application is used for preparing a product for detecting urinary tract infection.

[0085] Some embodiments are provided below.

[0086] The embodiments of the present application will be described in detail below with reference to the examples. It should be understood that these examples are only used to illustrate the present application and not intended to limit the scope of the present application. The experimental methods in the following examples, if not specified, the priority is given to the guidance provided in the present application, but also can be in accordance with the experimental manual or conventional conditions in the art, but also in accordance with the conditions suggested by the manufacturer, or reference to the known experimental methods in the art.

[0087] In the following examples, the amount of raw material components involved in the parameter, if not specified, there may be a slight deviation within the range of weighing accuracy. Involving temperature and time parameters, allow acceptable deviation caused by the accuracy of the instrument test or operation accuracy.

[0088] Example 1:

[0089] The specific technical solutions adopted in the present application are as follows:

[0090] 1. Primer design and synthesis

[0091] The present application covers 43 kinds of clinically common pathogenic bacteria related to urinary system infection and 6 drug resistance genes, wherein the pathogenic bacteria include Acinetobacter baumannii, Citrobacter freundii, Citrobacter koseri, Enterobacter cloacae complex, Escherichia coli, Klebsiella pneumoniae, Morganella morganii, Mycobacterium tuberculosis complex, Proteus mirabilis, Pseudomonas aeruginosa, Pseudomonas putida, Serratia marcescens, Stenotrophomonas maltophilia, Corynebacterium striatum, Enterococcus faecalis, Enterococcus faecium, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Staphylococcus saprophyticus, Streptococcus agalactiae, Streptococcus pneumoniae, Streptococcus pyogenes, Candida glabrata, Aspergillus fumigatus, Candida albicans, Candida auris, Candida parapsilosis, Candida tropicalis, Cryptococcus neoformans, Pneumocystis jirovecii, Chlamydia trachomatis, Coxiella burnetii, Mycoplasma genitalium, Mycoplasma hominis, Ureaplasma parvum, Ureaplasma urealyticum, human herpesvirus 5 (CMV), human herpesvirus 4 (EBV), human adenovirus B, human adenovirus C, human polyomavirus 1 (BK polyomavirus), human polyomavirus 2 (JC polyomavirus), and the drug resistance genes (non-mutation) include KPC, NDM, OXA-23, mecA, vanA, CTX-M. The above species and the regions where the drug resistance genes are located are subjected to multiple primer design and screening (see Table 1 for primer sequences).

[0092] The primer sequences designed are synthesized into one pool, named YK UT panel Mix.

[0093] Table 1

[0094]

[0095]

[0096]

[0097]

[0098]

[0099]

[0100] The 5' end of the primer further comprises an MGI-UDB tag sequence, wherein the primer represented by SEQ ID NO: 1-104 needs to be added with F-tag: TCACAGAACGACATGGCTACGATCCGACTT (SEQ ID NO: 209); and the primer represented by SEQ ID NO: 105-208 needs to be added with R-tag: GTCTTCCTAAGACCGCTTGGCCTCCGACTT (SEQ ID NO: 210).

[0101] 2. Sample pre-treatment and nucleic acid extraction

[0102] The present application relates to sample types mainly urine, including conventional clean midstream urine (morning urine), suprapubic bladder puncture urine, catheterization, bladder catheterization, etc. The sample collection is recommended 2-10 mL. The sample is treated within 24 hours after collection and stored at 2-8°C, and long-term storage requires storage at -20°C or -80°C.

[0103] Alternatively, 2-10 mL of urine sample is centrifuged (4000 rpm, centrifugation for 10 min) before extraction, the supernatant is removed, and 400 μL-1000 μL of the lower precipitate is taken.

[0104] The urine sample needs to be broken before nucleic acid extraction: take out the grinding tube, add 1000 uL of lysis solution to the grinding tube, add 400 μL-1000 μL of the sample to be tested, and preferably 800 μL; break the wall on the wall instrument (power 165 W; speed 18 M / s) for 420 s.

[0105] Nucleic acid extraction: acid extraction or purification reagent (magnetic bead method) of Guangzhou Dan Gene Co., Ltd. is used for nucleic acid extraction of the above sample.

[0106] 1) The supernatant of the sample after the wall breaking treatment is placed in a 2 mL centrifuge tube, 30 μL of high affinity silicon-based magnetic beads and 40 μL of proteinase K are added, and vortexed thoroughly;

[0107] 2) Place the centrifuge tube in a constant temperature shaking metal bath, incubate at 70°C for 12 min (at a speed of 1000 rpm), and then centrifuge instantly after standing;

[0108] 3) Place the centrifuge tube on the magnetic stand, and after the magnetic beads are completely adsorbed, carefully remove the liquid with a pipette, and note that the magnetic beads are not sucked;

[0109] 4) Add 800 μL of washing solution 1 to the centrifuge tube, vortex for 1 min, and centrifuge instantly after standing;

[0110] 5) Place the centrifuge tube on the magnetic stand, and after the magnetic beads are completely adsorbed, carefully remove the liquid with a pipette, and note that the magnetic beads are not sucked;

[0111] 6) Add 800 μL of washing solution 2 to the centrifuge tube, vortex for 1 min, and centrifuge instantly after standing;

[0112] 7) Place the centrifuge tube on the magnetic stand, and after the magnetic beads are completely adsorbed, carefully remove the liquid with a pipette, and note that the magnetic beads are not sucked;

[0113] 8) Repeat steps 6) and 7);

[0114] 9) Instantly centrifuge the tube for 10 seconds, place the tube on the magnetic stand, and remove the liquid carefully with a pipette, taking care not to suck up the magnetic beads. Open the cap and air dry for 3-5 minutes;

[0115] 10) Add 100 μL elution buffer to the tube, vortex to mix, and incubate at room temperature for 5 minutes. Then place the tube on the magnetic stand, and transfer the nucleic acid solution to a new sterile centrifuge tube after the magnetic beads are completely adsorbed.

[0116] Qubit 4.0 nucleic acid quantifier is used for DNA quantification. After nucleic acid extraction, if the subsequent experiment is not continued immediately, it can be stored at -20°C (within 1 month).

[0117] 3. Library construction and sequencing

[0118] Multiple PCR library construction kits are used for multiple PCR library construction. The first step amplification primer is YK UT panel Mix, which aims to amplify the target sequence of the pathogen of interest. The second step amplification primer is MGI-UDB tag primer (containing two upstream and downstream primers), which aims to add sample-specific Barcode sequence to the amplified product sequence to identify different samples. MGI-UDB is a universal amplification primer for sample-specific Barcode sequence, and the primer sequence is: PCR2-F: CTCTCAGTACGTCAGCAGTTnnnnnnnnnnCAACTCCTTGGCTCACAGAACGACATGGCTACGA (SEQ ID NO: 211); PCR2-R: GCATGGCGACCTTATCAGnnnnnnnnnnTTGTCTTCCTAAGACCGCTTGGCC (SEQ ID NO: 212), wherein nnnnnnnnnn is a 10-base sample-specific tag (barcode), and n is any of A / T / G / C; the upstream of PCR2-F primer also needs to be phosphorylated. There are currently 288 numbered MGI-UDB tag primers, and each numbered MGI-UDB tag primer has at least one difference in the Barcode sequence (10 bases) of the primer. The library construction system involved in the present application is suitable for Huada Intelligent Manufacturing MGISEQ or DNBSEQ sequencing platform.

[0119] (1) The first step amplification, the amount of amplified DNA template is 0.1 ng-500 ng, the reaction system is as shown in Table 2. Among them, the final concentration of the primer in YK UTpanel Mix is 0.05-0.2 μM, preferably 0.1 μM; the final concentration of the primer of the human gene internal reference gene is 0.025-0.1 μM, preferably 0.05 μM. Among them, the primer of the human gene internal reference gene is the primer of the human GAPDH internal reference gene, the sequence is F1: CCAGCAAGAGCACAAGAGGAAGAGA (SEQ ID NO: 213); R1: CCTCTTCAAGGGGTCTACATGGCAA (SEQ ID NO: 214).

[0120] Table 2

[0121]

[0122] The reaction procedure is as shown in Table 3:

[0123] Table 3

[0124]

[0125] (1) Purification of the first step amplification product: the first step amplification product is adsorbed by MagPure A3 XP 1beads (1.2x), and washed twice with 80% ethanol, and the remaining 80% ethanol in the tube is absorbed and discarded as much as possible, and placed at room temperature until dry, and finally resuspended with 23 μL of nuclease-free water (NFW) to wash the magnetic beads to obtain the purified product, and placed in a-20C refrigerator.

[0126] (2) The second step amplification reaction, the reaction system is as shown in Table 4, wherein MGI-UDB is a universal amplification primer of the sample-specific Barcode sequence:

[0127] Table 4

[0128] Component Volume (pL) NFW 10 2x Hifi Mix 25 MGI-UDB 5 First purified product 10 Total 50

[0129] The reaction procedure is as shown in Table 5:

[0130] Table 5

[0131]

[0132]

[0133] (1) Second step amplification product sorting: The non-target fragments in the second step amplification product were adsorbed and removed by MagPure A3 XP 1beads (0.75x), and then the purified product of the previous step was adsorbed by MagPure A3 XP 1beads (0.9x), and washed twice with 80% ethanol, and the remaining 80% ethanol in the tube was removed as much as possible, and placed at room temperature until dry, and finally eluted with 20ul NFW to resuspend the magnetic beads as the purified product.

[0134] (2) Qubit 4.0 assay library concentration, concentration > 0.4 ng / μL indicates that the library concentration is qualified, and then Agilent 2100 detection is performed, and the normal library main peak fragment is 240bp and 350bp, and there is no adapter and large fragment pollution, which is qualified for quality control. At this time, the eluted product is a library that can be loaded onto the machine, and is stored in a -20°C refrigerator for long-term storage.

[0135] (3) Sequencing, according to the throughput and total amount of the sequencer and the concentration of the sample library, all libraries are mixed together, and after DNB amplification, the machine is loaded for sequencing, and the data amount is allocated according to 0.5M reads-5M reads, preferably according to 1M reads.

[0136] 4. Data analysis

[0137] (1) Data quality control filtering

[0138] The original test data is filtered using Fastp software (v0.22.0), and the filtering parameters for analysis are: a) cut off sequences containing adapters (dimers); b) remove sequences with average base quality control below 15, and remove sequences with N base number greater than 5; c) polyG tail trimming minimum length is 10bp, 3 end polyX trimming length is 10bp, and after the above processing, the filtered Clean FASTQ file is obtained.

[0139] (2) Database alignment

[0140] The Clean FASTQ sequence is aligned with the target amplification sequence using BWA mem (v0.7.17) to obtain the alignment sam file, and the sam file is counted using a statistical script, and the results with a similarity of 90% or more to the target amplification sequence are retained, and the total number of each target amplification sequence is calculated.

[0141] (3) Analysis of drug-resistant mutations

[0142] The sam file obtained in step 2 is analyzed for mutations using bcftools software, and the results are matched with a known variant database to obtain the total number of site mutation sequences and mutation frequency.

[0143] (4) Data statistics

[0144] The database comparison results and mutation analysis results are annotated to the species information using scripts to obtain the number of detected sequences, the total number of drug-resistant gene sequences, and the mutation frequency of each species.

[0145] Example 2:

[0146] Sensitivity analysis of the detection range of the species based on the present application

[0147] The cultured bacteria, fungi, and viruses are used to prepare positive reference tNGS MIXA and negative reference NC, and the concentration is confirmed by digital PCR (ddPCR) technology. The tNGS MIXA is diluted by 10 times, 100 times, and 1000 times to obtain tNGS MIXA1, MIXA2, and MIXA3, respectively, and the matrix is a human cell line, such as Hela cells (concentration of 1.00E+06 cell / mL). The pathogens contained in all reference samples and their concentrations are shown in Table 6 below:

[0148] Table 6

[0149]

[0150]

[0151] The positive reference samples and negative reference samples at all concentration gradients are used to detect the above-mentioned urinary system panel, and the detection limit / analysis sensitivity is analyzed by analyzing the number of sequences and the determination results. The pathogen detection read number statistics results of each gradient positive reference sample are shown in Table 7 below:

[0152] Table 7

[0153] Species name tNGS MixA tNGS MixA1 tNGS MixA2 tNGS MixA3 Human herpesvirus 1 92531 139691 125475 37834 Staphylococcus aureus 151 107 14 5 Streptococcus pneumoniae 3987 620 778 139 Klebsiella pneumoniae 7767 1769 1256 256 Pseudomonas aeruginosa 32323 7668 5937 1255 Mycoplasma hominis 2809 282 44 7 Aspergillus fumigatus 1241 283 99 4

[0154] According to the positive threshold of reads≥10, the above detection results are compared and analyzed to obtain the detection limit of various pathogens, as shown in Table 8 below:

[0155] Table 8

[0156] Pathogen Limit of detection (CFU / mL, copies / mL) Human herpesvirus 1 1E+01 Staphylococcus aureus 1E+02 Streptococcus pneumoniae 1E+01 Klebsiella pneumoniae 1E+01 Pseudomonas aeruginosa 1E+01 Mycoplasma hominis 1E+02 Aspergillus fumigatus 1E+02

[0157] It is indicated that the detection limit of the above-mentioned detection kit for DNA viruses is 10^1 copies / mL, the detection limit for gram-negative bacteria, mycoplasma, and aspergillus is 10^1 CFU / mL, 10^2 CFU / mL, and 10^2 CFU / mL, respectively, and the detection limit for gram-positive bacteria is between 10^1 and 10^2 CFU / mL. The detection limits of the above-mentioned species are higher than those of traditional PCR, multiplex PCR, or flow fluorescence detection technology based on PCR.

[0158] Example 3:

[0159] Comparison of tNGS detection with urine culture and mNGS detection in species identification performance

[0160] For suspected urinary tract infection, and culture-positive urine samples a total of 167, parallel tNGS detection of urine described above, and pathogenic microorganism macrogenomics (mNGS) detection, analysis of tNGS detection and mNGS detection in the sensitivity and accuracy of the results of clinical samples. 167 samples including 149 bacterial positive and 18 fungal positive samples, of which 164 were single species positive and 3 were multi-species positive (Escherichia coli + Proteus mirabilis, Streptococcus agalactiae + Staphylococcus aureus, and Escherichia coli + Enterococcus faecium), respectively, as shown in Figure 1 and Figure 2 .

[0161] After analyzing the tNGS and mNGS detection results:

[0162] 1) Among the 167 culture-positive urine samples, the species of 7 samples were outside the detection range of tNGS, and among the 160 samples within the detection range, tNGS detected and reported 159 positive samples. The clinical sensitivity of the detection range was 99.38% (159 / 160).

[0163] 2) Among the 167 samples, mNGS detected and reported 166 positive samples, and the clinical sensitivity of the detection was 99.41% (166 / 167).

[0164] 3) tNGS and mNGS both detected different results from culture in the same sample, in which the culture-positive species was Escherichia coli, while tNGS and mNGS were both detected Serratia marcescens. The detection consistency of tNGS and mNGS was 95.81% (160 / 167).

[0165] The above results can conclude that the detection consistency of tNGS within the detection range and mNGS is 100% (160 / 160), and in real-world samples (including species outside the tNGS detection range), the performance of tNGS is also basically consistent with mNGS (consistency 95.81%). At the same time, it shows that tNGS detection of 53 pathogens can cover most of the clinically concerned bacteria and fungi (95.81%).

[0166] Example 4:

[0167] Comparison of tNGS detection and urine drug sensitivity test in antibiotic drug sensitivity consistency

[0168] Drug resistance gene analysis of tNGS and mNGS were performed on 121 urine samples with culture and drug susceptibility analysis, in which the culture positive species were Escherichia coli, Pseudomonas aeruginosa, Klebsiella pneumoniae, Acinetobacter baumannii, Proteus mirabilis, Enterococcus faecium, Enterococcus faecalis and Staphylococcus aureus, and drug resistance genes related to ESBL, CRE, VRE and MRSA were analyzed. The analysis results are as follows:

[0169] 1) The detection rate of tNGS in cephalosporin resistance genes most related to urinary system infection was much higher than that of mNGS (28.93% vs 13.23%), which reflected the advantage of tNGS in drug resistance gene detection. The number of drug resistance genes detected by tNGS and mNGS is shown in Table 9:

[0170] Table 9

[0171]

[0172] 2) The overall consistency of tNGS and drug susceptibility results was 76.85% (93 / 121), and the overall consistency of mNGS and drug susceptibility results was 69.43% (84 / 121), and the consistency of tNGS and drug susceptibility results was higher than that of mNGS.

[0173] Each technical feature of the above-described embodiments can be combined arbitrarily, and to make the description concise, each technical feature in the above-described embodiments is not described in all possible combinations, however, as long as the combination of technical features does not exist contradictory, it should be considered as the scope of the present application.

[0174] The above-described embodiments only express several embodiments of the present application, and the description is more specific and detailed, but it should not be understood as a limitation on the scope of the patent. It should be noted that for ordinary skilled in the art, without departing from the concept of the present application, a number of modifications and improvements can be made, which are within the scope of the present application. Therefore, the scope of the patent of the present application should be subject to the appended claims, and the description and drawings can be used to explain the content of the claims.

Claims

1. A primer set for detecting a pathogen of urinary system infection and a drug resistance gene, characterized in that, The primer set is composed of primers with nucleotide sequences as shown in SEQ ID NO: 1-208.

2. The primer set of claim 1, wherein The primer set further comprises a linker.

3. The primer set of claim 2, wherein The primer with nucleotide sequence as shown in SEQ ID NO: 1-104 is connected to a linker with nucleotide sequence as shown in SEQ ID NO: 209, and the primer with nucleotide sequence as shown in SEQ ID NO: 105-208 is connected to a linker with nucleotide sequence as shown in SEQ ID NO:

210.

4. A kit for detecting urological infection pathogens and drug resistance genes, characterized by, The kit comprises the primer set according to any one of claims 1-3.

5. The kit of claim 4, wherein The kit further comprises a tag primer; the tag primer is used to identify different samples.

6. The kit of claim 4 or 5, wherein The kit further comprises PCR amplification reagents.

7. The kit of claim 6, wherein The PCR amplification reagents comprise multiplex PCR amplification reagents.

8. The kit of claim 7, wherein The multiplex PCR amplification reagents comprise one or more of PCR buffer, multiplex amplification enzyme and dNTPs.

9. The kit of claim 4, wherein The kit further comprises an internal reference primer.

10. A method of detecting uropathogenic agents and drug resistance genes, characterized by, The method is for non-disease diagnosis purposes, and the method comprises the following steps: PCR amplification library construction is performed on sample DNA using the kit according to any one of claims 4-9, and a library is obtained; and sequencing is performed on the library.

11. The method for detecting pathogens and drug resistance genes of urinary system infections according to claim 10, wherein, The sequencing is high-throughput sequencing.

12. The method of detecting pathogen and drug resistance gene of urinary system infection according to claim 11, wherein, The high-throughput sequencing is pathogen-targeted sequencing.

13. The method of detecting pathogen and drug resistance genes of urinary system infection according to claim 10, wherein the pathogen and drug resistance genes are selected from the group consisting of the genes listed in Table 1. The PCR amplification is multiplex PCR amplification.

14. The method of detecting the pathogen and drug resistance gene of urinary system infection according to claim 13, wherein, The multiplex PCR amplification comprises first-step amplification and second-step amplification, the reaction system of the first-step amplification comprises the primer set according to claim 1 or 2, sample DNA, nuclease-free water, multiplex amplification enzyme, human gene internal reference primer and PCR buffer; the reaction system of the second-step amplification comprises the first-step amplification product, tag primer, nuclease-free water and PCR premix.

15. The method for detecting pathogens and drug resistance genes of urinary system infections according to claim 14, wherein, The first-step amplification product and the second-step amplification product are purified by magnetic beads.

16. The method of detecting the pathogen and drug resistance gene of urinary system infection as claimed in claim 14, wherein, In the reaction system of the first-step amplification, the final concentration of the primer set is 0.05-0.2 μM, the final concentration of the sample DNA is greater than or equal to 0.2 ng / μL, the final concentration of the multiplex amplification enzyme is 0.9-1.1 U / μL, and the final concentration of the human gene internal reference primer is 0.025-0.1 μM.

17. The method of detecting pathogen and drug resistance genes of urinary system infection according to claim 14, wherein the pathogen and drug resistance genes are selected from the group consisting of the genes listed in Table 1. In the reaction system of the second-step amplification, the final concentration of the first-step amplification product is 0.01-0.05 μM, the final concentration of the tag primer is 0.5-2 μM, and the PCR premix comprises one or more of hot-start enzyme, dNTPs and reaction buffer.

18. Use of the primer set for detecting pathogens and drug resistance genes of urinary system infections according to any one of claims 1-3 in the preparation of a product for detecting urinary tract infections.

Citation Information

Patent Citations

  • Primer composition for pathogen detection and application thereof

    CN118834973A

  • Primer and test kit for detecting urinary tract infection pathogen and drug-resistant gene, and use thereof

    WO2024169511A1