SNP (Single Nucleotide Polymorphism) site related to flower color character of xanthoceras sorbifolia bunge and application

Abstract

The invention relates to the technical field of molecular markers, and provides an SNP (Single Nucleotide Polymorphism) site related to the flower color character of shiny-leaved yellowhorn and application, the SNP site related to the flower color character of the shiny-leaved yellowhorn is located on the 332th basic group of a nucleotide sequence as shown in SEQ ID NO: 1 and corresponds to the mutation of the 13469119th basic group on the 14th chromosome of a shiny-leaved yellowhorn genome, the basic group N of the SNP site is G or A, and the SNP site is a nucleotide sequence as shown in SEQ ID NO: 2. The shiny-leaved yellowhorn plant with the basic group G blooms white, and the shiny-leaved yellowhorn plant with the basic group A blooms safflower. According to the technical scheme, the problem that the flower color character of the shiny-leaved yellowhorn cannot be identified in the early stage in the prior art is solved.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular markers, and in particular to a SNP site related to flower color traits of Xanthoceras sorbifolia and an application thereof. Background Art

[0002] Xanthoceras sorbifolia has a beautiful appearance and dense flowers. It can be used for greening barren hills and gardens. According to the color of the petals, Xanthoceras sorbifolia can be divided into white-flowered trees and red-flowered trees. White-flowered trees have white petals, while red-flowered trees have red petals. White-flowered trees are the most common type, while red-flowered trees are less common and have a higher ornamental value.

[0003] Genome-wide association study (GWAS) is a method used to identify associations between variation and phenotypes across the entire genome. This method uses hundreds or tens of millions of genetic variations in the genomes of each sample in a natural population to find variant sites that are significantly associated with the target phenotype. Derivative amplified polymorphism markers (dCAPS) can convert SNP sites into sites that can be cleaved by enzymes by artificially introducing mismatched bases for electrophoresis detection. It has the characteristics of simple operation, rapid detection, low cost, and no reliance on precision instruments.

[0004] Xanthoceras sorbifolia seeds can only bloom and bear fruit two years after germination. Therefore, studying a SNP site related to the flower color trait of Xanthoceras sorbifolia can be used to identify whether the tested plants have red or white flowers in the early stage of Xanthoceras sorbifolia growth and development, which is of great significance for greatly shortening the breeding period of Xanthoceras sorbifolia and improving breeding efficiency. Summary of the invention

[0005] The present invention proposes a SNP site related to the flower color trait of Xanthoceras sorbifolia and an application thereof, which solves the problem in the related art that the flower color trait of Xanthoceras sorbifolia cannot be identified at an early stage.

[0006] The technical solution of the present invention is as follows: The present invention proposes a SNP site associated with the flower color trait of Xanthoceras sorbifolia, wherein the SNP site is located at the 332nd base of the nucleotide sequence shown in SEQ ID NO: 1, corresponding to the 13469119th base mutation on chromosome 14 of the Xanthoceras sorbifolia genome, the base N of the SNP site is G or A, the Xanthoceras sorbifolia plants with the base G bloom white flowers, and the Xanthoceras sorbifolia plants with the base A bloom red flowers.

[0007] As a further technical solution, N in the nucleotide sequence is the 332nd position of the SEQ ID NO:1 sequence.

[0008] The present invention also proposes the use of the SNP site associated with the flower color trait of Xanthoceras sorbifolia in identifying the flower color trait of Xanthoceras sorbifolia.

[0009] As a further technical solution, the flower color traits of Xanthoceras sorbifolia were identified during the seedling stage.

[0010] The present invention also provides a dCAPS molecular marker of a SNP site related to the flower color trait of Xanthoceras sorbifolia, wherein the primer pair comprises a first primer pair and a second primer pair; The nucleotide sequences of the first primer pair and the second primer pair are as follows: F1: GGCTAGGGCTTGGGCTAATA, as shown in SEQ ID NO: 2; R1: TGGACGTGCAACCTGATACTG, as shown in SEQ ID NO:3; F2: GATCAACTTGGGCTAGGGCTT, as shown in SEQ ID NO:4; R2: tttttttttttttttttttttttttttttttttTGTTGAGGACCTAGTTCTGGATC, as shown in SEQ ID NO:5.

[0011] As a further technical solution, the upstream primer F1 and the downstream primer R1 of the first primer pair are amplified by PCR to obtain a specific band including SNP; the upstream primer F2 and the downstream primer R2 of the second primer pair are amplified by PCR to introduce mismatched bases.

[0012] The present invention also proposes the application of the dCAPS molecular marker in identifying the flower color traits of Xanthoceras sorbifolia.

[0013] The present invention also proposes a method for screening SNP loci related to the flower color trait of Xanthoceras sorbifolia, comprising the following steps: S1, extracting DNA from Xanthoceras sorbifolia samples and performing whole genome resequencing to obtain original sequencing data; S2, quality control the original sequencing data, and compare it with the Xanthoceras sorbifolia reference genome to obtain SNPs in the whole genome; S3. Through genome-wide association analysis, SNP loci associated with flower color traits of Xanthoceras sorbifolia were determined. The SNP loci associated with the flower color traits of Xanthoceras sorbifolia were screened out through genome-wide association analysis. The genotype of this locus was significantly correlated with the flower color traits of Xanthoceras sorbifolia.

[0014] The present invention also proposes a method for identifying flower color traits of Xanthoceras sorbifolia based on dCAPS molecular marker technology, comprising the following steps: A1. Extracting genomic DNA from Xanthoceras sorbifolia. A2, performing PCR amplification using the first primer pair and the second primer pair; A3, digesting the final product obtained by PCR with restriction endonucleases and then performing electrophoresis; A4. Result judgment: If the electrophoresis obtains a 301bp electrophoresis band, the genotype of the SNP site of Xanthoceras sorbifolia is GG, and the flower color is white; if the electrophoresis obtains a 361bp electrophoresis band, the genotype of the SNP site of Xanthoceras sorbifolia is AA, and the flower color is red.

[0015] As a further technical solution, in step A2, when the first primer pair is used for PCR amplification, the amplification program is 98°C for 30s; 98°C for 10s, 62°C for 5s, 72°C for 3s, for a total of 35 cycles; 72°C for 1min, and stored at 4°C; When the second primer pair is used for PCR amplification, the amplification program is 98°C for 30s; 98°C for 10s, 62°C for 5s, 72°C for 1s, for a total of 35 cycles; 72°C for 1min, and stored at 4°C.

[0016] As a further technical solution, when the first primer pair is used for PCR amplification, the PCR amplification system is 10 μL of 2×Phanta Flash Master Mix (Dye Plus), 1 μL of upstream and downstream primers, 1 μL of DNA template, and ddH2O supplemented to 20 μL; When the second primer pair is used for PCR amplification, the PCR amplification system is 10 μL of 2×Phanta Flash MasterMix (Dye Plus), 1 μL of upstream and downstream primers, 1 μL of DNA template, and ddH2O is added to 20 μL.

[0017] As a further technical solution, in step A3, the restriction endonuclease is BamHI enzyme.

[0018] The present invention also provides a kit for identifying the flower color trait of Xanthoceras sorbifolia, and the kit comprises the primer pair.

[0019] The working principle and beneficial effects of the present invention are: The invention discloses a SNP site that affects the flower color trait of Xanthoceras sorbifolia. Based on the characteristics of the SNP site, the early identification of the flower color of Xanthoceras sorbifolia can be completed at low cost, high throughput, quickly and efficiently, greatly shortening the breeding cycle, and having important theoretical and practical significance for the breeding of Xanthoceras sorbifolia with different flower colors. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] The present invention will be further described in detail below in conjunction with the accompanying drawings and specific embodiments.

[0021] Figure 1 This is a Manhattan plot of the GWAS association results of Xanthoceras chinensis flower color in Example 1 of the present invention; Figure 2 This is the electrophoresis diagram of safflower and white flower Xanthoceras sorbifolia after BamHI digestion after dCAPS molecular marker amplification in Example 3 of the present invention. DETAILED DESCRIPTION

[0022] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0023] The experimental methods used in the following examples are all conventional methods, and the instruments and equipment used are all conventional laboratory instruments and equipment; the reagents involved, unless otherwise specified, are all commercially available conventional reagents; 203 portions of Xanthoceras sorbifolia materials were taken from 103 portions in Handan, Hebei Province, 28 portions in Zhangjiakou, 26 portions in Chengde, 25 portions in Shijiazhuang, 12 portions in Xingtai, and 9 portions in Tangshan.

[0024] Example 1 A method for screening SNP loci associated with Xanthoceras sorbifolia flower color traits comprises the following steps: S1. Extraction of total DNA: A total of 203 natural populations of Xanthoceras sorbifolia were collected, and young leaf samples of each plant were preserved. DNA from all samples was extracted and a high-throughput sequencing library was constructed for sequencing analysis. S2. Genome alignment and variant site detection: 1) Filter the raw sequencing data to obtain clean reads; 2) Align the clean reads of each sample to the Xanthoceras sorbifolia reference genome; 3) Sort the comparison results; 4) Remove duplication; 5) Detect and filter population SNPs; S3. Genome-wide association analysis: The flower color phenotypes (white and red flowers) of 203 Xanthoceras sorbifolia materials were associated with the obtained SNPs. The p-value of all SNP sites was calculated using the assoc adjust method. Then, a Manhattan plot was drawn based on -log10 (p-value) and the position of the SNP on each chromosome. It was observed that there were significant SNP sites on chromosome 14, such as Figure 1 As shown, Figure 1 It shows that the SNP molecular marker screened by the present invention is located on chromosome 14, and the point indicated by the arrow is the SNP molecular marker of the present invention, that is, the 332nd base of the nucleotide sequence shown in SEQ ID NO: 1; The nucleotide sequence shown in SEQ ID NO: 1 is as follows: AATTCGGTTCTTCTTGCAATTTCGCTTGTGAGATCAACTTGGGCTAGGGCTTGGGCTAATAACCTAAGAACTAGAGAGCAAGGGATTCCCTAAAAAGGTAACTAAGCTCAAAATTTATCTACATTGTTTTTAATTTGTGTTGGGTGTTGTTTATTTGGTTATTAGTGA AGTTAGGATTGTGGATTTGTGTTGATTTCGGGATTAATTGAAGTTTGAGTGTGTTATTGTGTTAATTTGGGAAATTAAGGTTTATGGGTGTTTGTAATTTGGGGCTAAATTGAAGTTAGGGTTGAATTGGATTGTTAATTGATAGAGTAGTTAGGTTTGTTGTTN(G / A)GATTTAGAACTAGGTCCTCAACATATTAATTTCTTATTACATTAATATCAAGTTGTACATCCACAGGTGGCTTGTTATGTTTTAACCTTGGTGGCAAAACTTTATCTTACTGTTTGACTTTCAGGCTGTCAATTAGTAAGGCTTGGTGACAAAACTTTATCTCA CCGTTTGACTTTCAGGCTAACATTAGTTTCTTATTACATTAATATCAAGTTGTACATCCACACGCGGCTTGTTATGTTTTAACCTTGGTGGTAAAACTTTATCTTACTGTTTGACTTTCAGGCTGTTAATTAGTTCCACATTACATCAGTATCAGGTTGCACGTCCA.

[0025] The N at the 332nd base of the above sequence is G or A, and this mutation causes polymorphism in the above sequence.

[0026] Example 2 Development of a dCAPS molecular marker associated with flower color traits in Xanthoceras sorbifolia 2.1 Primer design According to the Xanthoceras sorbifolia genome sequence, specific primers were designed to PCR amplify the DNA fragment containing the SNP site: F1: GGCTAGGGCTTGGGCTAATA, as shown in SEQ ID NO: 2; R1: TGGACGTGCAACCTGATACTG, as shown in SEQ ID NO:3; The target sequence amplified by PCR using F1 and R1 as primer pair is shown in SEQ ID NO:1.

[0027] 2.2 Design of dCAPS primers The dCAPS primers were designed according to the SNP sites obtained in Example 1, and the specific steps were as follows: Select restriction endonuclease (BamHI) to introduce mismatched bases (TT→CC) at positions 336-337 of the sequence shown in SEQ ID NO:1; The final primer sequences are as follows: F2: GATCAACTTGGGCTAGGGCTT, as shown in SEQ ID NO:4; R2: tttttttttttttttttttttttttttttttttTGTTGAGGACCTAGTTCTGGATC, as shown in SEQ ID NO:5.

[0028] Specific bands including SNP were obtained by PCR amplification using F1 and R1 as primer pairs. Subsequently, mismatched bases were introduced by PCR amplification using F2 and R2 as primer pairs, and the amplified product was further digested with BamHI. When digested, a specific band of 301bp appeared, and the material tested was judged to be white flower Xanthoceras sorbifolia. When not digested, only a specific band of 361bp appeared, and the material tested was judged to be red flower Xanthoceras sorbifolia.

[0029] Example 3 Application of molecular markers Using the molecular marker primers obtained in Example 2, identification was performed in 8 randomly selected safflower and 8 white flower materials that had not been subjected to GWAS sequencing, comprising the following steps: A1. Extract DNA from young leaves of Xanthoceras sorbifolia using the FastPure Plant DNA Isolation Mini Kit-DC104 (Nanjing Novogene Biotech Co., Ltd.); A2. Using the genomic DNA obtained in A1 as a template, perform the first PCR amplification on F1 and R1 with the first primer to obtain a preliminary amplification product; the reaction system for the first PCR amplification is: 10 μL of 2×Phanta Flash Master Mix (DyePlus), 1 μL of upstream and downstream primers, 1 μL of DNA template, and ddH2O to 20 μL; The conditions for the first PCR amplification were 98°C for 30 s; 98°C for 10 s, 62°C for 5 s, 72°C for 3 s, for a total of 35 cycles; 72°C for 1 min, and stored at 4°C; The primary amplification product of A2 was diluted 100 times, and used as a template to perform a second PCR amplification on F2 and R2 with the second primer to obtain the final PCR amplification product; the reaction system for the second PCR amplification was: 2×Phanta Flash MasterMix (Dye Plus) 10μL, 1μL of upstream and downstream primers, 1μL of DNA template, and ddH2O to 20μL; The conditions for the second PCR amplification were 98°C for 30 s; 98°C for 10 s, 62°C for 5 s, 72°C for 1 s, for a total of 35 cycles; 72°C for 1 min, and stored at 4°C; A3, the final PCR amplification product in A2 was digested with restriction endonuclease BamHI (R3136S) (New England Biolabs), the digestion system was: 10 μL of PCR amplification product, 1 μL of restriction endonuclease, 3 μL of restriction endonuclease buffer, and ddH2O to 30 μL; The enzyme digestion reaction conditions were: incubation at 37°C for 3 h; inactivation at 65°C for 20 min; The above enzyme digestion products were subjected to agarose gel electrophoresis and photographed using a gel imager. The electrophoresis conditions were: 3.0% agarose gel (3 g agarose dissolved in 100 mL buffer), voltage: 120 V, time: 60 min; A4. Result judgment: If the electrophoresis results in a band of 301 bp, the genotype of the SNP site of Xanthoceras sorbifolia is GG, and the flower color is white; if the electrophoresis results in a band of 361 bp, the genotype of the SNP site of Xanthoceras sorbifolia is AA, and the flower color is red; The results are as follows Figure 2 As shown, 8 randomly selected white flower Xanthoceras sorbifolia materials can be digested by enzymes, with a band of 301 bp, while 8 red flower Xanthoceras sorbifolia materials cannot be digested by enzymes, with a band of 361 bp. The results show that the molecular marker polymorphism shown in SEQ ID NO: 1 is significantly correlated with the flower color trait of Xanthoceras sorbifolia, and can be used for the breeding of flower color traits of Xanthoceras sorbifolia.

[0030] The above are only preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A SNP site associated with the flower color trait of Xanthoceras sorbifolia, characterized in that: The SNP site is located at the 332nd base of the nucleotide sequence shown in SEQ ID NO: 1, corresponding to the base mutation at the 13469119th base on chromosome 14 of the Xanthoceras sorbifolia genome. The base N of the SNP site is G or A. The Xanthoceras sorbifolia plants with the base G bloom white flowers, and the Xanthoceras sorbifolia plants with the base A bloom red flowers.

2. Use of a SNP site associated with the flower color trait of Xanthoceras sorbifolia according to claim 1 in identifying the flower color trait of Xanthoceras sorbifolia.

3. The use according to claim 2, characterized in that: Identify flower color traits of Xanthoceras sorbifolia at the seedling stage.

4. The dCAPS molecular marker of a SNP locus related to the flower color trait of Xanthoceras sorbifolia according to claim 1, characterized in that: The primer pair includes a first primer pair and a second primer pair; The nucleotide sequence of the upstream primer F1 of the first primer pair is shown in SEQ ID NO: 2; The nucleotide sequence of the downstream primer R1 of the first primer pair is shown in SEQ ID NO: 3; The nucleotide sequence of the upstream primer F2 of the second primer pair is shown in SEQ ID NO:4; The nucleotide sequence of the downstream primer R2 of the second primer pair is shown in SEQ ID NO:

5.

5. Use of the dCAPS molecular marker according to claim 4 in identifying flower color traits of Xanthoceras sorbifolia.

6. The method for screening SNP loci associated with flower color traits of Xanthoceras sorbifolia according to claim 1, characterized in that: The following steps are involved: S1, extracting DNA from Xanthoceras sorbifolia samples and performing whole genome resequencing to obtain original sequencing data; S2, quality control the original sequencing data, and compare it with the Xanthoceras sorbifolia reference genome to obtain SNPs in the whole genome; S3. Through genome-wide association analysis, SNP loci associated with flower color traits of Xanthoceras sorbifolia were determined.

7. A method for identifying flower color traits of Xanthoceras sorbifolia based on dCAPS molecular marker technology, characterized in that: The following steps are involved: A1. Extracting genomic DNA from Xanthoceras sorbifolia. A2, performing PCR amplification using the first primer pair and the second primer pair described in claim 4; A3, digesting the final product obtained by PCR with restriction endonucleases and performing electrophoresis; A4. Result judgment: If the electrophoresis obtains a 301bp electrophoresis band, the genotype of the SNP site of Xanthoceras sorbifolia is GG, and the flower color is white; if the electrophoresis obtains a 361bp electrophoresis band, the genotype of the SNP site of Xanthoceras sorbifolia is AA, and the flower color is red.

8. The method for identifying flower color traits of Xanthoceras sorbifolia based on dCAPS molecular marker technology according to claim 7, characterized in that: In step A2, when the first primer pair is used for PCR amplification, the amplification program is 98° C. for 30 s; 98° C. for 10 s, 62° C. for 5 s, 72° C. for 3 s, for a total of 35 cycles; 72° C. for 1 min, and stored at 4° C.; When the second primer pair is used for PCR amplification, the amplification program is 98°C for 30s; 98°C for 10s, 62°C for 5s, 72°C for 1s, for a total of 35 cycles; 72°C for 1min, and stored at 4°C.

9. The method for identifying flower color traits of Xanthoceras sorbifolia based on dCAPS molecular marker technology according to claim 7, characterized in that: In step A3, the restriction endonuclease is BamHI enzyme.

10. A kit for identifying flower color traits of Xanthoceras sorbifolia, characterized in that: The kit comprises the primer pair according to claim 4.

Images