Therapeutic adeno-associated viruses with signal peptide modification for treatment of pompe disease using codon optimized nucleic acids encoding alpha-glucosidase (GAA)

Abstract

Disclosed herein is a method of treating Pincare Disease, the method comprising administering a recombinant AAV (rAAV) vector comprising an rAVV genome comprising a heterologous nucleic acid encoding a GAA signal peptide or portion thereof, a heterologous signal peptide and an acidic alpha-glucosidase (GAA) polypeptide, or an N-terminal truncation thereof, the heterologous nucleic acid is operably linked to a liver-specific promoter wherein the nucleic acid encoding the GAA polypeptide may be a wild-type nucleic acid sequence, or a modified nucleic acid sequence, or a codon-optimized nucleic acid sequence, or a modified nucleic acid sequence, or a codon-optimized nucleic acid sequence, or a modified nucleic acid sequence, or a codon-optimized nucleic acid sequence. And may optionally be modified to reduce or completely eliminate CG and CpG dinucleotides and optionally eliminate alternative reading frame (ARF) content.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] Pursuant to 35 U.S.C. §119(e), this application claims the benefit of U.S. Provisional Application No. 63 / 321,336, filed on March 18, 2022, U.S. Provisional Application No. 63 / 348,862, filed on June 3, 2022, and U.S. Provisional Application No. 63 / 444,804, filed on February 10, 2023, the contents of each of which are incorporated herein by reference in their entirety. Sequence Listing

[0002] This application contains a Sequence Listing as shown in Table 9 herein, which is hereby incorporated by reference in its entirety. Technical Field

[0003] The present invention relates to methods for treating Pompe disease by administering vectors, adeno-associated virus (AAV) particles, and virions expressing alpha-glucosidase (GAA) polypeptides, wherein the nucleic acid encoding GAA can be codon-optimized or truncated. The compositions disclosed herein can be used in methods for treating Pompe disease that eliminate the need for long-term GAA enzyme replacement therapy (ERT) administered clinically for an extended period of time. Background Art

[0004] Pompe disease (glycogen storage disease type II; acid maltase deficiency; MIM232300) is caused by a recessive mutation in the GAA gene, resulting in a complete or partial deficiency of the lysosomal enzyme acid α-glucosidase (GAA). The loss of GAA leads to the progressive accumulation of glycogen in the lysosomes of many tissues, particularly skeletal muscle and cardiomyocytes. Impaired energy metabolism leads to severe muscle structural destruction, dysfunction, autophagy, and, in adults, marked fatty replacement of skeletal muscle cells.

[0005] Clinically, the condition ranges from fulminant infantile-onset Pompe disease (IPD), which typically leads to death before 12 months of age, to late-onset Pompe disease (LOPD), which slowly progresses to myopathy (resulting in immobility) and often leads to death from respiratory failure within 5-15 years of diagnosis. Patients with infantile-onset Pompe disease are often found to have cardiomyopathy at birth or even prenatally, with elevated creatine kinase (CK), followed by severe hypotonia, respiratory insufficiency requiring ventilator support, and severe cardiac hypertrophy within the first few weeks to months of life. The most common causes of death are cardiopulmonary failure, aspiration pneumonia, or ventricular arrhythmias. Patients with late-onset Pompe disease (LOPD) (mostly adults, some adolescents) experience slowly progressive muscle weakness that often leads to delayed diagnosis, extensive fat replacement of trunk and proximal limb muscles, and progression to respiratory failure, the main cause of death (Carlier et al., 2011). Basilar artery aneurysms can develop and, if ruptured, can be life-threatening (El-Gharbawy et al., 2011; Hobson-Webb et al., 2012). Gene therapy has been investigated as an alternative or adjunct to enzyme therapy for GSD-II (Amalfitano, A. et al., (1999) Proc. Natl. Acad. Sci. USA 96:8861-8866, Ding, E. et al., (2002) Mol. Ther. 5:436-446, Fraites, TJ et al., (2002) Mol. Ther. 5:571-578, Tsujino, S. et al., (1998) Hum. Gene Ther. 9:1609-1616).

[0006] (alglucosidase alfa) was the first product approved in the United States for the treatment of Pompe disease (2006); Alglucosidase alfa was approved in 2010 and is currently the standard of care (SOC) therapy for patients with infantile and late-onset Pompe disease. Alglucosidase alfa is administered intravenously as an infusion every two weeks at a dose of 20 mg / kg (LUMIZYME 2014 prescribing information). Alglucosidase alfa provides an exogenous source of GAA. Binding to the mannose-6-phosphate receptor on the cell surface has been shown to occur via carbohydrate groups on the GAA molecule, after which it is internalized and transported to the lysosome, where it undergoes proteolytic cleavage, resulting in increased enzyme activity. It then exerts its enzymatic activity in glycogenolysis. While this enzyme replacement therapy (ERT) prolongs survival for most patients with infantile Pompe disease, a subset of patients, despite adherence to SOC ERT, either die or suffer persistent muscle weakness or severe hypotonia requiring mechanical ventilator support. For patients with late-onset disease, ERT initially modestly improves muscle function and lung function parameters, followed by functional stabilization or decline, but it is still far from an ideal treatment ( Schoser et al., 2017 ).

[0007] In infantile-onset patients, particularly those with severe or null mutations (cross-reactive immune material [CRIM] negative), high and persistent anti-rhGAA immunoglobulin G (IgG)-mediated immunity to the GAA enzyme is a major cause of impaired or inadequate ERT responses. That is, ERT is known to elicit both IgG and IgE antibody responses and may also lead to infusion-related reactions (Kishnani et al., 2007; Kishnani et al., 2010). Current practice is to initiate immune modulation with ERT in patients with LOPD who are at risk for antibody development.

[0008] In addition, alglucosidase alfa ( / ) and is currently the only available treatment. For those with infantile-onset Pompe disease (IOPD), GAA is absent (CRIM-negative) or very low (approximately 1% of normal), and if left untreated, it can lead to rapidly progressive cardiopulmonary failure and death by age 2 years (Parini et al., 2018). Subjects with significant GAA deficiency in adolescents or adults (late-onset Pompe disease [LOPD]) present with milder symptoms and slower progression. Furthermore, missing biweekly treatments may result in a significant loss of efficacy, requiring months of ERT to restore the same level of response.

[0009] Therefore, despite the tentative success of alglucosidase alfa ERT, there remains a significant unmet medical need for IOPD and LOPD. Longitudinal data from patients confirm that ERT does not fully correct or restore patients with Pompe disease to normal. Although the rate of progression is slower, delaying the inevitable death process, patients generally still decline (Kuperus et al., 2017; Parini et al., 2018). Although alglucosidase alfa prolongs survival in patients with IOPD and LOPD (LUMIZYME Prescribing Information, 2014), it presents several drawbacks due to the antibody response to GAA and reduced efficacy.

[0010] Therefore, from a clinical perspective, the success rate of long-term treatment of Pompe disease patients using ERT is limited. In a subgroup of patients with IOPD, many patients experience high and persistent anti-rhGAA antibody titers (HSAT). Pompe disease patients who lack any residual GAA protein are considered CRIM-negative. CRIM-negative patients develop HSAT, while patients in the CRIM-positive subgroup also develop high or persistent intermediate titers, which greatly increase mortality (Banugaria et al., 2011). In addition, the use of immunosuppression to prevent antibody formation in patients at risk for HSAT has significantly prolonged survival and confirmed the clinical relevance of HSAT (Mendelsohn et al., 2009; Banugaria et al., 2011). In addition, the literature suggests that only approximately 1% of ERT is pharmacologically active.

[0011] Therefore, although enzyme therapy has been shown to have reasonable efficacy for severe infantile GSD II, the benefits of GAA enzyme therapy are limited by the need for frequent infusions and the development of inhibitors or neutralizing antibodies against recombinant hGAA protein in subjects (Amalfitano, A. et al., (2001) Genet. In Med. 3: 132-138). Therefore, improved methods and alternative therapies are needed to treat patients with Pompe disease. Adeno-associated virus (AAV) vector-mediated gene transfer provides a suitable and feasible alternative. Summary of the Invention

[0012] The technology described herein generally relates to a recombinant adeno-associated virus (rAAV) vector comprising in its genome: (a) 5′ and 3′ AAV inverted terminal repeat (ITR) sequences, and (b) a heterologous nucleic acid sequence located between the 5′ and 3′ ITRs, the heterologous nucleic acid sequence encoding all or a portion of an endogenous GAA signal peptide, a heterologous signal peptide, and an alpha-glucosidase (GAA) polypeptide, wherein the GAA polypeptide comprises amino acid residues 28-952 of SEQ ID NO:1, positions 57-952 of SEQ ID NO:1, or an N-terminal GAA polypeptide fragment, e.g., comprising amino acids 28, 28-29, 28-30, 28-31, 28-32, or 28-33 of SEQ ID NO:1 and immediately preceding amino acid residues 28, 28-29, 28-30, 28-31, 28-32, or 28-33 of SEQ ID NO:1. In some embodiments, the heterologous GAA polypeptide may be fused to an amino acid sequence of SEQ ID NO: 1, wherein the heterologous signal peptide is inserted immediately after the N-terminal GAA polypeptide and before the remaining amino acids of the GAA polypeptide, for example, wherein the heterologous signal peptide is optionally fused to amino acid position 57 of the remaining GAA polypeptide, wherein the GAA polypeptide may extend to amino acid position 952 of SEQ ID NO: 1, or a functional fragment thereof, wherein the nucleic acid sequence encoding the GAA polypeptide may be codon-optimized, and wherein the heterologous nucleic acid is operably linked to a liver-specific promoter. In certain embodiments, a homologous GAA signal peptide or fragment thereof may be present.

[0013] A recombinant adeno-associated virus (rAAV) vector comprising in its genome: (a) 5′ and 3′ AAV inverted terminal repeat (ITR) sequences, and (b) a heterologous nucleic acid sequence, optionally located between the 5′ and 3′ ITRs, encoding all or part of an endogenous GAA signal peptide, a heterologous signal peptide, and an α-glucosidase (GAA) polypeptide, wherein the GAA polypeptide comprises amino acid residues 28-952 of SEQ ID NO: 1, amino acids 57-952 of SEQ ID NO: 1, or an N-terminal GAA polypeptide fragment, e.g., comprising amino acids 28, 28-29, 28-30, 28-31, 28-32, or 28-33 of SEQ ID NO: 1 and a deletion of any number of amino acids from about 5 amino acids to about 40 amino acids following the N-terminal GAA polypeptide fragment of SEQ ID NO: 1, and wherein the heterologous signal peptide can be inserted directly before the remaining amino acids of the GAA polypeptide. In one embodiment, the heterologous signal peptide is optionally fused to amino acid position 57 of the remaining amino acids of the GAA polypeptide, and wherein the GAA polypeptide may extend to amino acid position 952 of SEQ ID NO: 1 or a functional fragment thereof, and wherein the nucleic acid sequence encoding the GAA polypeptide may be wild type or codon optimized, and wherein the heterologous nucleic acid is operably linked to a liver-specific promoter.

[0014] In some embodiments, the nucleic acid sequence encoding the endogenous GAA signal peptide encodes at least 1-5, or at least 1-10, or at least 1-20, or at least about 1-23, or at least about 1-24, or at least about 1-25, or at least about 1-26, or at least about 1-27 consecutive amino acids of the endogenous GAA signal peptide of SEQ ID NO:59. In some embodiments, the nucleic acid sequence encoding the GAA signal peptide encodes a modified GAA signal peptide, which comprises a deletion of at least 1, or at least 2, or at least 3, or at least 4, or at least 5, or at least 6, or at least 7, or at least 8, or at least 9, or at least 10, or at least 11, or at least 12, or at least 13, or at least 14, or at least 15, or at least 16, or at least 17, or at least 18, or at least 19, or at least 20 amino acids of SEQ ID NO: 59, wherein the deletion can be a continuous deletion or a non-continuous deletion.

[0015] In some embodiments, the nucleic acid sequence encoding the GAA signal peptide encodes at least 1-5, or at least 1-10, or at least 1-20, or at least about 1-23, or at least about 1-24, or at least about 1-25, or at least about 1-26, or at least about 1-27 consecutive amino acids of an endogenous GAA signal peptide.

[0016] In one embodiment of any aspect herein, there is a codon-optimized nucleic acid sequence encoding a GAA polypeptide selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 18 or functional fragments thereof.

[0017] In one embodiment of any aspect herein, the nucleic acid encoding SEQ ID NO: 3 is wild-type.

[0018] In one embodiment of any aspect herein, the vector comprises the nucleic acid sequence of SEQ ID NO: 23 or a functional variant thereof.

[0019] In one embodiment of any aspect herein, the heterologous nucleic acid sequence encodes a GAA protein comprising a signal peptide fused to a GAA polypeptide, wherein the signal peptide is an endogenous GAA signal peptide, or a heterologous signal peptide, or a combination thereof.

[0020] In one embodiment of any aspect herein, the AAV genome comprises, in 5′ to 3′ orientation: (a) a 5′ ITR, (b) a liver-specific promoter sequence, (c) a 5′ UTR sequence, (d) a nucleic acid encoding part or all of an endogenous GAA signal peptide, (e) a nucleic acid encoding a heterologous signal peptide or an N-terminal GAA polypeptide fragment, (f) a nucleic acid encoding an α-glucosidase (GAA) polypeptide, wherein the GAA polypeptide may be functionally active in its entirety or a fragment thereof, (g) a poly A sequence, and (h) an inverted RNA pol II terminator sequence.

[0021] In one embodiment of any aspect herein, the vector further comprises at least one of a UTR or an inverted RNA pol II terminator sequence.

[0022] In one embodiment of any of the aspects herein, the UTR is 5' or 3'.

[0023] In one embodiment of any aspect herein, the nucleic acid encoding the signal peptide encodes a signal sequence selected from any one of the following: endogenous GAA signal peptide, fibronectin signal peptide (FN1), IL-2wt signal peptide, modified IL-2 signal peptide, IL2(1-3) signal peptide, IgG signal peptide, AAT signal peptide, A2M signal peptide or PZP signal peptide, or active fragments thereof having signal peptide activity.

[0024] In one embodiment of any aspect herein, the nucleic acid sequence encodes a GAA polypeptide having the amino acid sequence of SEQ ID NO: 1, or a polypeptide having at least 80% sequence identity to SEQ ID NO: 1, wherein amino acid residue 199 is R (199R), amino acid residue 223 is H (223H), and amino acid residue 780 is I (780I).

[0025] In one embodiment of any aspect herein, the nucleic acid sequence encoding the GAA polypeptide is SEQ ID NO: 3, or a nucleic acid sequence encoding a GAA polypeptide having at least 80% sequence identity to SEQ ID NO: 1 having at least 80%, or at least 85%, or at least 90% sequence identity to SEQ ID NO: 3, wherein amino acid residue 199 is R (199R), amino acid residue 223 is H (223H), and amino acid residue 780 is I (780I).

[0026] In one embodiment of any of the aspects herein, the 5'UTR sequence comprises SEQ ID NO: 41 or a nucleic acid having at least 80% sequence identity to SEQ ID NO: 41.

[0027] In one embodiment of any of the aspects herein, the 5'UTR sequence comprises SEQ ID NO: 40 or a nucleic acid having at least 80% sequence identity to SEQ ID NO: 40.

[0028] In one embodiment of any of the aspects herein, the vector further comprises an intron sequence located 5' to the nucleic acid sequence encoding the signal peptide and 3' to the promoter.

[0029] In one embodiment of any aspect herein, the intron sequence is selected from the group consisting of an MVM sequence, an HBB2 sequence, a CMVIE intron sequence, or a UBC intron sequence or an SV40 sequence.

[0030] In one embodiment of any aspect herein, the GAA polypeptide is an N-terminally truncated GAA polypeptide selected from any one disclosed in Table 1.

[0031] In one embodiment of any aspect herein, the vector further comprises at least one poly A sequence located 3' of the nucleic acid encoding the GAA gene and 5' of the 3' ITR sequence.

[0032] In one embodiment of any aspect herein, the heterologous nucleic acid sequence further comprises a 3′UTR sequence, wherein the 3′UTR sequence is located 3′ of the nucleic acid encoding the GAA polypeptide and 5′ of the 3′ITR sequence, or is located between the nucleic acid encoding the GAA polypeptide and the poly A sequence, and may further comprise an RNA pol II terminator sequence.

[0033] In one embodiment of any aspect herein, the heterologous nucleic acid sequence further comprises a 3′ intron sequence and / or an RNA pol II terminator sequence, wherein the 3′ intron sequence is located 3′ of the nucleic acid encoding the GAA polypeptide and 5′ of the 3′ ITR sequence, or is located between the nucleic acid encoding the GAA polypeptide and the poly A sequence.

[0034] In one embodiment of any of the aspects herein, the ITR comprises an insertion, deletion or substitution.

[0035] In one embodiment of any aspect herein, one or more CpG islands in the ITR are removed.

[0036] In one embodiment of any aspect herein, the nucleic acid encoding the signal peptide is selected from the group consisting of an AAT signal peptide (e.g., SEQ ID NO: 67) or an active fragment thereof having secretory signal activity, e.g., a nucleic acid encoding an amino acid sequence having at least about 75%, or 80%, or 85%, or 90%, or 95%, or 98%, or 99% sequence identity to SEQ ID NO: 67; a fibronectin signal peptide (FN1) (e.g., SEQ ID NO: 73 to SEQ ID NO: 75) or an active fragment thereof having secretory signal activity, e.g., a nucleic acid encoding an amino acid sequence having at least about 75%, or 80%, or 85%, or 90%, or 95%, or 98%, or 99% sequence identity to SEQ ID NO: 73 to SEQ ID NO: 75; an endogenous GAA signal peptide (SEQ ID NO: 51) or an active fragment thereof having secretory signal activity, e.g., a nucleic acid encoding an amino acid sequence having at least about 75%, or 80%, or 85%, or 90%, or 95%, or 98%, or 99% sequence identity to SEQ ID NO: 73 to SEQ ID NO: 75; ID NO: 51 has an amino acid sequence having at least about 75%, or 80%, or 85%, or 90%, or 95%, or 98%, or 99% sequence identity; hIGF2 signal peptide (e.g., SEQ ID NO: 72) or an active fragment thereof having secretory signal activity, for example, a nucleic acid encoding an amino acid sequence having at least about 75%, or 80%, or 85%, or 90%, or 95%, or 98%, or 99% sequence identity to SEQ ID NO: 72; IgG1 (201) signal peptide (SEQ ID NO: 54) or an active fragment thereof having secretory signal activity, for example, a nucleic acid encoding an amino acid sequence having at least about 75%, or 80%, or 85%, or 90%, or 95%, or 98%, or 99% sequence identity to SEQ ID NO: 54; wtIL2 leader peptide (SEQ ID NO: 55) or an active fragment thereof having secretory signal activity, for example, a nucleic acid encoding an amino acid sequence having at least about 75%, or 80%, or 85%, or 90%, or 95%, or 98%, or 99% sequence identity to SEQ ID NO: NO:55 having an amino acid sequence that is at least about 75%, or 80%, or 85%, or 90%, or 95%, or 98%, or 99% identical; a mutant IL2 leader peptide (SEQ ID NO:56) or an active fragment thereof that has secretory signaling activity, e.g., a nucleic acid encoding an amino acid sequence that is at least about 75%, or 80%, or 85%, or 90%, or 95%, or 98%, or 99% identical to SEQ ID NO:56;and the nucleic acid encoding the GAA polypeptide is selected from any one of the following groups: SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, or a nucleic acid sequence having at least 60%, or 70%, or 80%, or 85%, or 90%, or 95%, or 98%, or 99% sequence identity to SEQ ID NO: 1 to SEQ ID NO: 18;

[0037] In one embodiment of any aspect herein, the nucleic acid encoding the GAA polypeptide is selected from: SEQ ID NO: 3 or a fragment thereof having functional GAA activity, or a nucleic acid sequence having at least 60%, or 70%, or 80%, 85%, or 90%, or 95%, or 98%, or 99% sequence identity to SEQ ID NO: 3; wherein SEQ ID NO: 3 encodes a GAA polypeptide having at least 85% sequence identity to SEQ ID NO: 1, wherein amino acid residue 199 is R (199R), amino acid residue 223 is H (223H), and amino acid residue 780 is I (780I).

[0038] In one embodiment of any aspect herein, the nucleic acid encoding a GAA polypeptide encodes a GAA polypeptide beginning at any of amino acid residues 35, 40, 50, 57, 60, 68, 69, 70, 72, 74, 779, 790, 791, 792, 793, or 796 of SEQ ID NO: 1, or a sequence that is 80% identical to SEQ ID NO: 1, wherein amino acid residue 199 is R (199R), amino acid residue 223 is H (223H), and amino acid residue 780 is I (780I).

[0039] In one embodiment of any aspect herein, the GAA polypeptide has an endogenous GAA signal peptide or a fragment thereof and a heterologous signal peptide attached at or after the N-terminus of the GAA polypeptide, wherein the endogenous signal peptide has the amino acid sequence of SEQ ID NO:59, or a sequence having at least 80% sequence identity to SEQ ID NO:59, and the heterologous signal peptide is selected from the group consisting of SEQ ID NO:60 (201 IgG signal peptide), or IL2 wild-type signal peptide (SEQ ID NO:61), modified IL2 signal peptide (SEQ ID NO:62), A2M signal peptide (SEQ ID NO:63), or PZP signal peptide (SEQ ID NO:64), or an artificial signal peptide (SEQ ID NO:65), or cathpetsin L signal peptide (SEQ ID NO:66), or a signal peptide having at least 90% sequence identity to SEQ ID NOs:60 to 66.

[0040] In one embodiment of any aspect herein, the liver-specific promoter is selected from any one of the following: SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 91 to SEQ ID NO: 96, SEQ ID NO: 146 to SEQ ID NO: 150 or SEQ ID NO: 439 to SEQ ID NO: 441, or a liver-specific promoter having at least 80% sequence identity to SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 91 to SEQ ID NO: 96, SEQ ID NO: 146 to SEQ ID NO: 150 or SEQ ID NO: 439 to SEQ ID NO: 441.

[0041] In one embodiment of any aspect herein, the liver-specific promoter is selected from any one of SEQ ID NO: 98 or SEQ ID NO: 99, or a liver-specific promoter having at least 80% sequence identity to SEQ ID NO: 98 or SEQ ID NO: 99.

[0042] In one embodiment of any aspect herein, the liver-specific promoter is SEQ ID NO: 97, or a liver-specific promoter having at least 80% sequence identity to SEQ ID NO: 97.

[0043] In one embodiment of any aspect herein, the recombinant vector is made from the plasmid of SEQ ID NO:27.

[0044] In one embodiment of any aspect herein, the nucleic acid comprises SEQ ID NO: 25 or a functional fragment thereof.

[0045] In one embodiment of any aspect herein, the recombinant AAV vector is a chimeric AAV vector, a haploid AAV vector, a hybrid AAV vector, or a polyploid AAV vector.

[0046] In one embodiment of any aspect herein, the recombinant AAV vector is a rational haploid vector, a mosaic AAV vector, a chemically modified AAV vector, or an AAV vector from any AAV serotype.

[0047] In one embodiment of any aspect herein, the recombinant AAV vector is selected from the group consisting of an AAVXL32 vector, an AAVXL32.1 vector, an AAV8 vector, or a haploid AAV8 vector comprising at least one AAV8 capsid protein. In one embodiment of any aspect herein, the serotype is AAV3b. In one embodiment of any aspect herein, the AAV3b serotype comprises one or more mutations in the capsid protein selected from any of the following: 265D, 549A, Q263Y. In one embodiment of any aspect herein, the AAV3b serotype is selected from any of the following: AAV3b265D, AAV3b265D549A, AAV3b549A, AAV3bQ263Y, or AAV3bSASTG.

[0048] In one embodiment of any aspect herein, the poly A sequence is a full-length HGF poly A sequence. In one embodiment, it may be a functional fragment of the hGH poly A sequence.

[0049] In one embodiment of any aspect herein, the poly A sequence is selected from SEQ ID NO: 42, SEQ ID NO: 43 or SEQ ID NO: 44, or a nucleic acid sequence having at least 80% sequence identity to SEQ ID NOS: 42 to SEQ ID NO: 44.

[0050] In one embodiment of any aspect herein, the reverse RNA pol II terminator sequence comprises SEQ ID NO: 45 or a nucleic acid sequence having at least 80% sequence identity to SEQ ID NO: 45. In one embodiment, it is these sequences.

[0051] Another aspect described herein provides a pharmaceutical composition comprising any of the recombinant AAV vectors described herein in a pharmaceutically acceptable carrier.

[0052] Another aspect described herein provides a method of treating a subject having Pompe disease or glycogen storage disease type II (GSD II, acid maltase deficiency) or alpha-glucosidase (GAA) polypeptide deficiency, comprising administering to the subject any one of the recombinant AAV vectors, or any one of the rAAV genomes or nucleic acid sequences described herein.

[0053] In one embodiment of any aspect herein, the AAV vector is made from the plasmid of SEQ ID NOS:27.

[0054] In one embodiment of any aspect herein, the recombinant AAV vector comprises the nucleic acid sequence of SEQ ID NO: 3 or a functional fragment thereof.

[0055] In one embodiment of any aspect herein, the recombinant AAV vector comprises the nucleic acid sequence of SEQ ID NO: 23 or a functional variant thereof.

[0056] In one embodiment of any aspect herein, the GAA polypeptide is secreted from the liver of the subject, and the secreted GAA is taken up by skeletal muscle tissue, cardiac tissue, diaphragm tissue, or a combination thereof, wherein the uptake of the secreted GAA results in a decrease in lysosomal glycogen storage in the tissue.

[0057] In one embodiment of any aspect herein, the administration to the subject is selected from any one of the following: intramuscular administration, subcutaneous administration, intraspinal administration, intracisternal administration, intrathecal administration, and intravenous administration.

[0058] In one embodiment of any aspect herein, the recombinant AAV vector is a chimeric AAV vector, a haploid AAV vector, a hybrid AAV vector, or a polyploid AAV vector.

[0059] In one embodiment of any aspect herein, the recombinant AAV vector is a rational haploid vector, a mosaic AAV vector, a chemically modified AAV vector, or an AAV vector from any AAV serotype.

[0060] In one embodiment of any aspect herein, the recombinant AAV vector is an AAVXL32 vector or an AAVXL32.1 vector or an AAV8 vector, or a haploid AAV8 vector comprising at least one AAV8 capsid protein.

[0061] In one embodiment of any aspect herein, the recombinant AAV vector is an AAV8 vector.

[0062] In one embodiment of any aspect herein, the recombinant AAV vector is administered at a dose range of 1.0E9 vg / kg to 5.0E13 vg / kg, for example, 1.0E9 vg / kg to 5.0E12 vg / kg; 5.0E9 vg / kg to 5.0E12 vg / kg; 5.0E9 vg / kg to 1.0E12 vg / kg; 5.0E9 vg / kg to 5.0E11 vg / kg; 5.0E9 vg / kg to 5.0E10 vg / kg; and 1.0E9 vg / kg to 1.0E10 vg / kg.

[0063] In one embodiment of any aspect herein, the method further comprises receiving GAA protease replacement therapy and stopping GAA protease replacement therapy (ERT) on the same day, the next day, or any time between day 1 and 26 weeks after administration of the recombinant AAV vector.

[0064] Another aspect described herein provides a nucleic acid construct comprising SEQ ID NO: 3 or a nucleic acid sequence having at least 80% sequence identity to SEQ ID NO: 3.

[0065] In one embodiment of any aspect herein, the nucleic acid sequence of SEQ ID NO: 3, or expression of a nucleic acid having 80% sequence identity thereto, encodes a GAA polypeptide having at least 80% sequence identity to SEQ ID NO: 1, and wherein R is present at position 199, H is present at position 223, and I is present at position 780.

[0066] Another aspect described herein provides a nucleic acid construct comprising SEQ ID NO: 23 or a nucleic acid sequence having at least 80% sequence identity to SEQ ID NO: 23.

[0067] In one embodiment of any aspect herein, the nucleic acid comprises SEQ ID NO: 3 or SEQ ID NO: 25, or a nucleic acid sequence having at least 80% sequence identity to SEQ ID NO: 3 or SEQ ID NO: 25.

[0068] In one embodiment of any aspect herein, the nucleic acid sequence of SEQ ID NO: 3, or expression of a nucleic acid having 80% sequence identity thereto, encodes a GAA polypeptide having at least 80% sequence identity to SEQ ID NO: 1, and wherein R is present at position 199, H is present at position 223, and I is present at position 780.

[0069] Another aspect described herein provides a recombinant AAV comprising any one of the nucleic acid constructs described herein.

[0070] In one embodiment of any of the aspects herein, the AAV lacks at least one amino acid from the N-terminus of GAA.

[0071] In one embodiment of any aspect herein, the AAV lacks at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, or more amino acids from the N-terminus of GAA.

[0072] In one embodiment of any aspect herein, the heterologous signal peptide is inserted directly after the endogenous GAA signal peptide or portion thereof.

[0073] The various aspects of the present invention teach certain benefits in construction and use, and these benefits produce the exemplary advantages described below. From the following more detailed description, other features and advantages of the various aspects of the present invention will become apparent in conjunction with the accompanying drawings, which illustrate the principles of the various aspects of the present invention by way of example. BRIEF DESCRIPTION OF THE DRAWINGS

[0074] The file of this application contains at least one drawing executed in color. Copies of this patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee. The drawings illustrate various aspects of the invention. In such drawings:

[0075] Figure 1A - Figure ID shows serum GAA protein quantification by Western blot densitometry. Figure 1A ), Week 2( Figure 1B ), Week 3( Figure 1C ) and week 4 (heart serum) ( Figure 1D ) Serum GAA protein was measured by Western blot densitometry. Serum GAA was normalized to total protein (AD).

[0076] Figure 2A-2D Serum GAA activity measured by 4MU assay is shown. Figure 2A ), Week 2( Figure 2B ), Week 3( Figure 2C ) and week 4 (heart serum) ( Figure 2D ) Serum GAA activity was measured by 4MU assay.

[0077] Figure 3A-3C Target organ GAA protein quantification by Western blot densitometry is shown. 4 weeks after administration, heart ( Figure 3A ), diaphragm( Figure 3B ) and liver( Figure 3C GAA protein was normalized to total protein.

[0078] Figures 4A-4D The target organ GAA activity measured by 4MU assay is shown. 4 weeks after administration, the heart ( Figure 4A ), diaphragm( Figure 4B ), Quadriceps(Quad)( Figure 4C ) and liver( Figure 4D ) in GAA activity.

[0079] Figures 5A-5D The glycogen content of target organs was shown. Four weeks after administration, the heart ( Figure 5A ), diaphragm( Figure 5B ), quadriceps( Figure 5C ) and liver( Figure 5D ) in the glycogen content.

[0080] Figures 6A-6C Shown is the quantification of serum GAA protein by Western blot densitometry in animals sacrificed at 3 weeks. Figure 6A ), Week 2( Figure 6B ) and week 3 ( Figure 6C ) Serum GAA protein was measured by Western blot densitometry. Serum GAA was normalized to total protein.

[0081] Figures 7A-7C Serum GAA activity of animals sacrificed at 3 weeks was measured by 4MU assay. Figure 7A ), Week 2( Figure 7B ) and week 3 ( Figure 7C ) Serum GAA activity was measured by 4MU assay.

[0082] Figures 8A-8C The target organ GAA activity of animals sacrificed at 3 weeks was shown as determined by the 4MU assay. Figure 8A ), diaphragm( Figure 8B ) and liver( Figure 8C ) in GAA activity.

[0083] Figures 9A-9C The target organ glycogen content of animals sacrificed at 3 weeks is shown. 3 weeks after administration, the heart ( Figure 9A ), diaphragm( Figure 9B ) and liver( Figure 9C ) in the glycogen content.

[0084] Figures 10A-10H Shown is the quantification of serum GAA protein by Western blot densitometry in animals sacrificed at 8 weeks. Figure 10A ), Week 2( Figure 10B), Week 3( Figure 10C ) and Week 4 ( Figure 10D ), Week 5( Figure 10E ), Week 6( Figure 10F ), Week 7( Figure 10G ), Week 8( Figure 10H ) Serum GAA protein was measured by Western blot densitometry. Serum GAA was normalized to total protein.

[0085] Figures 11A-11H Shown are serum GAA activities of animals sacrificed at 8 weeks as determined by the 4MU assay. Figure 11A ), Week 2( Figure 11B ), Week 3( Figure 11C ) and Week 4 ( Figure 11D ), Week 5( Figure 11E ), Week 6( Figure 11F ), Week 7( Figure 11G ), Week 8( Figure 11H ) Serum GAA activity was measured by 4MU assay.

[0086] Figures 12A-12C Target organ GAA protein quantification by Western blot densitometry is shown for animals sacrificed at 8 weeks. At 8 weeks after administration, the heart ( Figure 12A ), diaphragm( Figure 12B ) and liver( Figure 12C ) in the GAA protein.

[0087] Figures 13A-13C Shown are target organ GAA activities of animals sacrificed at 8 weeks as measured by the 4MU assay. 8 weeks after administration, the heart ( Figure 13A ), diaphragm( Figure 13B ) and liver( Figure 13C ) in GAA activity.

[0088] Figures 14A-14F The target organ glycogen content of animals sacrificed at 8 weeks is shown. 8 weeks after administration, the heart ( Figure 14A 、 Figure 14D ), diaphragm( Figure 14B 、 Figure 14E ) and liver( Figure 14C 、 Figure 14F ) and normalized to the dose per kg body weight ( Figure 14D-14F ).

[0089] Figure 15Schematic diagrams of the Actus, M3, and M4 constructs are shown. Actus contains the liver promoter of SEQ ID NO: 97, and the M3 construct is similar to the M2 construct, except that the M3 construct contains the promoter of SEQ ID NO: 99, while the M2 construct contains the promoter of SEQ ID NO: 98, which contains a mutation within the myozyme transcription factor binding site. The coding sequence in the M3 construct was modified to remove a predicted alternative open reading frame and a known immunostimulatory hexanucleotide CpG motif. In the M4 construct, all CG dinucleotides were removed from the entire coding sequence. The alternative frame was not removed in the selected M4 construct. The amino acid sequence in the M3 and M4 constructs is identical to the sequence found in Actus 101 (myozyme / lumizyme amino acid sequence).

[0090] Figure 16A and Figure 16B Analysis of hGAA target tissue uptake is shown. Figure 16A Shown are the expression of GAA activity (upper panel) and glycogen levels (lower panel) in the liver, heart, and diaphragm following administration of M4 compared to Actus 101 and vehicle control (VC). Figure 16B Shown are the expression of GAA activity (upper panel) and glycogen levels (lower panel) in the liver, heart and diaphragm following administration of M4 from two different batches compared to Actus 101 and vehicle control (VC).

[0091] Figure 17A and Figure 17B Analysis of serum hGAA expressed by Actus 101 and M4 is shown. Figure 17A The protein expression of hGAA expressed from Actus 101, M4 and vehicle control (VC) is shown. Compared to Actus 101, hGAA protein expressed from M4 was 2.48-fold higher. Figure 17B Shown are the total protein with hGAA activity present in serum after administration of two different lots of M4 compared to Actus 101 and vehicle control (VC) at 4 weeks post-injection.

[0092] Figures 18A-18C Shown are the expressions of wild-type (pM3-NCBI) and Actus101 hGAA proteins in mouse hearts 4 weeks after vector injection. Figure 18A Bar graphs showing hGAA uptake after administration of the indicated constructs. Figure 18B Bar graphs showing hGAA activity after administration of the indicated constructs. Figure 18C Graphs showing glycogen levels after administration of the indicated constructs. hGAA activity in the hearts of mice ( Figure 18B ) and glycogen reduction ( Figure 18C), Actus 101 outperformed the M3 construct; this was in stark contrast to the M4 construct, which outperformed Actus 101.

[0093] Figure 19 Shown is a 4MU activity assay for hGAA activity in serum from mice 4 weeks post-transduction with the indicated constructs. M4 outperformed Actus 101 in promoting GAA activity.

[0094] Figure 20 Shown are the liver retention observed after injection of saline (control), Actus 101, or M4. Liver retention appears comparable between Actus 101 and M4.

[0095] Figures 21A-21D Analysis of hGAA target tissue uptake is shown. Figure 21A Shown are the expressions of GAA activity in the heart following administration of M4, Actus101, and saline control. Figure 21B Shown are the expressions of GAA activity in the diaphragm following administration of M4, Actus 101, and saline control. Figure 21C Shown are the expressions of GAA activity in quadriceps muscle after administration of M4, Actus 101, and saline control. Figure 21D Shown are the expressions of GAA activity in soleus muscle after administration of M4, Actus101, and saline control.

[0096] Figure 22Western blots are shown showing hGAA expression at days 7, 14, and 21 post-infection from vehicle control (VC), Actus 101, and various M4 constructs (Seq12 (SEQ ID NO: 30), Seq99 (SEQ ID NO: 29), Seq3 (SEQ ID NO: 28), and Seq100 (SEQ ID NO: 27). GAA-KO mice were given low and high doses (as indicated). Levels were assessed on the indicated days. Seq100 elicited higher expression levels that were sustained longer than VC, Actus 101, and the other indicated M4 constructs. "HST 1" and "HST 2" refer to high-dose study 1 and high-dose study 2, respectively. SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30 are plasmids for expressing rAAV vectors, wherein the rAAV vectors express a GAA polypeptide having the sequence of SEQ ID NO: 1, wherein the rAAV vectors comprise a codon-optimized nucleic acid sequence selected from SEQ ID NO: 3 (Seq 100), SEQ ID NO: 4 (Seq3), SEQ ID NO: 7 (Seq12), SEQ ID NO: 13 (Seq99).

[0097] Figure 23 Shown are hGAA levels in GAA-KO mice at day 21 after administration of the indicated constructs. Compared to VC, Actus101, and the other indicated M4 constructs, Seq100 elicited higher hGAA expression levels in both serum (top Western blot) and liver (bottom Western blot) at day 21 after administration.

[0098] Figure 24 Shown are normalized hGAA RNA levels in the liver of GAA-KO mice on day 21 after administration of the indicated constructs. Seq100 elicited higher hGAA RNA expression levels in serum on day 21 after administration compared to VC, Actus 101, and other indicated M4 constructs.

[0099] Figure 25 Shown are Western blots showing GAA uptake in the indicated target tissues (i.e., heart or diaphragm) at day 21 after administration of the indicated constructs. Seq 100 elicited higher hGAA expression levels in each tissue at day 21 after administration compared to VC, Actus 101, and other indicated M4 constructs.

[0100] Figure 26A and 26BShown are bar graphs showing GAA and glycogen levels in the indicated tissues of GAA-KO mice on day 21 after administration. Figure 26A Shown are GAA activity in the indicated tissues of GAA-KO mice at day 21 after administration of the indicated constructs. Seq 100 elicited higher hGAA expression levels in each tissue at day 21 after administration compared to VC, Actus 101, and the other indicated M4 constructs. Figure 26B Shown are glycogen in the indicated tissues of GAA-KO mice on day 21 after administration of the indicated constructs. Seq100 induced higher glycogen clearance in each tissue on day 21 after administration compared to VC, Actus 101, and other indicated M4 constructs.

[0101] Figure 27 Western blots showing hGAA expression in GAA-KO mice over time are shown. Seq 100 elicited higher hGAA expression levels at 7 and 14 days after administration compared to VC, Actus 101, and other indicated M4 constructs.

[0102] Figure 28 Shown is a bar graph showing the results of 4MU assay in GAA-KO mice 21 days after administration. Seq100 induced higher hGAA expression levels at 21 days after administration compared to VC, Actus 101, and other indicated M4 constructs.

[0103] Figure 29 Schematic diagrams showing various modified GAAs are shown, which comprise constructs comprising: (i) a GAA signal peptide or portion thereof, and (ii) a heterologous signal peptide attached to (iii) a GAA polypeptide. An N-terminally truncated GAA polypeptide beginning at amino acid position 57 is shown as an exemplary GAA polypeptide, however, any N-terminally truncated GAA polypeptide disclosed in Table 1 may be used.

[0104] Figure 30 Western blots are shown showing hGAA expression in GAA-KO mice 4 weeks after administration of the indicated constructs. Black arrows indicate GAA expression. Grey triangles indicate nonspecific bands.

[0105] Figure 31 Shown are bar graphs showing total GAA protein in the serum of GAA-KO mice 4 weeks after administration of the indicated constructs. Normal saline was used as a control.

[0106] Figure 32Shown is a bar graph showing total GAA activity in the serum of GAA-KO mice 4 weeks after administration of the indicated constructs. Normal saline was used as a control. 4MU activity in serum was consistent with GAA expression levels.

[0107] Figure 33 A bar graph is shown showing total GAA activity in the hearts of GAA-KO mice 4 weeks after administration of the indicated constructs. Normal saline was used as a control. 4MU activity in the heart was consistent with GAA expression levels, and expression of the constructs reached wild-type levels.

[0108] Figure 34 A bar graph is shown showing total glycogen levels in the hearts of GAA-KO mice 4 weeks after administration of the indicated constructs. Saline was used as a control. Glycogen levels in the heart were consistent with GAA expression levels, and expression of the constructs reached wild-type levels.

[0109] Figure 35A Shown are Western blots showing total GAA activity in the liver of GAA-KO mice 4 weeks after administration of the indicated constructs. Figure 35B A bar graph is shown showing total GAA activity in the hearts of GAA-KO mice 4 weeks after administration of the indicated constructs. Saline was used as a control. Reduced retention of modified GAA in the liver was observed.

[0110] Figure 36 Shown is a table showing GAA levels in serum, GAA activity in serum and heart, glycogen levels in heart, and GAA levels retained in liver of mice after administration of the indicated AAVs (left column).

[0111] Figure 37 Schematic diagrams of the modified constructs are shown. Mod-Actus is an Actus construct modified to move the wtAAV DNA sequences 5′ and 3′ to the ITRs. Mod-P072 is a modified P072 construct to replace the 5′UTR with a 5′UTR+intron sequence, remove the 3′UTR, and add the SV40 bidirectional polyA sequence. Mod-P092 is a modified P092 construct to replace the 5′UTR with a 5′UTR+intron sequence, remove the 3′UTR, and add the SV40 bidirectional polyA sequence. Mod-072 and mod-092 are also modified to move the wtAAV DNA sequences 5′ and 3′ to the ITRs.

[0112] Figure 38A and Figure 38B Shown are bar graphs showing GAA expression in huh7 cell cultures in response to the indicated AAVs. Figure 38A GAA activity in huh7 cell lysates is shown. Figure 38B GAA activity in huh7 cell supernatants is shown. Mod-P072 secretes the highest levels of GAA into the supernatant. Mod-Actus promotes the highest GAA activity in cells.

[0113] Figures 39A-39C Data showing in vivo expression of the indicated AAVs at varying levels in wild-type mice (C57BL / 6J) are presented. Figure 39A This is a graph showing serum GAA activity in male mice at different weeks after administration. Figure 39B This is a graph showing serum GAA activity in female mice at different weeks after administration. Figure 39C The graph shows GAA activity in serum of male and female mice (total) at different weeks after administration. Mod-P072 reached the highest GAA activity level in the serum of mice 4 weeks after administration.

[0114] Figures 40A-40C Shown are bar graphs representing semi-quantitative Western blot analysis of GAA levels in liver, heart, and quadriceps muscle tissues following in vivo expression of various levels of the indicated AAVs in wild-type mice (C57BL / 6J). Figure 40A is a graph showing GAA levels in liver tissues of male and female mice. Figure 40B is a graph showing GAA levels in cardiac tissue of male and female mice. Figure 40C Figure 2 shows GAA levels in quadriceps muscle tissue of male and female mice. Mod-Actus administration resulted in the highest GAA uptake in liver tissue. Mod-P072 administration resulted in the highest GAA uptake in heart and quadriceps muscle tissue.

[0115] Figure 41 A bar graph shows glycogen levels in cardiac tissue following administration of Actus 101, pP110, and pP113 at the indicated doses. A greater decrease in cellular glycogen was observed following administration of pP110 compared to Actus 101 or pP113. Saline was used as a control.

[0116] Figure 42 A bar graph showing glycogen levels in cardiac tissue following administration of M4, pP065, pP072, and pP092 at the indicated doses is shown. Higher doses of pP065 and pP072 caused the greatest reduction in glycogen levels in cells. Normal saline was used as a control.

[0117] The above-mentioned drawings illustrate aspects of the present invention in at least one exemplary embodiment thereof, and aspects of the present invention are further defined in detail in the following description. According to one or more embodiments, features, elements and aspects of the present invention referred to by the same numbers in different figures represent the same, equivalent or similar features, elements or aspects. DETAILED DESCRIPTION

[0118] The technology described herein is directed to recombinant AAV (rAAV) vectors and rAAV constructs for delivering GAA polypeptides to subjects in methods for treating Pompe disease, wherein heterologous nucleic acids encoding GAA polypeptides are codon-optimized to reduce immune responses and enhance and improve expression efficiency in human subjects. That is, the rAAV constructs described herein for delivering GAA polypeptides to subjects comprise improvements, such as, but not limited to, codon-optimized nucleic acid sequences encoding GAA polypeptides, wherein the codon-optimized nucleic acid sequences encoding GAA polypeptides are modified to include, for example, the following features: (i) enhanced in vivo expression, (ii) reduction of CpG islands and / or elimination of CG dinucleotide content, (iii) modification of STOP sequences or elimination of alternative reading frames (ARFs), and (iv) reduction of innate immune responses. Alternatively, wild-type GAA modified to enhance expression is used. In addition, the rAAV constructs described herein for delivering GAA polypeptides to a subject comprise improvements such as the incorporation of a 5′UTR between the nucleic acid expressing the GAA polypeptide and the liver-specific promoter, and the use of a specific terminator sequence 3′ of the nucleic acid expressing the GAA polypeptide, such as a specific poly A sequence and / or terminator sequence, multiple poly A sequences, etc.

[0119] The technology described herein relates to improved recombinant AAV (rAAV) vectors and rAAV constructs to deliver GAA polypeptides to subjects in methods for treating Pompe disease, and is related to those previously disclosed in International Patent Applications WO2020102645 and WO2021102107, both of which are incorporated herein by reference in their entireties.

[0120] Specifically, described herein are targeted viral vectors for treating Pompe disease, for example, using a rAAV vector as an illustrative example, wherein the viral vector comprises a nucleotide sequence containing an inverted terminal repeat (ITR), a liver-specific promoter, a heterologous gene, a poly-A tail, and potentially other regulatory elements, wherein the heterologous gene is human GAA, and wherein the vector (e.g., rAAV) can be administered to a patient in a therapeutically effective dose, which is delivered to appropriate tissues and / or organs to express the heterologous gene and treat the disease (e.g., Pompe disease).

[0121] One aspect described herein provides a recombinant adeno-associated virus (AAV) vector comprising in its genome: (a) 5′ and 3′ AAV inverted terminal repeat (ITR) sequences, and (b) a heterologous nucleic acid sequence located between the 5′ and 3′ ITRs, the heterologous nucleic acid sequence encoding a polypeptide comprising an α-glucosidase (GAA) polypeptide, wherein the heterologous nucleic acid is operably linked to a liver-specific promoter disclosed herein.

[0122] In one embodiment of any aspect herein, the heterologous nucleic acid sequence encodes a GAA polypeptide comprising a secretion signal fused to the GAA polypeptide, wherein the secretion signal (also referred to herein as a "signal peptide") is an endogenous GAA polypeptide or an exogenous GAA polypeptide.

[0123] In one embodiment of any aspect herein, the nucleic acid sequence encoding the GAA polypeptide is a human GAA gene or a human codon-optimized GAA gene (coGAA) or a modified GAA nucleic acid sequence. As disclosed herein, the nucleic acid encoding the human GAA protein is selected from any one of SEQ ID NO: 1 to SEQ ID NO: 18, or a functional variant having at least 80%, or at least about 85%, or at least about 90%, or at least about 95%, or at least about 98% sequence identity to any one of SEQ ID NO: 1 to SEQ ID NO: 18.

[0124] In some embodiments, the expressed GAA comprises at least a signal peptide that promotes secretion of the GAA polypeptide from the liver. In some embodiments, the GAA polypeptide or modified GAA is expressed as a fusion protein comprising at least a signal peptide that promotes secretion of the GAA polypeptide from the liver.

[0125] In all aspects of all embodiments of the technology described herein, the liver-specific promoter preferentially expresses the hGAA polypeptide in the liver. In all aspects of all embodiments of the technology described herein, in some embodiments, the AAV vector comprises at least one capsid protein that is targeted to the liver. I. Recombinant AAV expressing GAA

[0126] As disclosed herein, one aspect of the technology relates to a method for treating Pompe disease using an rAAV vector comprising a capsid and, within its capsid, a nucleotide sequence referred to as a "rAAV vector genome." The rAAV vector genome (also referred to as "rAAV genome") comprises multiple elements, including but not limited to two inverted terminal repeats (ITRs, such as a 5'-ITR and a 3'-ITR), and located between the ITRs are additional elements, including a promoter, a heterologous gene encoding a GAA polypeptide, and a poly-A tail, wherein the heterologous gene encoding the GAA polypeptide is codon-optimized, for example, including but not limited to reducing CpGs, reducing CpG islands, and minimizing or eliminating internal start codons.

[0127] In some embodiments, the rAAV genome disclosed herein comprises a 5′ITR and a 3′ITR sequence, and a promoter located between the 5′ITR and the 3′ITR (e.g., a liver-specific promoter sequence as disclosed herein), the promoter being operably linked to a heterologous nucleic acid encoding an α-glucosidase (GAA) polypeptide, wherein the heterologous nucleic acid is codon-optimized as disclosed herein, and wherein there is a 5′UTR between the nucleic acid encoding the GAA polypeptide and the liver-specific promoter sequence. In some cases, a 3′UTR is also present. In addition, the UTR may comprise an intron. In one embodiment, the heterologous nucleic acid sequence may optionally further comprise one or more of the following elements: an intron sequence, a nucleic acid encoding a secretion signal peptide (the signal peptide may be an endogenous signal peptide (SP) or a heterologous SP as disclosed herein), a poly A sequence, and a terminator sequence. In some embodiments, the 5′UTR sequence comprises SEQ ID NO: 41, or comprises SEQ ID NO: 40, or a sequence having at least 85%, or at least 90%, or more sequence identity to SEQ ID NO: 40 or SEQ ID NO: 41. In some embodiments, the polyA sequence is the full-length HGH polyA sequence comprising SEQ ID NO: 42, or a sequence having at least 85%, or at least 90%, or more sequence identity to SEQ ID NO: 42. In some embodiments, the terminator sequence is an inverted RNA pol II terminator sequence. In some embodiments, the inverted RNA pol II terminator sequence comprises the sequence of SEQ ID NO: 45, or a sequence having at least 85%, or at least 90%, or more sequence identity to SEQ ID NO: 45.

[0128] In some embodiments, the nucleic acid encoding an alpha-glucosidase (GAA) polypeptide encodes a full-length GAA polypeptide (eg, starting at residue 28 of SEQ ID NO: 1). In some embodiments, the nucleic acid encoding an alpha-glucosidase (GAA) polypeptide encodes a truncated GAA polypeptide (e.g., starting at amino acid residues 35, 40, 50, 57, 60, 68, 69, 70, 72, 74 and / or C-terminally truncated starting at residues 779, 790, 791, 792, 793, and 796 of SEQ ID NO: 1), or a C-terminally truncated GAA polypeptide starting at amino acid residues 35-952, 40-952, 50-952, 57-952, 60-952, 68-952, 69-952, 70-952, 72-952, 74-952, 779-952, 790-952, 791-952, 792-952, 793-952, and 796-952 of SEQ ID NO: 1. ID NO: 1 A GAA polypeptide having at least 80%, or at least 85%, or at least 90% or at least 95% sequence identity.

[0129] In some embodiments, the nucleic acid encoding an alpha-glucosidase (GAA) polypeptide encodes a full-length GAA polypeptide (e.g., residues 28-952 of SEQ ID NO: 1) or a truncated GAA polypeptide (e.g., a GAA polypeptide beginning at any of residues 35, 40, 50, 57, 60, 68, 69, 70, 72, 74 of SEQ ID NO: 1 and / or a second truncation beginning at residues 779, 790, 791, 792, 793, and 796 of SEQ ID NO: 1) having an endogenous GAA signal peptide (e.g., an endogenous signal peptide comprising residues comprising SEQ ID NO: 59) attached to the N-terminus of the GAA polypeptide. For example, SEQ ID NO: 1 and only a heterologous or homologous signal peptide. In alternative embodiments, the nucleic acid encoding an alpha-glucosidase (GAA) polypeptide encodes a full-length GAA polypeptide (e.g., residues 28-952 of SEQ ID NO: 1) or a truncated GAA polypeptide (e.g., a GAA polypeptide beginning at any one of residues 35, 40, 50, 57, 60, 68, 69, 70, 72, 74, 779, 790, 791, 792, 793, and 796 of SEQ ID NO: 1) with a heterologous signal peptide attached to the N-terminus of the full-length or truncated GAA polypeptide.

[0130] In alternative embodiments, the nucleic acid encoding an alpha-glucosidase (GAA) polypeptide encodes a full-length GAA polypeptide (e.g., residues 28-952 of SEQ ID NO: 1) or an N-terminally truncated GAA polypeptide (e.g., a GAA polypeptide beginning at any one of residues 35, 40, 50, 57, 60, 68, 69, 70, 72, 74, 779, 790, 791, 792, 793, and 796 of SEQ ID NO: 1), and further encodes a GAA signal peptide or a portion or fragment thereof, and a heterologous signal peptide attached to the N-terminus of the full-length or truncated GAA polypeptide. In some embodiments, the GAA polypeptide is an N-terminally truncated GAA polypeptide, wherein the truncation begins at any one of amino acids 29-35 of SEQ ID NO: 1. In some embodiments, the nucleic acid encoding an α-glucosidase (GAA) polypeptide comprises (i) a GAA signal peptide or a portion thereof (e.g., an N-terminal portion thereof), (ii) a portion of a GAA polypeptide (e.g., any portion of residues 28-56 of SEQ ID NO: 1), (iii) a heterologous signal peptide as disclosed herein, and (iv) a GAA polypeptide (e.g., an N-terminally truncated GAA polypeptide, e.g., a GAA polypeptide starting at any of residues 35, 40, 50, 57, 60, 68, 69, 70, 72, 74, 779, 790, 791, 792, 793, and 796 of SEQ ID NO: 1). In some embodiments, the GAA polypeptide can comprise a C-terminal truncation having at least 1, or at least 2, or at least 3, or at least 4, or at least 5, or between at least 5-10, or between 10-20, or between 20-30 amino acid residues at the C-terminus of the GAA polypeptide. Disclosed herein are exemplary heterologous signal peptides, including but not limited to signal peptides comprising amino acids selected from any one of SEQ ID NO: 60 to SEQ ID NO: 78. In some embodiments, the signal peptide is attached to the N-terminus of SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, and SEQ ID NO: 64. A. α-glucosidase (GAA) polypeptide

[0131] The GAA gene (NM_000152.3) is approximately 18.3 kilobases (kb) long and contains 20 exons (Dasouki et al., 2014). Its complementary DNA contains a 2,859-nucleotide coding sequence that encodes an immature 952-amino acid enzyme. GAA is synthesized as a membrane-bound, catalytically inactive (relative to the natural substrate, glycogen) precursor and is sequestered in the endoplasmic reticulum. It undergoes sugar chain modification in the Golgi complex and is subsequently transported to the (secondary) secretory pathway or to the lysosome, where it is progressively trimmed at the amino and carboxyl termini. Phosphorylation of mannose residues ensures efficient transport to lysosomes via the mannose 6-phosphate receptor. In the lysosome, GAA catalyzes the hydrolysis of the α1→4 glycosidic bond in glycogen to glucose in a low-potential hydrogen (pH) environment. During maturation, it acquires specificity for its natural substrate (glycogen).

[0132] There are many normal allelic variants in GAA, and they are responsible for the three known isomerases (GAA1, GAA2 and GAA4). More than 450 GAA mutations have been reported in individuals with Pompe disease. Nonsense mutations, large and small gene rearrangements and splicing defects have been observed, many of which may be family, geographic region or ethnicity specific. More common in individuals with IOPD are mutation combinations that result in complete or almost complete loss of GAA enzyme activity (usually less than 1% of the normal activity in skin fibroblasts), while those that allow partial enzyme activity (approximately 2%-40% of the normal activity in skin fibroblasts) often have LOPD manifestations. GAA mutations result in messenger RNA instability and / or severe truncation of acid α-glucosidase, or a significant reduction in enzyme activity. Dysfunction or loss of GAA leads to accumulation of glycogen in the lysosomes and cytoplasm of multiple tissues, resulting in destruction of skeletal muscle, smooth muscle and cardiac muscle. The effects of enzyme deficiency may extend to the vesicular system connected to lysosomes and may also affect receptors that cycle through these organelles, such as glucose transporter 4. Evidence also shows that a failure of productive autophagy and a gradual accumulation of autophagosomes, which disrupt contractile organization in myofibers, are associated with the lack of correction of skeletal muscle during ERT.

[0133] α-Glucosidase (GAA) polypeptides are members of glycoside hydrolase family 31. Human GAA is synthesized as a 110 kDal precursor (Wisselaar et al., (1993) J. Biol. Chem. 268(3):2223-31). The mature form of the enzyme is a mixture of 70 kDal and 76 kDal monomers (Wisselaar et al., (1993) J. Biol. Chem. 268(3):2223-31). The precursor enzyme has seven potential glycosylation sites, four of which are retained in the mature enzyme (Wisselaar et al., (1993) J. Biol. Chem. 268(3):2223-31). The protein cleavage event that produces the mature enzyme occurs in late endosomes or lysosomes (Wisselaar et al., (1993) J. Biol. Chem. 268(3):2223-31).

[0134] The rAAV vector genome may encode a GAA polypeptide, which may include, for example, amino acid residues 40-952 of human GAA, or a smaller portion (eg, amino acid residues 40-790).

[0135] The mature 70 kDa1 and 76 kDa1 GAA polypeptide species do not contain the C-terminal 160 amino acids. However, certain Pompe disease alleles that result in complete loss of GAA activity map to this region, such as Val949Asp (Becker et al., (1998) J. Hum. Genet. 62:991). The phenotype of this mutant suggests that the C-terminal portion of the protein, although not part of the 70 kDa1 or 76 kDa1 species, plays an important role in the function of the protein. It has also been reported that the C-terminal portion of the protein, although cleaved from the rest of the protein during processing, remains associated with the main species (Moreland et al., (November 1, 2004) J. Biol. Chem., Manuscript 404008200). Therefore, the C-terminal residue may play a direct role in the catalytic activity of the protein and / or may be involved in promoting proper folding of the N-terminal portion of the protein.

[0136] The native GAA gene encodes a precursor polypeptide having the following components: a signal sequence and an adjacent putative transmembrane domain, a trefoil domain (PFAM PF00088) (which is a cysteine-rich domain of approximately 45 amino acids containing three disulfide bonds) (Thim (1989) FEBS Lett. 250: 85), a domain defined by the mature 70 / 76 kDa1 polypeptide, and a C-terminal domain. It has been reported that both the trefoil domain and the C-terminal domain are required for the production of functional GAA, and it is possible that the C-terminal domain interacts with the trefoil domain during protein folding, which may promote the formation of appropriate disulfide bonds in the trefoil domain.

[0137] In some embodiments of the methods and compositions disclosed herein, the human GAA protein expressed by AAV comprises the amino acids of SEQ ID NO: 1, or a protein that is at least 60%, or 70%, or 80%, 85% or 90% or 95%, or 98% or 99% identical to SEQ ID NO: 1.

[0138] In some embodiments, the hGAA polypeptide comprises a signal peptide (SP). One of ordinary skill in the art would know the specific position of GAA to which the signal peptide (SP) can be fused.

[0139] In some embodiments of the methods and compositions disclosed herein, the human GAA protein expressed by AAV comprises the amino acids of SEQ ID NO: 1 or a fragment or variant thereof, e.g., a human GAA protein starting with any one of the following residues selected from residues 40, 50, 57, 68, 69, 70, 71, 72, 779, 787, 789, 790, 791, 792, 793, or 796 of SEQ ID NO: 1. Thus, one aspect of the invention relates to a GAA protein wherein SP is fused to the N-terminal amino acid 40, 50, 57, 68, 69, 70, 71, 72, 779, 787, 789, 790, 791, 792, 793, or 796 of human GAA of SEQ ID NO: 1. In some embodiments, the GAA polypeptide expressed by the AAV vector disclosed herein has at least 80%, or at least 85%, or at least 90%, or at least 95% sequence identity to amino acid residues selected from the group consisting of amino acid residues 28-952, 35-952, 40-952, 50-952, 57-952, 60-952, 68-952, 69-952, 70-952, 72-952, 74-952, 779-952, 790-952, 791-952, 792-952, 793-952, and 796-952 of SEQ ID NO: 1, and further may comprise an N-terminal signal peptide, wherein the signal peptide may be an endogenous GAA signal peptide or a heterologous signal peptide as disclosed herein.

[0140] In some embodiments of the methods and compositions disclosed herein, the human GAA protein expressed by the AAV comprising amino acids is a human GAA protein starting at any one of the following residues, or a protein having at least 60%, or 70%, or 80%, 85%, or 90%, or 95%, or 98%, or 99% identity thereto: residue 40, 50, 57, 68, 69, 70, 71, 72, 779, 787, 789, 790, 791, 792, 793, or 796 of SEQ ID NO: 1. (i) Modified GAA (modGAA) polypeptide

[0141] In some embodiments, the modified human GAA protein comprises a polypeptide having at least one modification selected from H199R, R223H, V780I, or H201L of SEQ ID NO: 1, or a variant having at least 80%, 90%, 95%, or 99% homology to at least 500, 550, 600, 650, 700, 750, 800, 850, or 900 amino acids of SEQ ID NO: 1, comprising at least one of these modifications. In some embodiments, the modified human GAA protein comprises a polypeptide comprising at least two modifications selected from H199R, R223H, V780I, or H201L of SEQ ID NO: 1, or a variant having at least 80%, 90%, 95%, or 99% homology to at least 500, 550, 600, 650, 700, 750, 800, 850, or 900 contiguous amino acids of SEQ ID NO: 1, comprising at least two of these modifications. In some embodiments, the modified human GAA protein comprises a polypeptide having at least three modifications selected from H199R, R223H, V780I, and H201L of SEQ ID NO: 1 (GAA-H199R-H201L-R223H or GAA-H199R-H201L-V780I), or a variant having at least 80%, 90%, 95%, or 99% homology to at least 500, 550, 600, 650, 700, 750, 800, 850, or 900 contiguous amino acids of SEQ ID NO: 1, comprising at least three of these modifications.

[0142] These modified GAA polypeptides and fragments thereof can be used. In some embodiments, the human modified GAA protein expressed by AAV comprises a GAA polypeptide of SEQ ID NO: 1 modified as above, or a protein at least 60%, or 70%, or 80%, 85%, or 90%, or 95%, or 98%, or 99% identical to SEQ ID NO: 1, or a nucleic acid encoding such a sequence (SEQ ID NO: 3), or a fragment of SEQ ID NO: 1, wherein the fragment begins at any one of the following residues: residues 40, 50, 57, 68, 69, 70, 71, 72, 779, 787, 789, 790, 791, 792, 793, or 796 of SEQ ID NO: 1 (modGAA; H199R, R223H, V780I), or a fragment of SEQ ID NO: 1 that is at least 60%, or 70%, or 80%, 85%, or 90%, or 95%, or 98%, or 99% identical to SEQ ID NO: 1. NO: 1 is at least 60%, or 70%, or 80%, 85%, or 90%, or 95%, or 98%, or 99% identical to a protein wherein an R is present at amino acid position 199, an H is present at amino acid position 223, and an I is present at amino acid position 780. Although Actus 101 (SEQ ID NO: 1) contains three point mutations, it is considered wild-type GAA.

[0143] In some embodiments, GAA is modified to add or remove glycosylation sites, such as N-linked glycosylation sites, O-linked glycosylation sites, or both. In certain embodiments, the addition or removal of glycosylation sites is achieved by N-terminal deletions, C-terminal deletions, internal deletions, random point mutagenesis, or site-directed mutagenesis. In some embodiments, exemplary GAA modifications involve the addition of one or more asparagine (Asn) residues, or one or more mutations to produce asparagine (Asn) residues, or the deletion of one or more asparagine (Asn) residues. In certain embodiments, all or part of the N-linked and / or O-linked glycosylation sites present in GAA are mutated. In some embodiments, GAA modifications will generate information related to the biological activity, physical structure, and / or substrate binding potential of GAA.

[0144] In one embodiment, the modified human GAA protein comprises a deletion of the amino acid stretch between positions 29-56 (inclusive) of SEQ ID NO: 1. In one embodiment, the modified human GAA protein comprises a deletion of the amino acid stretch between positions 29-56 (inclusive) of SEQ ID NO: 1, and the modified human GAA protein is no longer retained in cells.

[0145] In one embodiment, the modified human GAA protein comprises a polypeptide having at least one modification selected from Table 12. The modifications listed in Table 12 are generally GAA polymorphisms that have been identified but are not associated with a disease (e.g., Pompe disease). (ii) Nucleotide sequences: N-terminal GAA polypeptide truncations and nucleic acid sequences encoding GAA polypeptides and N-terminal truncations, with endogenous or heterologous signal peptides.

[0146] As disclosed herein, nucleic acids encoding the GAA proteins disclosed herein (e.g., SEQ ID NO: 1 to SEQ ID NO: 18, which are codon-optimized GAA nucleic acid sequences), for example, have been modified from the NCBI GAA sequence of NM_00152.5 to include any one or more of the following: (i) enhanced in vivo expression, (ii) reduction of CpG islands or reduction or elimination of CG dinucleotides, (iii) reduction of innate immune responses, and (iv) reduction or elimination of alternative reading frames (ARFs) or open reading frames (ORFs). Exemplary codon-optimized GAA nucleic acid sequences encompassed for use in the methods and rAAV compositions disclosed herein can be selected from any one of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, or SEQ ID NO: 18 as disclosed herein, or a nucleic acid sequence having at least 60%, or 70%, or 80%, 85%, or 90%, or 95%, or 98%, or 99% sequence identity to SEQ ID NO: 1 to SEQ ID NO: 18, wherein SEQ ID NO: 1 to SEQ ID NO: 18 are codon-optimized GAA nucleic acid sequences. NO: 18 or a variant thereof having at least 80% sequence identity encodes a GAA polypeptide wherein amino acid position 199 is R (199R); amino acid position 233 is H (233H), and amino acid position 780 is I (780I).

[0147] In some embodiments, the codon-optimized GAA nucleic acid sequence contemplated for use in the methods and rAAV compositions disclosed herein can be selected from any one of SEQ ID NO: 3 or SEQ ID NO: 4, or a nucleic acid sequence having at least 60%, or 70%, or 80%, 85%, or 90%, or 95%, or 98%, or 99% sequence identity to SEQ ID NO: 3 or SEQ ID NO: 4.

[0148] In some embodiments, the rAAV genome for use in the methods for treating Pompe disease as disclosed herein comprises a heterologous nucleic acid sequence encoding a signal peptide (SP) fused in frame to the 5' end of a GAA nucleic acid sequence encoding a GAA polypeptide or an N-terminally truncated GAA polypeptide, as disclosed herein. For example, the heterologous nucleic acid sequence encoding a signal peptide (SP) is fused in frame to the 5' end of a GAA nucleic acid sequence encoding a GAA polypeptide or an N-terminally truncated GAA polypeptide, such that when the rAAV vector transduces mammalian cells, both polypeptides are expressed from the rAAV genome.

[0149] In some embodiments, the rAAV genome in the methods for treating Pompe disease as disclosed herein comprises a heterologous nucleic acid sequence comprising SEQ ID NO: 3 or a portion of SEQ ID NO: 3, wherein expression of the portion of the nucleic acid of SEQ ID NO: 3 produces a functional hGAA protein, and wherein the functional hGAA protein may comprise an N-terminal deletion of SEQ ID NO: 1, or an N-terminal and C-terminal truncation of SEQ ID NO: 1 as disclosed herein.

[0150] In some embodiments, the rAAV genome for use in the methods of treating Pompe disease as disclosed herein comprises a heterologous nucleic acid sequence comprising SEQ ID NO: 3, or nucleotides 82-2859 of SEQ ID NO: 3, or a nucleic acid having at least 85% sequence identity thereto, wherein nucleotides 1-81 of SEQ ID NO: 3 (corresponding to SEQ ID NO: 53), encoding a codon-optimized hGAA signal peptide, are replaced with a nucleic acid encoding a heterologous signal peptide as disclosed herein, e.g., selected from any one of SEQ ID NO: 54 to SEQ ID NO: 58, SEQ ID NO: 67, SEQ ID NO: 72, or SEQ ID NO: 75, or a nucleotide sequence having at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% sequence identity thereto.

[0151] In some embodiments, the rAAV genome for use in the methods of treating Pompe disease as disclosed herein comprises a heterologous nucleic acid sequence comprising one or more base pair deletions 5' to SEQ ID NO:3.

[0152] For example, in some embodiments, the heterologous nucleic acid sequence in the AAV genome can comprise nucleotides selected from any one of the following: positions 82-2859 of SEQ ID NO: 3, 82-2859 bp of SEQ ID NO: 3, 103-2859 bp of SEQ ID NO: 3, positions 118-2859 of SEQ ID NO: 3, 148-2859 bp of SEQ ID NO: 3, 169-2859 bp of SEQ ID NO: 3, 199-2859 bp of SEQ ID NO: 3, 205-2859 bp of SEQ ID NO: 3, 208-2859 bp of SEQ ID NO: 3, 214-2859 bp of SEQ ID NO: 3, 220-2859 bp of SEQ ID NO: 3, 265-2859 bp of SEQ ID NO: 3, 2335-2859 bp of SEQ ID NO: 3, NO:3, or 2368-2859 bp of SEQ ID NO:3, 2371-2859 bp of SEQ ID NO:3, 2374-2859 bp of SEQ ID NO:3, 2377-2859 bp of SEQ ID NO:3, 2386-2859 bp of SEQ ID NO:3, or a nucleic acid having at least 85% sequence identity thereto; and nucleotides 1-81 of SEQ ID NO:3 appended 5′ to said sequence (corresponding to SEQ ID NO:53 or a nucleotide sequence having at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% sequence identity thereto), encoding a codon-optimized hGAA signal peptide.

[0153] In alternative embodiments, the heterologous nucleic acid sequence in the AAV genome can comprise nucleotides selected from any one of the following: positions 82-2859 of SEQ ID NO: 3, 82-2859 bp of SEQ ID NO: 3, 103-2859 bp of SEQ ID NO: 3, positions 118-2859 of SEQ ID NO: 3, 148-2859 bp of SEQ ID NO: 3, 169-2859 bp of SEQ ID NO: 3, 199-2859 bp of SEQ ID NO: 3, 205-2859 bp of SEQ ID NO: 3, 208-2859 bp of SEQ ID NO: 3, 214-2859 bp of SEQ ID NO: 3, 220-2859 bp of SEQ ID NO: 3, 265-2859 bp of SEQ ID NO: 3, 2335-2859 bp of SEQ ID NO: 3, 2360-2361 bp of SEQ ID NO: 3, 2440-2539 bp of SEQ ID NO: 3, 2460-2539 bp of SEQ ID NO: 3, 2470-2539 bp of SEQ ID NO: 3, 2480-2539 bp of SEQ ID NO: 3, 2490-2539 bp of SEQ ID NO: 3 NO:3, or a nucleic acid having at least 85% sequence identity thereof, wherein positions 1-81 of SEQ ID NO:3 encoding a codon-optimized hGAA signal peptide (corresponding to SEQ ID NO:53) are replaced with a nucleic acid encoding a heterologous signal peptide as disclosed herein, e.g., selected from any one of SEQ ID NOs:54 to 58, SEQ ID NO:67, SEQ ID NO:72, or SEQ ID NO:75, or a nucleotide sequence having at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% sequence identity thereof.

[0154] The truncated GAA can be wild-type or codon-optimized. For example, exemplary 5′-terminal deletions of SEQ ID NO: 3 are disclosed in Table 1 herein, which encode N-terminally truncated GAA polypeptides. In some embodiments, the 5′-terminal end of the 5′-terminal deletion of SEQ ID NO: 3 can be attached to the 3′-terminus of a nucleic acid encoding a signal peptide as disclosed herein, such as any signal peptide selected from any of the following: SEQ ID NO: 53 to SEQ ID NO: 58, SEQ ID NO: 67, SEQ ID NO: 72, or SEQ ID NO: 75, or a nucleotide sequence having at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% sequence identity thereto.

[0155] Table 1: Table of exemplary N-terminal truncations of the GAA polypeptide of SEQ ID NO: 1 and 5' deletions of the nucleic acid sequence of SEQ ID NO: 3.

[0156] In some embodiments, the rAAV genome for use in the methods of treating Pompe disease as disclosed herein comprises a heterologous nucleic acid sequence comprising nucleotides 103-2859 of SEQ ID NO: 3, wherein appended 5′ to the sequence is a nucleic acid encoding a wild-type or codon-optimized hGAA signal peptide (i.e., a nucleic acid comprising SEQ ID NO: 53) or a fragment thereof, or a nucleic acid sequence encoding a heterologous signal peptide as disclosed herein, e.g., a nucleic acid sequence selected from any one of the following: SEQ ID NO: 54 to SEQ ID NO: 58, SEQ ID NO: 67, SEQ ID NO: 72, or SEQ ID NO: 75, or a nucleotide sequence having at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% sequence identity thereto.

[0157] In some embodiments, the rAAV genome for use in the methods of treating Pompe disease as disclosed herein comprises a heterologous nucleic acid sequence comprising nucleotides 118-2859 of SEQ ID NO: 3, wherein appended 5′ to the sequence is a nucleic acid encoding a wild-type or codon-optimized hGAA signal peptide (i.e., a nucleic acid comprising SEQ ID NO: 53) or a nucleic acid sequence encoding a heterologous signal peptide as disclosed herein, e.g., a nucleic acid sequence selected from any one of the following: SEQ ID NO: 54 to SEQ ID NO: 58, SEQ ID NO: 67, SEQ ID NO: 72, or SEQ ID NO: 75, or a nucleotide sequence having at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% sequence identity thereto.

[0158] In some embodiments, the rAAV genome for use in the methods of treating Pompe disease as disclosed herein comprises a heterologous nucleic acid sequence comprising nucleotides 148-2859 of SEQ ID NO: 3, wherein appended 5′ to the sequence is a nucleic acid encoding a wild-type or codon-optimized hGAA signal peptide (i.e., a nucleic acid comprising SEQ ID NO: 53) or a nucleic acid sequence encoding a heterologous signal peptide as disclosed herein, e.g., a nucleic acid sequence selected from any one of SEQ ID NO: 54 to SEQ ID NO: 58, SEQ ID NO: 67, SEQ ID NO: 72, or SEQ ID NO: 75, or a nucleotide sequence having at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% sequence identity thereto.

[0159] In some embodiments, the rAAV genome for use in the methods of treating Pompe disease as disclosed herein comprises a heterologous nucleic acid sequence comprising nucleotides 169-2859 of SEQ ID NO: 3, appended 5′ to a nucleic acid encoding, for example, a codon-optimized hGAA signal peptide (i.e., a nucleic acid comprising SEQ ID NO: 53) or a nucleic acid sequence encoding a heterologous signal peptide as disclosed herein, e.g., a nucleic acid sequence selected from any one of SEQ ID NO: 54 to SEQ ID NO: 58, SEQ ID NO: 67, SEQ ID NO: 72, or SEQ ID NO: 75, or a nucleotide sequence having at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% sequence identity thereto.

[0160] In some embodiments, the rAAV genome for use in the methods of treating Pompe disease as disclosed herein comprises a heterologous nucleic acid sequence comprising nucleotides 199-2859 of SEQ ID NO: 3, wherein appended 5′ to the sequence is a nucleic acid encoding a wild-type or codon-optimized hGAA signal peptide (i.e., a nucleic acid comprising SEQ ID NO: 53) or a fragment thereof and / or a nucleic acid sequence encoding a heterologous signal peptide as disclosed herein, e.g., a nucleic acid sequence selected from any one of the following: SEQ ID NO: 54 to SEQ ID NO: 58, SEQ ID NO: 67, SEQ ID NO: 72, or SEQ ID NO: 75, or a nucleotide sequence having at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% sequence identity thereto.

[0161] In some embodiments, the rAAV genome for use in the methods of treating Pompe disease as disclosed herein comprises a heterologous nucleic acid sequence comprising nucleotides 205-2859, or nucleotides 208-2859, or nucleotides 214-2859 of SEQ ID NO: 3, wherein appended 5′ to the sequence is a nucleic acid encoding a wild-type or codon-optimized hGAA signal peptide (i.e., a nucleic acid comprising SEQ ID NO: 53) and / or a nucleic acid sequence encoding a heterologous signal peptide as disclosed herein, e.g., a nucleic acid sequence selected from any one of the following: SEQ ID NO: 54 to SEQ ID NO: 58, SEQ ID NO: 67, SEQ ID NO: 72, or SEQ ID NO: 75, or a nucleotide sequence having at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% sequence identity thereto.

[0162] In some embodiments, the rAAV genome for use in the methods of treating Pompe disease as disclosed herein comprises a heterologous nucleic acid sequence comprising nucleotides 220-2859, or nucleotides 208-2859, or nucleotides 214-2859 of SEQ ID NO: 3, wherein appended 5′ to the sequence is a nucleic acid encoding a wild-type or codon-optimized hGAA signal peptide (i.e., a nucleic acid comprising SEQ ID NO: 53) and / or a nucleic acid sequence encoding a heterologous signal peptide as disclosed herein, e.g., a nucleic acid sequence selected from any one of the following: SEQ ID NO: 54 to SEQ ID NO: 58, SEQ ID NO: 67, SEQ ID NO: 72, or SEQ ID NO: 75, or a nucleotide sequence having at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% sequence identity thereto.

[0163] In some embodiments, the rAAV genome for use in the methods of treating Pompe disease as disclosed herein comprises a heterologous nucleic acid sequence comprising any one of nucleotides 265-2859 of SEQ ID NO: 3, or nucleotides 2335-2859 of SEQ ID NO: 3, or nucleotides 2368-2859 of SEQ ID NO: 3, or nucleotides 2371-2859 of SEQ ID NO: 3, wherein the sequence is appended 5′ to a nucleic acid encoding a wild-type or codon-optimized hGAA signal peptide (i.e., a nucleic acid comprising SEQ ID NO: 53) or a fragment thereof, and / or a nucleic acid sequence encoding a heterologous signal peptide as disclosed herein, e.g., a nucleic acid sequence selected from any one of SEQ ID NO: 54 to SEQ ID NO: 58, SEQ ID NO: 67, SEQ ID NO: 72, or SEQ ID NO: 73. NO: 75, or a nucleotide sequence having at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% sequence identity thereto.

[0164] In some embodiments, the rAAV genome for use in the methods of treating Pompe disease as disclosed herein comprises a heterologous nucleic acid sequence encoding a signal sequence as disclosed herein and a GAA polypeptide or an N-terminally truncated GAA polypeptide, wherein the GAA polypeptide begins at any one of amino acid residues selected from position 28, 35, 40, 50, 57, 57, 68, 69, 70, 72, 74, 89, 779, 790, 791, 792, 793, or 796, and optionally wherein the GAA polypeptide further has a C-terminal deletion of at least about 10, or about 20, or about 30, or about 40, or about 50, or about 60, or about 70, or about 80, or about 90, or about 100, or about 110, or more than 110 amino acid residues from the C-terminus of SEQ ID NO: 1. In some embodiments, the rAAV genome for use in the methods of treating Pompe disease as disclosed herein comprises a heterologous nucleic acid sequence encoding a signal sequence as disclosed herein and a GAA polypeptide or an N-terminally truncated GAA polypeptide, wherein the GAA polypeptide begins at any amino acid residue selected from position 28, 35, 40, 50, 57, 57, 68, 69, 70, 72, 74, 89, 779, 790, 791, 792, 793, or 796, and wherein the C-terminus of the GAA polypeptide occurs at any residue after amino acid residue 500, 600, 700, 800, 842, 852, 862, 875, 885, 895, 900, 905, 915, 920, 925, 930, 935, 940, 945, 950, or 951 of SEQ ID NO. 1.

[0165] In some embodiments, the rAAV genome for use in the methods of treating Pompe disease as disclosed herein comprises a heterologous nucleic acid sequence that (i) encodes a wild-type or codon-optimized hGAA signal peptide (i.e., a nucleic acid comprising SEQ ID NO: 53) or a fragment thereof and / or a nucleic acid sequence encoding a heterologous signal peptide as disclosed herein, e.g., a nucleic acid sequence selected from any one of SEQ ID NO: 54 to SEQ ID NO: 58, SEQ ID NO: 67, SEQ ID NO: 72, or SEQ ID NO: 75, or a nucleotide sequence having at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% sequence identity to SEQ ID NO: 53 to SEQ ID NO: 58, SEQ ID NO: 67, SEQ ID NO: 72, or SEQ ID NO: 65, and (ii) encodes a GAA polypeptide encoded by a nucleic acid sequence that begins at any base pair selected from SEQ ID NO: 54 to SEQ ID NO: 58, SEQ ID NO: 67, SEQ ID NO: 72, or SEQ ID NO: 75. NO: 3 at position 82, 103, 118, 148, 169, 199, 205, 208, 214, 220, 265, and ends at any base pair selected from the group consisting of position 2553 (i.e., 100 C-terminal residues deleted, ending at 851 aa), position 2583 (i.e., 90 C-terminal residues deleted, ending at 861 aa), position 2613 (i.e., 80 C-terminal residues deleted, ending at 871 aa), position 2643 (i.e., 70 C-terminal residues deleted, ending at 871 aa), position 2673 (i.e., 60 C-terminal residues deleted, ending at 881 aa), position 2703 (i.e., 50 C-terminal residues deleted, ending at 881 aa), position 2714 (i.e., 70 C-terminal residues deleted, ending at 881 aa), position 2723 (i.e., 80 C-terminal residues deleted, ending at 881 aa), position 2734 (i.e., 80 C-terminal residues deleted, ending at 881 aa), position 2740 (i.e., 80 C-terminal residues deleted, ending at 881 aa), position 2761 (i.e., 80 C-terminal residues deleted, ending at 881 aa), position 2762 (i.e., 80 C-terminal residues deleted, ending at 881 aa), position 2770 (i.e., 80 C-terminal residues deleted, ending at 881 aa), position 2771 (i.e., 80 C-terminal residues deleted 10 C-terminal residues, ending at 942 aa), or terminates at any position between base pairs 2553-2859 of SEQ ID NO: 3. B. Signal peptide (SP)

[0166] The native GAA signal peptide is not cleaved in the ER, resulting in the native GAA polypeptide being membrane-bound in the ER (Tsuji et al., (1987) Biochem. Int. 15(5): 945-952). Disruption of GAA membrane binding can be achieved by replacing the endogenous GAA signal peptide (and optionally adjacent sequences) with an alternative signal peptide for GAA.

[0167] Thus, in representative embodiments, the rAAV vectors and rAAV genomes for use in the methods of treating Pompe disease as disclosed herein further comprise a heterologous nucleic acid encoding a GAA polypeptide to be transferred to target cells, attached to a heterologous nucleic acid sequence encoding a heterologous signal peptide that replaces the endogenous GAA signal peptide. The heterologous nucleic acid encoding the GAA polypeptide, including an N-terminal truncation of the GAA polypeptide, is operably linked to a segment encoding a secretion signal peptide, such that upon transcription and translation, a fusion polypeptide is produced comprising a secretion signal sequence operably linked to (e.g., directing secretion of) the GAA polypeptide or the N-terminal truncated GAA polypeptide.

[0168] In some embodiments, the endogenous signal peptide of hGAA (i.e., amino acids 1-27 of SEQ ID NO: 1 (encoded by the codon-optimized nucleic acid sequence corresponding to SEQ ID NO: 59)) is replaced with a heterologous signal peptide (also referred to herein as a "signal sequence" or "leader sequence") of SEQ ID NO: 60 (201 IgG signal peptide), or IL2 wild-type signal peptide (SEQ ID NO: 61), modified IL2 signal peptide (SEQ ID NO: 62), A2M signal peptide (SEQ ID NO: 63), or PZP signal peptide (SEQ ID NO: 64), or an artificial signal peptide (SEQ ID NO: 65), or cathpetsin L signal peptide (SEQ ID NO: 66), or a signal peptide having at least 90% sequence identity to SEQ ID NO: 60 to SEQ ID NO: 66.

[0169] In some embodiments, the AAV vector encodes a GAA polypeptide comprising an endogenous GAA signal peptide (e.g., amino acids 1-27 of SEQ ID NO: 1, also referred to as a "native GAA" or "homologous GAA" signal peptide). In some embodiments, the AAV vector encodes a GAA polypeptide comprising an endogenous GAA signal peptide (e.g., amino acids 1-27 of SEQ ID NO: 1, or a portion thereof) and an additional heterologous (i.e., non-native) signal sequence. In some embodiments, a GAA polypeptide or an N-terminal GAA polypeptide as disclosed herein that lacks the endogenous signal peptide of amino acids 1-27 of GAA of SEQ ID NO: 1 is fused to a heterologous signal peptide (also referred to as a "secretion signal peptide").

[0170] In a specific embodiment, the heterologous nucleic acid sequence encodes a GAA polypeptide comprising a signal peptide fused to a GAA polypeptide, wherein the signal peptide is a heterologous GAA polypeptide. In some embodiments, the heterologous nucleic acid encoding a GAA polypeptide fused to a heterologous (e.g., exogenous or non-GAA) signal peptide can further comprise a nucleic acid sequence encoding a portion of a homologous (e.g., endogenous) GAA signal peptide at the 5' end, for example, encoding at least 1-5, or at least 1-10, or at least 1-20, or at least about 1-23, or at least about 1-24, or at least about 1-25, or at least about 1-26, or the entire GAA signal peptide, for example, or at least about 1-27 consecutive amino acids of an endogenous GAA signal peptide. In other words, in some embodiments, the heterologous nucleic acid sequence can comprise, in a 5' to 3' orientation, a nucleic acid sequence encoding the entire GAA signal peptide of SEQ ID NO: 59 or a portion of the endogenous GAA signal peptide of SEQ ID NO: 59, a nucleic acid sequence encoding a heterologous signal peptide (e.g., a non-GAA signal peptide), and a nucleic acid sequence encoding a GAA polypeptide, such as a wild-type nucleic acid sequence, or a sequence encoding at least 1-3 amino acid variants, or a codon-optimized nucleic acid sequence encoding a GAA polypeptide (including N-terminal GAA truncations). For example, in some embodiments, the nucleic acid sequence encoding a GAA polypeptide encodes an N-terminally truncated GAA polypeptide, such as those disclosed in Table 1 herein.

[0171] In some embodiments, the order of the signal peptides is varied. For example, in some embodiments, the heterologous nucleic acid sequence can comprise, in a 5' to 3' direction, a nucleic acid sequence encoding a heterologous signal peptide as disclosed herein, the entire GAA signal peptide of SEQ ID NO: 59, or a portion of the endogenous GAA signal peptide of SEQ ID NO: 59, and a wild-type or codon-optimized nucleic acid sequence encoding a GAA polypeptide (including an N-terminal GAA truncation).

[0172] In some embodiments, a portion of a GAA polypeptide can be present, for example, any one amino acid, or two or more consecutive amino acids, located in the region of amino acids 28-56 of SEQ ID NO: 1, located between the GAA signal peptide (or a portion thereof) and the heterologous signal peptide and upstream (e.g., N-terminus) of the N-terminally truncated GAA polypeptide. For example, and without wishing to be bound by theory, in some embodiments, the heterologous nucleic acid sequence can comprise, in a 5' to 3' orientation: (i) the entire full-length GAA signal peptide or a portion thereof as disclosed herein, (ii) a portion of a GAA polypeptide (e.g., amino acids 28-35 of SEQ ID NO: 1, amino acid 28 of SEQ ID NO: 1, or amino acids 28-31 of SEQ ID NO: 1), (iii) the heterologous signal peptide, and (iv) a GAA polypeptide (e.g., an N-terminally truncated GAA polypeptide starting at amino acid 57 of SEQ ID NO: 1). It is contemplated that the portion of the GAA polypeptide located between the GAA polypeptide and the heterologous signal peptide can be of any length, for example, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 10-12, 12-14, 14-16, 16-18, 18-20 amino acids, or more than 20 amino acids of residues 28-56 of SEQ ID NO: 1, and the N-terminal GAA polypeptide need not begin at the next or consecutive amino acid of the earlier GAA polypeptide portion. Certain amino acids in this region of amino acids 28-56 may cause cellular retention. In one embodiment, those amino acids are removed or substituted.

[0173] In some embodiments, the nucleic acid sequence encoding the GAA signal peptide encodes at least 1-5, or at least 1-10, or at least 1-20, or at least about 1-23, or at least about 1-24, or at least about 1-25, or at least about 1-26, or at least about 1-27 consecutive amino acids (i.e., the complete GAA signal peptide sequence), or non-contiguous amino acids of the endogenous GAA signal peptide of SEQ ID NO: 59. In some embodiments, the nucleic acid sequence encoding the GAA signal peptide encodes a GAA signal peptide comprising the following: at least one deletion of at least 1, or at least 2, or at least 3, or at least 4, or at least 5, or at least 6, or at least 7, or at least 8, or at least 9, or at least 10, or at least 11, or at least 12, or at least 13, or at least 14, or at least 15, or at least 16, or at least 17, or at least 18, or at least 19, or at least 20 amino acids of SEQ ID NO: 59, wherein one or more deletions may be continuous or non-continuous.

[0174] In some embodiments, the nucleic acid sequence encoding the GAA signal peptide may comprise the entire nucleic acid of SEQ ID NO: 57 (encoding a GAA signal peptide comprising amino acids 1-27 of SEQ ID NO: 59). In alternative embodiments, the nucleic acid sequence encoding the GAA signal peptide may comprise a portion of the nucleic acid sequence of SEQ ID NO: 53, for example, a portion of SEQ ID NO: 53 selected from a contiguous base of SEQ ID NO: 53 having any of the following lengths: 1-3 bp, 1-4 bp, 1-5 bp, 1-6 bp, 1-7 bp, 1-8 bp, 1-9 bp, 1-10 bp, 1-11 bp, 1-12 bp, 1-13 bp, 1-14 bp, 1-15 bp, 1-16 bp, 1-17 bp, 1-18 bp, 1-19 bp, 1-20 bp, 1-21 bp, 1-22 bp, 1-23 bp, 1-24 bp, 1-25 bp, 1-26 bp, 1-27 bp, 1-28 bp, 1-29 bp, 1-30 bp, 1-31 bp, 1-32 bp, 1-33 bp, 1-34 bp, 1-35 bp, 1-36 bp, 1-37 bp, 1-38 bp, 1-39 bp, 1-40 bp, 1-41 bp, 1-42 bp, 1-43 bp, 1-44 bp, 1-45 bp, 1-46 bp, 1-47 bp, 1-48 bp, 1-49 bp, 1 bp, 1-24bp, 1-25bp, 1-26bp, 1-27bp, 1-28bp, 1-29bp, 1-30bp, 1-33bp, 1-36bp, 1-39bp, 1-42bp, 1-45bp, 1-48bp, 1-51bp, 1-54bp, 1-57bp, 1-60bp, 1-63bp, 1-66bp, 1-69bp, 1-72bp, 1-75bp, and 1-78bp. That is, using the 21bp portion of SEQ ID NO: 53 as an illustrative example, the GAA signal peptide may comprise a nucleic acid that is the 21bp portion of SEQ ID NO: 53, wherein the 21bp may be any 21 consecutive base pairs of SEQ ID NO: 53. For example, the 1-21 bp portion starting at base pair 1 of SEQ ID NO: 53 will encode a GAA signal peptide comprising amino acids 1-7 of SEQ ID NO: 59, and the 1-21 bp portion starting at base pair 15 of SEQ ID NO: 53 will encode a GAA signal peptide comprising amino acids 5-12 of SEQ ID NO: 59. In some embodiments, the portion of the GAA signal peptide of SEQ ID NO: 59 is the N-terminal portion of SEQ ID NO: 59 (i.e., having a deletion of at least 1, or at least 2, or at least 3, or at least 4, or at least 5, or at least 6, or at least 7, or at least 8, or at least 9, or at least 10, or at least 11, or at least 12, or at least 13, or at least 14, or at least 15 amino acids, or more than 15 amino acids, at the C-terminus of SEQ ID NO: 59).

[0175] In some embodiments, a nucleic acid encoding a heterologous signal peptide, as disclosed herein, can be inserted into a nucleic acid sequence encoding a GAA signal peptide. The insertion can occur at any position within bp 1-81 of SEQ ID NO: 53. In some embodiments, a nucleic acid sequence encoding a heterologous signal peptide, as disclosed herein, is inserted into a portion of a nucleic acid encoding a GAA signal peptide (e.g., to create a chimeric signal peptide), the nucleic acid sequence comprising, for example, a portion encoding a GAA signal peptide (e.g., a portion of SEQ ID NO: 53, as discussed above) and a 5' nucleic acid sequence, a nucleic acid encoding a heterologous signal peptide, as disclosed herein, appended 3' to the sequence. In some embodiments, a nucleic acid encoding an N-terminal portion of a GAA polypeptide with subsequent amino acid deletions can also be present (e.g., a nucleic acid encoding amino acids 28, 28-29, 28-30, 28-31, 28-32, 28-33, etc. of SEQ ID NO: 1 (subsequently deleting approximately 4-40 amino acids of SEQ ID NO: 1)). In some embodiments, a heterologous signal peptide can be inserted immediately after the N-terminal amino acid (eg, after position 28, 29, 30, 31, 32, or 33).

[0176] In some embodiments of the compositions and methods described herein, the signal peptide is used for the general purpose of facilitating secretion of the GAA polypeptide from hepatocytes into the blood, where it can be transported and targeted to the lysosomes of mammalian cells (e.g., human cardiomyocytes and skeletal muscle cells as described herein). In some embodiments, the heterologous signal peptide is selected from any one of the following: AAT signal peptide, fibronectin signal peptide (FN1), 201 signal peptide, wtIL2 signal peptide, mutIL2 signal peptide, A2M signal peptide, PZP signal peptide, or an active fragment of AAT, FN1, 201, wtIL2, mutIL2, A2M or PZP signal peptide that has secretory signal activity.

[0177] In some embodiments, the signal peptide is heterologous (i.e., foreign or exogenous) to the polypeptide of interest. For example, the heterologous signal peptide is a fibronectin secretion signal peptide, and the polypeptide of interest is not fibronectin. In some embodiments, the signal peptide is selected from any of the following: FN1, 201 signal peptide, wtIL2 signal peptide, mutIL2 signal peptide, A2M signal peptide, and PZP signal peptide, which have secretion signal activity. In alternative embodiments, the signal peptide is not heterologous to GAA, i.e., the signal peptide is a GAA signal peptide (i.e., residues 1-27 of SEQ ID NO: 1, which is an endogenous GAA polypeptide).

[0178] In some embodiments, the endogenous GAA signal sequence of amino acids 1-27 of SEQ ID NO: 1 (ie, MGVRHPPCSHRLLAVCALVSLATAALL, SEQ ID NO: 59) is replaced with a different signal peptide (leader peptide). For example, the endogenous signal peptide of GAA (SEQ ID NO: 59) can be replaced by any of the following: (i) an IgG1 signal peptide (referred to herein as "201 signal peptide" or "2011p") having the amino acid sequence MEFGLSWVFLVALLKGVQCE (SEQ ID NO: 60) encoded by the nucleic acid sequence SEQ ID NO: 54, (ii) wtIL21p: MYRMQLLSCIALSLALVTNS (SEQ ID NO: 61) encoded by the nucleic acid sequence SEQ ID NO: 55, or (iii) mutIL21p: MYRMQLLLLIALSLALVTNS (SEQ ID NO: 62) encoded by the nucleic acid sequence SEQ ID NO: 56, (iv) an A2M signal peptide: MGKNKLLHPSLVLLLLVLLPTDA (SEQ ID NO: 63) encoded by the nucleic acid sequence SEQ ID NO: 57, (iv) a PZP signal peptide: MYRMQLLSCIALSLALVTNS (SEQ ID NO: 64) encoded by the nucleic acid sequence SEQ ID NO: 65, NO: 58 encodes MRKDRLLHLCLVLLLILLSASDSNS (SEQ ID NO: 64). In some embodiments, the heterologous signal peptide can be truncated.

[0179] In some embodiments, the endogenous GAA signal peptide (SEQ ID NO: 59) or a fragment or portion thereof is still present, and an additional signal peptide is added (e.g., any one or more of the signal peptides AAT, FN1, 201, wtIL2, mutIL2, A2M, or PZP disclosed herein). In some embodiments, the endogenous GAA signal peptide at amino acids 1-27 of SEQ ID NO: 1 (i.e., MGVRHPPCSHRLLAVCALVSLATAALL, SEQ ID NO: 59) is replaced with a different or heterologous signal peptide. For example, the endogenous signal peptide of GAA (SEQ ID NO: 59) can be replaced with any one of the following heterologous signal peptides: (i) an IgG1 signal peptide (referred to herein as "201 signal peptide" or "201lp") having the amino acid sequence MEFGLSWVFLVALLKGVQCE (SEQ ID NO: 60) encoded by the nucleic acid sequence of SEQ ID NO: 54, (ii) wtIL2lp: MYRMQLLSCIALSLALVTNS (SEQ ID NO: 61) encoded by the nucleic acid sequence of SEQ ID NO: 55, or (iii) mutIL2lp: MYRMQLLLLIALSLALVTNS (SEQ ID NO: 62) encoded by the nucleic acid sequence of SEQ ID NO: 56, (iv) an A2M signal peptide: MGKNKLLHPSLVLLLLVLLPTDA (SEQ ID NO: 63) encoded by the nucleic acid sequence of SEQ ID NO: 57, (iv) a PZP signal peptide: MYRMQLLSCIALSLALVTNS (SEQ ID NO: 64) encoded by the nucleic acid sequence of SEQ ID NO: 58, NO:58 encodes MRKDRLLHLCLVLLLILLSASDSNS (SEQ ID NO:64).

[0180] In some embodiments, the nucleic acid sequence in the rAAV vector or rAAV genome is a sequence selected from SEQ ID NO: 470 to SEQ ID NO: 515. In one embodiment, the nucleic acid sequence in the rAAV vector or rAAV genome comprises at least a portion of a sequence selected from SEQ ID NO: 470 to SEQ ID NO: 515 (i.e., a sequence that is at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more of a sequence selected from SEQ ID NO: 470 to SEQ ID NO: 515).

[0181] In some embodiments, exemplary nucleic acid sequences in rAAV vectors or rAAV genomes as disclosed herein are shown in the exemplary constructs provided below: pP065 is a plasmid comprising, in 5′ to 3′ orientation: [L-ITR]-[(LSP: liver-specific promoter)]-[5′UTR]-[1-28aa GAA-SP]-[GAA polypeptide starting from amino acid position 57 of SEQ ID NO: 1]-[3′UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, for example, SEQ ID NO: 470. pP066 is a plasmid comprising, in 5′ to 3′ orientation: [L-ITR]-[(LSP: liver-specific promoter)]-[5′UTR]-[1-28aa GAA-SP]-[GAA polypeptide starting from amino acid position 57 of SEQ ID NO: 1]-[3′UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, for example, SEQ ID NO: 471. pP067 is a plasmid comprising, in 5′ to 3′ orientation: [L-ITR]-[(LSP: liver-specific promoter)]-[5′UTR]-[aa1 from GAA-SP]-[28-31aa GAA]-[IL-2 signal sequence]-[GAA polypeptide starting from amino acid position 57 of SEQ ID NO: 1]-[3′UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, for example, SEQ ID NO: 472. pP068 is a plasmid comprising, in 5′ to 3′ orientation: [L-ITR]-[(LSP: liver-specific promoter)]-[5′UTR]-[aa1 from GAA-SP]-[28-31aa GAA]-[201Ig]-[GAA polypeptide starting from amino acid position 57 of SEQ ID NO: 1]-[3′UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, for example, SEQ ID NO: 473. pP069 is a plasmid comprising, in 5′ to 3′ direction: [L-ITR]-[(LSP: liver-specific promoter)]-[5′UTR]-[aa1 from GAA-SP from seq 100]-[GAA 28-31 aa from seq 3]-[IL-2 signal sequence]-[GAA polypeptide starting at amino acid 57 of seq 3]-[3′UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[ITR-adjacent domain]-[R-ITR]. See, e.g., SEQ ID NO: 474. pP070 is a plasmid comprising, in 5′ to 3′ orientation: [L-ITR]-[(LSP: liver-specific promoter)]-[5′UTR]-[aa1 from GAA-SP]-[28-31aa GAA]-[201Ig]-[GAA polypeptide starting from amino acid position 57 of SEQ ID NO: 1]-[3′UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, for example, SEQ ID NO: 475. pP071 is a plasmid comprising, in 5′ to 3′ orientation: [L-ITR]-[(LSP: liver-specific promoter)]-[5′UTR]-[1-24aa GAA]-[IL-2 signal sequence]-[GAA polypeptide starting from amino acid position 57 of SEQ ID NO: 1]-[3′UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, for example, SEQ ID NO: 476. pP072 is a plasmid comprising, in 5′ to 3′ orientation: [L-ITR]-[(LSP: liver-specific promoter)]-[5′UTR]-[1-24aa GAA]-[201Ig]-[GAA polypeptide starting from amino acid position 57 of SEQ ID NO: 1]-[3′UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, for example, SEQ ID NO: 477. pP073 is a plasmid comprising, in 5′ to 3′ orientation: [L-ITR]-[(LSP: liver-specific promoter)]-[5′UTR]-[1-24aa GAA]-[IL-2 signal sequence]-[GAA polypeptide starting from amino acid position 57 of SEQ ID NO: 1]-[3′UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, for example, SEQ ID NO: 478. pP074 is a plasmid comprising, in 5′ to 3′ orientation: [L-ITR]-[(LSP: liver-specific promoter)]-[5′UTR]-[1-24aa GAA]-[201Ig]-[GAA polypeptide starting from amino acid position 57 of SEQ ID NO: 1]-[3′UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, for example, SEQ ID NO: 479. pP075 is a plasmid comprising, in 5′ to 3′ orientation: [L-ITR]-[(LSP: liver-specific promoter)]-[5′UTR]-[1-23aa GAA]-[IL-2 signal sequence]-[GAA polypeptide starting from amino acid position 57 of SEQ ID NO: 1]-[3′UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, for example, SEQ ID NO: 480. pP076 is a plasmid comprising, in 5′ to 3′ orientation: [L-ITR]-[(LSP: liver-specific promoter)]-[5′UTR]-[1-23aa GAA]-[201Ig]-[GAA polypeptide starting from amino acid position 57 of SEQ ID NO: 1]-[3′UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, for example, SEQ ID NO: 481. pP077 is a plasmid comprising, in 5′ to 3′ orientation: [L-ITR]-[(LSP: liver-specific promoter)]-[5′UTR]-[1-23aa GAA]-[IL-2 signal sequence]-[GAA polypeptide starting from amino acid position 57 of SEQ ID NO: 1]-[3′UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, for example, SEQ ID NO: 482. pP078 is a plasmid comprising, in 5′ to 3′ orientation: [L-ITR]-[(LSP: liver-specific promoter)]-[5′UTR]-[1-23aa GAA]-[201Ig]-[GAA polypeptide starting from amino acid position 57 of SEQ ID NO: 1]-[3′UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, for example, SEQ ID NO: 483. pP079 is a plasmid comprising, in 5′ to 3′ orientation: [L-ITR]-[(LSP: liver-specific promoter)]-[5′UTR]-[1-2aa GAA]-[IL-2 signal sequence (Met1 deleted)]-[GAA polypeptide starting from amino acid position 57 of SEQ ID NO: 1]-[3′UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, for example, SEQ ID NO: 484. pP080 is a plasmid comprising, in 5′ to 3′ orientation: [L-ITR]-[(LSP: liver-specific promoter)]-[5′UTR]-[1-2aa GAA]-[201Ig (Met1 removed)]-[GAA polypeptide starting from amino acid position 57 of SEQ ID NO: 1]-[3′UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, for example, SEQ ID NO: 485. pP081 is a plasmid comprising, in 5′ to 3′ orientation: [L-ITR]-[(LSP: liver-specific promoter)]-[5′UTR]-[1-2aa GAA]-[IL-2 signal sequence (Met1 deleted)]-[GAA polypeptide starting from amino acid position 57 of SEQ ID NO: 1]-[3′UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, for example, SEQ ID NO: 486. pP082 is a plasmid comprising, in 5′ to 3′ orientation: [L-ITR]-[(LSP: liver-specific promoter)]-[5′UTR]-[1-2aa GAA]-[201Ig (Met1 removed)]-[GAA polypeptide starting from amino acid position 57 of SEQ ID NO: 1]-[3′UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, for example, SEQ ID NO: 487. pP083 is a plasmid comprising, in 5′ to 3′ orientation: [L-ITR]-[(LSP: liver-specific promoter)]-[5′UTR]-[1-4aa GAA]-[IL-2 signal sequence (Met1 deleted)]-[GAA polypeptide starting from amino acid position 57 of SEQ ID NO: 1]-[3′UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, for example, SEQ ID NO: 488. pP084 is a plasmid comprising, in 5′ to 3′ orientation: [L-ITR]-[(LSP: liver-specific promoter)]-[5′UTR]-[1-4aa GAA]-[201Ig (Met1 removed)]-[GAA polypeptide starting from amino acid position 57 of SEQ ID No: 1]-[3′UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, for example, SEQ ID NO: 489. pP085 is a plasmid comprising, in 5′ to 3′ orientation: [L-ITR]-[(LSP: liver-specific promoter)]-[5′UTR]-[1-4aa GAA]-[IL-2 signal sequence (Met1 deleted)]-[GAA polypeptide starting from amino acid position 57 of SEQ ID NO: 1]-[3′UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, for example, SEQ ID NO: 490. pP086 is a plasmid comprising, in 5′ to 3′ orientation: [L-ITR]-[(LSP: liver-specific promoter)]-[5′UTR]-[1-4aa GAA]-[201Ig (Met1 removed)]-[GAA polypeptide starting from amino acid position 57 of SEQ ID No: 1]-[3′UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, for example, SEQ ID NO: 491. pP087 is a plasmid comprising, in 5′ to 3′ orientation: [L-ITR]-[(LSP: liver-specific promoter)]-[5′UTR]-[1-10aa GAA]-[IL-2 signal sequence (Met1 deleted)]-[GAA polypeptide starting from amino acid position 57 of SEQ ID NO: 1]-[3′UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, for example, SEQ ID NO: 492. pP088 is a plasmid comprising, in 5′ to 3′ orientation: [L-ITR]-[(LSP: liver-specific promoter)]-[5′UTR]-[1-10aa GAA]-[201Ig (Met1 removed)]-[GAA polypeptide starting from amino acid position 57 of SEQ ID NO: 1]-[3′UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, for example, SEQ ID NO: 493. pP089 is a plasmid comprising, in 5′ to 3′ orientation: [L-ITR]-[(LSP: liver-specific promoter)]-[5′UTR]-[1-10aa GAA]-[IL-2 signal sequence (Met1 deleted)]-[GAA polypeptide starting from amino acid position 57 of SEQ ID NO: 1]-[3′UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, for example, SEQ ID NO: 494. pP090 is a plasmid comprising, in 5′ to 3′ orientation: [L-ITR]-[(LSP: liver-specific promoter)]-[5′UTR]-[1-10aa GAA]-[201Ig (Metl removed)]-[GAA polypeptide starting from amino acid position 57 of SEQ ID NO: 1]-[3′UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, for example, SEQ ID NO: 495. pP091 is a plasmid comprising, in 5′ to 3′ orientation: [L-ITR]-[(LSP: liver-specific promoter)]-[5′UTR]-[1-27aa GAA]-[IL-2 signal sequence (Met1 deleted)]-[GAA polypeptide starting from amino acid position 57 of SEQ ID NO: 1]-[3′UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, for example, SEQ ID NO: 496. pP092 is a plasmid comprising, in 5′ to 3′ orientation: [L-ITR]-[(LSP: liver-specific promoter)]-[5′UTR]-[1-27aa GAA]-[201Ig (Met1 removed)]-[GAA polypeptide starting from amino acid position 57 of SEQ ID NO: 1]-[3′UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, for example, SEQ ID NO: 497. pP093 is a plasmid comprising, in 5′ to 3′ orientation: [L-ITR]-[(LSP: liver-specific promoter)]-[5′UTR]-[1-27aa GAA]-[IL-2 signal sequence (Met1 deleted)]-[GAA polypeptide starting from amino acid 57 of SEQ ID NO: 1]-[3′UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[ITR-adjacent region]-[R-ITR]. See, for example, SEQ ID NO: 498. pP094 is a plasmid comprising, in 5′ to 3′ orientation: [L-ITR]-[(LSP: liver-specific promoter)]-[5′UTR]-[1-27aa GAA]-[201Ig (Met1 removed)]-[GAA polypeptide starting from amino acid position 57 of SEQ ID NO: 1]-[3′UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, for example, SEQ ID NO: 499. pP098 is a plasmid comprising, in 5′ to 3′ orientation: [L-ITR]-[(LSP: liver-specific promoter)]-[5′UTR]-[1-24aa GAA]-[GAA polypeptide starting from amino acid position 57 of SEQ ID NO: 1]-[3′UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, for example, SEQ ID NO: 500. pP099 is a plasmid comprising, in 5′ to 3′ orientation: [L-ITR]-[(LSP: liver-specific promoter)]-[5′UTR]-[1-24aa GAA]-[GAA polypeptide starting from amino acid position 57 of SEQ ID NO: 1]-[3′UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, for example, SEQ ID NO: 501. pP110 is a plasmid comprising, in 5' to 3' direction: [ITR2]-[LSP]-[1-28aa GAA]-[GAA polypeptide starting from amino acid position 57 of SEQ ID NO: 1]-[3'UTR]-[hGH polyA]-[ITR2]. See, for example, SEQ ID NO: 502. pP111 is a plasmid comprising, in 5' to 3' direction: [ITR2]-[LSP]-[1-24aa GAA]-[GAA polypeptide starting from amino acid position 57 of SEQ ID NO: 1]-[3'UTR]-[hGH polyA]-[ITR2]. See, for example, SEQ ID NO: 503. pP112 is a plasmid comprising, in 5′ to 3′ orientation: [ITR2]-[LSP]-[1-27aa GAA]-[2011p (Met1 removed)]-[GAA polypeptide starting from amino acid position 57 of SEQ ID NO: 1]-[3′UTR]-[hGH polyA]-[ITR2]. See, for example, SEQ ID NO: 504. pP113 is a plasmid comprising, in 5′ to 3′ orientation: [ITR2]-[LSP]-[1-24aa GAA]-[2011p]-[GAA polypeptide starting at amino acid position 57 of SEQ ID NO: 1]-[3′UTR]-[hGH polyA]-[ITR2]. See, for example, SEQ ID NO: 505. pP114 is a plasmid comprising, in 5′ to 3′ orientation: [ITR2]-[LSP]-[1-2aa GAA]-[IL-2 signal sequence (Met1 deleted)]-[GAA polypeptide starting from amino acid position 57 of SEQ ID NO: 1]-[3′UTR]-[hGH polyA]-[ITR2]. See, for example, SEQ ID NO: 506. pP150 is a plasmid comprising, in 5' to 3' orientation: [ITR2]-[LSP]-[1-24aa GAA]-[201Ip]-[GAA polypeptide starting from amino acid position 57 of SEQ ID NO: 1]-[3'UTR]-[hGH polyA]-[ITR2]. See, for example, SEQ ID NO: 507. pP151 is a plasmid comprising, in 5' to 3' orientation: [ITR2]-[LSP]-[5'UTR]-[1-24aaGAA]-[201Ip]-[GAA polypeptide starting at amino acid position 57 of SEQ ID NO: 1]-[3'UTR]-[hGH polyA]-[ITR2]. See, for example, SEQ ID NO: 508. pP152 is a plasmid comprising, in 5' to 3' direction: [ITR2]-[LSP]-[1-24aa GAA]-[201Ip]-[GAA polypeptide starting from amino acid position 57 of SEQ ID NO: 1]-[3'UTR]-[hGH polyA]-[ITR2]. See, for example, SEQ ID NO: 509. pP153 is a plasmid comprising, in 5' to 3' orientation: [ITR2]-[LSP]-[5'UTR]-[1-24aaGAA]-[201Ip]-[GAA polypeptide starting at amino acid position 57 of SEQ ID NO: 1]-[3'UTR]-[hGH polyA]-[ITR2]. See, for example, SEQ ID NO: 510. pP155 is a plasmid comprising, in 5' to 3' orientation: [L-ITR]-[fragment of P5]-[LSP]-[1-24aa GAA]-[201Ip]-[GAA polypeptide starting from amino acid position 57 of SEQ ID NO: 1]-[3'UTR]-[hGH polyA]-[R-ITR]. See, for example, SEQ ID NO: 511. pP157 is a plasmid comprising, in 5′ to 3′ orientation: [L-ITR]-[fragment of P5]-[LSP]-[1-28aa GAA from ACTUS]-[GAA polypeptide starting at amino acid position 57 of SEQ ID NO: 1]-[3′UTR]-[hGH polyA]-[R-ITR]. See, for example, SEQ ID NO: 512.

[0182] In some embodiments, the exemplary constructs have a codon-optimized GAA, including a codon-optimized GAA signal peptide or a portion thereof, for example, the GAA and / or GAA signal peptide is encoded by SEQ ID NO: 3 or SEQ ID NO: 4, or a fragment thereof. In some embodiments of the invention, the GAA and / or GAA signal peptide or a portion thereof in the exemplary constructs is not codon-optimized, for example, the GAA and / or GAA signal peptide is encoded by SEQ ID NO: 2 or a fragment thereof.

[0183] In some embodiments, the exemplary constructs described herein can be located in a plasmid DNA backbone, or a closed-end linear double-stranded DNA backbone or a precursor plasmid to a closed-end linear double-stranded DNA backbone.

[0184] In some embodiments, exemplary constructs described herein comprise a 5'UTR as described in this application, including but not limited to SEQ ID NO:40 or SEQ ID NO:41.

[0185] In some embodiments, nucleic acids encoding GAA of the invention (including but not limited to exemplary constructs) have a 130 bp ITR. In some embodiments of the invention, nucleic acids encoding GAA of the invention (including but not limited to exemplary constructs) have a 145 bp ITR.

[0186] In some embodiments, exemplary nucleic acid sequences in rAAV vectors or rAAV genomes as disclosed herein are shown in Table 10.

[0187] Table 10: Exemplary constructs encoding a GAA signal peptide or portion thereof, a heterologous signal peptide, and a GAA polypeptide in a 5' to 3' direction (see e.g. Figure 29 In Table 10, for exemplary purposes, GAA polypeptides starting at amino acid position 57 of SEQ ID NO: 1 are shown; however, any GAA polypeptide is contemplated, including any N-terminal truncation disclosed in Table 1 herein, as well as wild-type GAA polypeptides, codon-optimized GAA polypeptides, ACTUS-101 GAA polypeptides, and N-terminal truncations thereof. (Hetero-SP or SP refers to a heterologous signal peptide as disclosed herein, and GAA-SP refers to the endogenous (homologous) signal peptide of GAA of SEQ ID NO: 59, or a portion thereof).

[0188] In one embodiment, the constructs described in Table 10 achieve the titers described in Table 11 after 4 weeks of administration in vivo.

[0189] In Table 11, "Serum GAA" describes the level of GAA expression found in the serum of injected mice 4 weeks after administration; "Serum 4MU" describes the level of GAA activity found in the serum of injected mice 4 weeks after administration; "Heart 4MU" describes the level of GAA activity found in the hearts of injected mice 4 weeks after administration; "Cardiac 4MU" describes the level of glucose found in the hearts of injected mice 4 weeks after administration; and "Liver Retention" describes the level of GAA expression found in the livers of injected mice 4 weeks after administration.

[0190] Typically, the GAA signal peptide and / or heterologous signal peptide will be located at the amino terminus (N-terminus) of the GAA polypeptide (i.e., the nucleic acid segment encoding the signal peptide is located 5′ to the heterologous nucleic acid encoding the GAA peptide in the rAAV vector or rAAV genome as disclosed herein). Alternatively, the signal peptide can be located at the carboxyl terminus or embedded in the GAA polypeptide, so long as the signal peptide is operably associated therewith and directs secretion of the GAA polypeptide or GAA fusion polypeptide of interest (with or without cleavage of the signal peptide from the GAA polypeptide) from the cell.

[0191] The signal peptide is operably associated with a GAA polypeptide (including the N-terminally truncated GAA polypeptides disclosed in Table 1 herein) to target the GAA polypeptide to the secretory pathway. In other words, the signal peptide is operably associated with the GAA polypeptide so that the GAA polypeptide is secreted from the cell at a higher level (i.e., a greater amount) than in the absence of the secretory signal peptide. Generally, when the signal peptide is attached, typically at least about 20%, 30%, 40%, 50%, 70%, 80%, 85%, 90%, 95% or more of the GAA polypeptide is secreted from the cell compared to when the secretory signal peptide is not attached. In other embodiments, substantially all of the detectable polypeptide (alone and / or in the form of a fusion polypeptide) is secreted from the cell.

[0192] The phrase "secreted from a cell" means that the polypeptide can be secreted into any compartment (e.g., fluid or space) outside the cell, including but not limited to: interstitial space, blood, lymph, cerebrospinal fluid, renal tubules, airways (e.g., alveoli, bronchioles and bronchi, nasal passages, etc.), gastrointestinal tract (e.g., esophagus, stomach, small intestine, colon, etc.), vitreous humor in the eye, and endolymph in the cochlea, etc.

[0193] Thus, in some embodiments, the GAA-expressing AAV for use in the methods of treating Pompe disease as disclosed herein comprises 5′ ITR and 3′ ITR sequences, and a liver-specific promoter located between the 5′ ITR and 3′ ITR, wherein the liver-specific promoter is operably linked to a heterologous nucleic acid encoding a secretory peptide and a nucleic acid encoding an α-glucosidase (GAA) polypeptide (i.e., the heterologous nucleic acid encodes a GAA polypeptide or an N-terminal GAA polypeptide comprising a signal peptide-GAA polypeptide).

[0194] In an alternative embodiment, the GAA-expressing AAV for use in the methods of treating Pompe disease as disclosed herein comprises 5′ ITR and 3′ ITR sequences, and a promoter located between the 5′ ITR and 3′ ITR, operably linked to a heterologous nucleic acid encoding a secreted peptide and a nucleic acid encoding an α-glucosidase (GAA) polypeptide.

[0195] Typically, the secretory signal peptide is cleaved within the endoplasmic reticulum, and in some embodiments, the signal peptide is cleaved from the GAA polypeptide prior to secretion. However, as long as secretion of the GAA polypeptide from the cell is enhanced and the GAA polypeptide is functional, cleavage of the signal peptide is not necessary. Therefore, in some embodiments, the signal peptide is partially or completely retained.

[0196] In some embodiments, the rAAV genome or isolated nucleic acid as disclosed herein comprises a nucleic acid encoding a chimeric polypeptide comprising a GAA polypeptide operably linked to a secretory signal peptide, and the chimeric polypeptide is expressed and produced from cells transduced with the rAAV vector, and the GAA polypeptide is secreted from the cells. The GAA polypeptide can be secreted after cleaving all or part of the secretory signal peptide. Alternatively, the GAA polypeptide can retain the signal peptide (i.e., the signal peptide is not cleaved). Thus, in this context, a "GAA polypeptide" can be a chimeric polypeptide comprising a secretory peptide.

[0197] Other signal peptides are contemplated for use in the methods and compositions disclosed herein. For example, a large number of secreted proteins and sequences directing secretion from cells are known in the art as disclosed in U.S. Patent No. 9,873,868, which is incorporated herein by reference in its entirety. Exemplary secreted proteins (and their secretion signals) include, but are not limited to, erythropoietin, coagulation factor IX, cystatin, lactoferrin, plasma proteinase C1 inhibitor, apolipoproteins (e.g., APO A, C, E), MCP-1, α-2-HS-glycoprotein, α-1-microglobulin, complement (e.g., C1Q, C3), vitronectin, lymphotoxin-α, azurocidin, VIP, inhibitor of metalloproteinase 2, glypican-1, pancreatic hormone, clusterin, hepatocyte growth factor, insulin, α-1-antichymotrypsin, growth hormone, type IV collagenase, guanylin, properdin, preproenkephalin A, inhibin beta (e.g., A chain), prealbumin, angiocenin, pro-enkephalin A, Lutein (e.g., beta chain), insulin-like growth factor binding proteins 1 and 2, activator pro-polypeptide, fibrinogen (e.g., beta chain), gastric triglyceride lipase, midkine, neutrophil defensin 1, neutrophil defensin 2, and neutrophil defensin 3, alpha-1-antitrypsin, matrix gla-protein, alpha-tryptase, bile salt-activated lipase, chymotrypsinogen B, elastin, IG lambda chain V region, platelet factor 4 variant, chromogranin A, WNT-1 proto-oncogene protein, oncostatin M, beta-neoendorphin-dynorphin, von Willebrand factor, plasma serine protease inhibitor, serum amyloid A, nestin, fibronectin, renin, osteonectin, histatin 3, phospholipase A2, cartilage matrix protein, GM-CSF, matrix dissolving factor, neuroendocrine protein 7B2, placental protein 11, gelsolin, M-CSF, transcobalamin I, lactase-phlorizin hydrolase, elastase 2B, pepsinogen A, MIP1-beta, prolactin, trypsinogen II, gastrin-releasing peptide II, atrial natriuretic peptide, secretory alkaline phosphatase, pancreatic alpha-amylase, secretogranin I, beta-casein, serum transferrin, tissue factor pathway inhibitor, follicle-stimulating hormone beta chain, coagulation factor XII, growth hormone-releasing factor, prostatic seminal protein, interleukins (e.g., 2, 3, 4, 5, 9, 11), inhibins (e.g., alpha chain), angiotensinogen, thyroglobulin, IG heavy or light chain, plasminogen activator inhibitor-1, lysozyme C, plasminogen activator, antileukoproteinase 1, statherin, fibulin-1, isoform B, uromodulin, thyroxine-binding globulin, axonin-1, endometrial alpha-2 globulin, interferons (e.g., alpha , β, γ), β-2-microglobulin, procholecystokinin, progastricsin, prostatic acid phosphatase, bone sialoprotein II, colipase, Alzheimer's amyloid protein A4, PDGF (e.g., A or B chain), coagulation factor V, triglyceride lipase, haptoglobin 2, corticosteroid-binding globulin, triglyceride lipase, prorelaxin H2, follistatin 1 and 2, platelet glycoprotein IX, GCSF, VEGF, heparin cofactor II, antithrombin III, leukemia inhibitory factor, interstitial collagenase, pleiotrophin, small inducible cytokine A1, melanin-concentrating hormone, angiotensin-converting enzyme, trypsin inhibitor, coagulation factor VIII, alpha-fetoprotein, alpha-lactalbumin, senogelin II, kappa casein, glucagon, thyrotropin beta chain, transcobalamin II, thrombospondin 1, parathyroid hormone, vasopressin, copeptin, tissue factor, motilin, MPIF-1, kininogen, neuroendocrine converting enzyme 2, stem cell factor procollagen alpha 1 chain, plasma kallikrein, keratinocyte growth factor, and any other secreted hormones, growth factors, cytokines, enzymes, coagulation factors, milk proteins, immunoglobulin chains, etc.

[0198] In one embodiment, the secretory signal peptide is not the secretory signal peptide of alpha-1-antitrypsin (e.g., amino acids 1-24 of alpha-1-antitrypsin), chymotrypsinogen B2 (e.g., amino acids 1-20 of chymotrypsinogen B2), iduronate-2-sulfatase (e.g., amino acids 1-25 of iduronate-2-sulfatase), or proteinase C1 inhibitor (e.g., amino acids 1-23 of proteinase C1 inhibitor).

[0199] In some embodiments, additional secretory signal peptides in the rAAV vectors disclosed herein and encoded by the rAAV genome can be selected from, but are not limited to, signal peptide sequences from: cathepsin proproenzyme L (e.g., GenBank Accession Nos. KHRTL, NP_037288, NP_034114, AAB81616, AAA39984, P07154, CAA68691; the disclosures of which are incorporated herein by reference in their entireties), and prepro-alpha-2 collagen (e.g., GenBank Accession Nos. CAA98969, CAA26320, CGHU2S, NP_000080, BAA25383, P08123; the disclosures of which are incorporated herein by reference in their entireties), and allelic variants, modifications, and functional fragments thereof (as discussed above for the fibronectin signal peptide sequence). For cathepsin proprozymogen L (Rattus norvegicus), an exemplary signal peptide sequence includes MTPLLLLAVLCLGTALA [SEQ ID NO: 77] (Accession No. CAA68691), and for prepro alpha type 2 collagen (Homo sapiens), an exemplary signal peptide sequence includes MLSFVDTRTLLLLAVTLCLATC [SEQ ID NO: 78] (Accession No. CAA98969). Also contemplated are longer amino acid sequences comprising the full-length signal peptide sequences from cathepsin proprozymogen L and prepro alpha type 2 collagen, or functional fragments thereof (as discussed above for the fibronectin signal peptide sequence).

[0200] In some embodiments, the signal peptide is partially or entirely derived from a secreted polypeptide produced by hepatocytes. In some embodiments, the signal peptide can further be wholly or partially synthetic or artificial. Synthetic or artificial secretory signal peptides are known in the art, see, for example, Barash et al., "Human signal peptide description by hidden Markov model and generation of a strong artificial signal peptide for secreted protein expression," Biochem. Biophys. Res. Comm. 294: 835-42 (2002); the disclosure of which is incorporated herein by reference in its entirety. In specific embodiments, the signal peptide comprises, consists essentially of, or consists of the following artificial secretory signal: MWWRLWWLLLLLLLLWPMVWA (SEQ ID NO: 65), or variants thereof having 1, 2, 3, 4, or 5 amino acid substitutions (optionally, conservative amino acid substitutions, which are known in the art).

[0201] Exemplary signal peptides for use in the methods and compositions disclosed herein can be selected from any of the signal peptides disclosed in Table 2, or portions thereof, or functional variants thereof. Exemplary signal peptides are fibronectin (FN1) or AAT. In some embodiments of the methods and compositions disclosed herein, the rAAV vector composition comprises a nucleic acid encoding a secretory signal peptide, such as a signal peptide selected from the group consisting of an AAT signal peptide (e.g., SEQ ID NO: 67), a fibronectin signal peptide (FN1) (e.g., SEQ ID NO: 68-SEQ ID NO: 71), a hIGF2 signal peptide (e.g., SEQ ID NO: 72), or active fragments thereof having secretory signal activity (e.g., a nucleic acid encoding an amino acid sequence having at least about 75%, or 80%, or 85%, or 90%, or 95%, or 98%, or 99% sequence identity to SEQ ID NO: 67-SEQ ID NO: 72).

[0202] In some embodiments of the methods and compositions disclosed herein, the nucleic acid encoding the signal peptide is selected from any one of SEQ ID NO: 54-SEQ ID NO: 58, SEQ ID NO: 67, SEQ ID NO: 72-SEQ ID NO: 76, and SEQ ID NO: 72, or a nucleic acid sequence having at least about 75%, or 80%, or 85%, or 90%, or 95%, or 98%, or 99% sequence identity to any one of SEQ ID NO: 54-SEQ ID NO: 58, SEQ ID NO: 67, SEQ ID NO: 72-SEQ ID NO: 76, and SEQ ID NO: 72.

[0203] Fibronectin secretion signal peptide:

[0204] In some embodiments, the signal peptide is a fibronectin secretory signal peptide or a portion thereof or a functional variant thereof, which term includes modifications of the naturally occurring sequence (as described in more detail below).

[0205] In some embodiments, the signal peptide is a fibronectin signal peptide, such as a signal sequence of human fibronectin or a signal sequence from rat fibronectin. Fibronectin (FN1) signal sequences and modified FN1 signal peptides encompassed for use in the rAAV genomes and rAAV vectors described herein are disclosed in U.S. Patent No. 7,071,172, which is incorporated herein by reference in its entirety; and disclosed in Table 3 of International Application No. WO2021102107 or Provisional Application No. 62 / 937,556 filed on November 19, 2019, which are incorporated herein by reference. Examples of exemplary fibronectin signal peptide sequences include, but are not limited to, those listed in Table 1 of U.S. Patent No. 7,071,172, which are incorporated herein by reference in their entirety.

[0206] Table 2: Exemplary fibronectin (FN1) secretion signal peptides

[0207] Peptidase cleavage site

[0208] In some embodiments, one or more exogenous peptidase cleavage sites can be inserted into the signal peptide-GAA polypeptide, for example, between the signal peptide and the GAA polypeptide. In a specific embodiment, an autoprotease (e.g., foot-and-mouth disease virus 2A autoprotease) is inserted between the signal peptide and the GAA polypeptide. In other embodiments, a protease recognition site (e.g., a Lys-Arg recognition site of trypsin, a Lys-Arg recognition site of Aspergillus KEX2-like protease, a recognition site of a metalloprotease, a recognition site of a serine protease, etc.) that can be controlled by adding an exogenous protease is used. Modification of the GAA polypeptide to delete or inactivate native protease sites is covered herein and disclosed in U.S. Provisional Application No. 62,937,556 and International Application No. WO2021102107, filed November 19, 2019, which are incorporated herein by reference. D. GAA polypeptide spacer and fusion junction

[0209] When GAA is expressed with a heterologous signal peptide, the signal peptide can be fused directly to the GAA polypeptide or can be separated from the GAA polypeptide by a linker. An amino acid linker (also referred to herein as a "spacer") incorporates one or more amino acids that differ from those found at that position in the native protein. Spacers can generally be designed to be flexible or to insert a structure, such as an α-helix, between two protein moieties.

[0210] Thus, in some embodiments of the methods and compositions disclosed herein, the recombinant AAV vector comprises a heterologous nucleic acid sequence encoding a GAA polypeptide, wherein the GAA protein further comprises a spacer region comprising a nucleotide sequence of at least 1 amino acid in length, which is located at the N-terminus of the GAA polypeptide.

[0211] In one embodiment, the spacer is at least 50% identical to the sequence GGGTVGDDDDK.

[0212] In some embodiments, the spacer or linker can be relatively short, for example, at least 1, 2, 3, 4, or 5 amino acids, or such as the sequence Gly-Ala-Pro or Gly-Gly-Gly-Gly-Gly-Pro; or can be longer, for example, 5-10 amino acids in length or 10-25 amino acids in length. For example, flexible repeat linkers with 3-4 copies of a sequence such as GGGGS and α-helical repeat linkers with 2-5 copies of a sequence such as EAAAK have been described (Arai et al., (2004) Proteins: Structure, Function and Bioinformatics 57: 829-838). In some embodiments, linkers comprising GGGTVGDDDDK are also contemplated for use. Linkers incorporating the α-helical portion of human serum albumin can be used to minimize the immunogenicity of the linker region. In some embodiments, the spacer is encoded by the nucleic acid GGCGCGCCG, which encodes an amino acid spacer comprising the amino acids GAP or Gly-Ala-Pro.

[0213] The site of the fusion junction where the GAA polypeptide is fused to the signal peptide should be carefully selected to promote proper folding and activity of each polypeptide in the fusion protein and to prevent premature separation of the signal peptide from the GAA polypeptide.

[0214] In some embodiments, the spacer has a helical structure. In another specific embodiment, the spacer is at least 50% identical to the sequence GGGTVGDDDDK.

[0215] In some embodiments, a signal peptide can be fused directly or through a spacer to the amino acids of a GAA polypeptide disclosed in Table 1 herein, allowing expression of the GAA polypeptide or an N-terminally truncated GAA polypeptide and, as described in the Examples herein, proper secretion of the GAA polypeptide.

[0216] To facilitate signal peptide folding, the GAA amino acid residue adjacent to the fusion junction can be modified. For example, because GAA cysteine ​​residues may interfere with proper signal peptide folding, the cysteine ​​at position 952 of the terminal GAA can be deleted or replaced with a serine to accommodate a C-terminal signal peptide. The signal peptide can also be fused immediately before the final Cys952. In conjunction with the final Cys952 mutation to serine, the penultimate Cys938 can be changed to a proline. F. Liver-specific promoter (LSP)

[0217] In some embodiments, to achieve appropriate levels of GAA expression, the rAAV genotype comprises a liver-specific promoter (LSP). The LSP enables expression of operably linked genes in the liver and, in some embodiments, can be an inducible LSP. In one embodiment, the LSP is located 5' upstream and operably linked to a heterologous nucleic acid sequence encoding a GAA protein.

[0218] Exemplary liver-specific promoters that can be used in AAV to treat Pompe disease according to the methods disclosed herein are disclosed in International Nos. WO2020102645 and WO2021102107, which are incorporated herein by reference in their entireties.

[0219] In some embodiments, encompassed herein are any of the liver-specific promoters disclosed in WO2020102645 and WO2021102107, wherein the LSP has been improved. For example, a liver-specific promoter useful in the rAAV vectors disclosed herein is any of the LSPs disclosed in International WO2020102645 and WO2021102107, wherein the LSP has been modified to replace the SEQ ID NO: 450 sequence (corresponding to SEQ ID NO: 126 or referred to as CRE0052 or LVR_CRE_0052_G6PC sequence in WO2021102107) in any of the LSP sequences in WO2021102107 with a sequence selected from SEQ ID NO: 40 or SEQ ID NO: 41, or a sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto. The SP131A1 (or LVR131_A1) promoter is used as an exemplary promoter, which is disclosed as SEQ ID NO: 94 in WO2021102107. In the present application, the promoter has been modified as follows: SEQ ID NO: 450 (corresponding to SEQ ID NO: 126 in WO2021102107) is replaced with SEQ ID NO: 40 or SEQ ID NO: 41, or a sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto. Any promoter disclosed in WO2021102107 is encompassed for use herein, wherein if the promoter comprises SEQ ID NO 450 (corresponding to SEQ ID NO: 126 in WO2021102107), it may be replaced with SEQ ID NO: 40 or SEQ ID NO: 41, or a sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto.

[0220] In some embodiments, the promoter is the LP1 promoter (SEQ ID NO: 432), or a variant thereof having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% nucleotide sequence identity thereto.

[0221] In some embodiments of the method for treating Pompe disease as disclosed herein, the synthetic liver-specific promoter that can be used in the AAV vector is any one of the following LSP promoters: SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 91 to SEQ ID NO: 96, SEQ ID NO: 146 to SEQ ID NO: 150, SEQ ID NO: 439 to SEQ ID NO: 441 as disclosed herein; or any one of SEQ ID NO: 270 to SEQ ID NO: 341 or SEQ ID NO: 342 to SEQ ID NO: 430 as disclosed herein; or a synthetic liver-specific promoter that can promote liver-specific transgene expression and has activity in hepatocytes, the activity being the LSP promoter comprising SEQ ID NO: 146 to SEQ ID NO: 150, SEQ ID NO: 439 to SEQ ID NO: 441 disclosed herein. NO: 431, or a synthetic promoter disclosed in Table 4 of International Application No. WO2021102107, which is incorporated herein by reference in its entirety.

[0222] In some embodiments, the synthetic liver-specific promoter is selected from any one of the following: SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 91 to SEQ ID NO: 96, SEQ ID NO: 146 to SEQ ID NO: 150, or SEQ ID NO: 270 to SEQ ID NO: 430 as disclosed herein, or a nucleic acid sequence that is at least 80%, or at least 90% or 95% identical thereto or to a source regulatory nucleic acid sequence.

[0223] In some embodiments, the liver-specific promoter (LSP) in the AAV expressing the GAA polypeptide as disclosed herein and useful in the method for treating Pompe disease as disclosed herein comprises a nucleic acid sequence selected from any of the following promoters: SEQ ID NO: 86 (CRM 0412), SEQ ID NO: 91 (SP0412) or SEQ ID NO: 92 (SP0422), SEQ ID NO: 93 (SP0239), SEQ ID NO: 94 (SP0265), SEQ ID NO: 95 (SP0240) or SEQ ID NO: 96 (SP0246), or SEQ ID NO: 146 (SP0265-UTR), SEQ ID NO: 147 (SP0239-UTR), SEQ ID NO: 148 (SP0240-UTR), SEQ ID NO: 149 (SP0246-UTR) or SEQ ID NO: 150 (SP0131-A1-UTR), SEQ ID NO: 151 (SP0131-A1-UTR), SEQ ID NO: 152 (SP0131-A1-UTR), SEQ ID NO: 153 (SP0131-A1-UTR), SEQ ID NO: 154 (SP0131-A1-UTR), SEQ ID NO: 155 (SP0131-A1-UTR), SEQ ID NO: 156 (SP0131-A1-UTR), SEQ ID NO: 157 (SP0131-A1-UTR), SEQ ID NO: 158 (SP0131-A1-UTR), SEQ ID NO: 159 (SP0131-A1-UTR), SEQ ID NO: 160 (SP0131-A1-UTR), SEQ ID NO: 161 (SP0131-A1-UTR), SEQ ID NO: 1 NO: 439 (LVR_0243), SEQ ID NO: 440 (LVR_0412) and SEQ ID NO: 441 (A1 promoter), or a functional fragment or variant of any LSP selected from SEQ ID NO: 270 to SEQ ID NO: 341 or SEQ ID NO: 342 to SEQ ID NO: 430, or a functional fragment or variant thereof of SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 91 to SEQ ID NO: 96 or SEQ ID NO: 146 to SEQ ID NO: 150, SEQ ID NO: 439 to SEQ ID NO: 441 or SEQ ID NO: 270 to SEQ ID NO: 430.

[0224] In some embodiments of the methods of treating Pompe disease disclosed herein, the synthetic liver-specific promoter is selected from any or any LSP promoter selected from SEQ ID NO: 86 (CRM 0412), SEQ ID NO: 91 (SP0412) or SEQ ID NO: 92 (SP0422), SEQ ID NO: 93 (SP0239), SEQ ID NO: 94 (SP0265), SEQ ID NO: 95 (SP0240) or SEQ ID NO: 96 (SP0246), or SEQ ID NO: 146 (SP0265-UTR), SEQ ID NO: 147 (SP0239-UTR), SEQ ID NO: 148 (SP0240-UTR), SEQ ID NO: 149 (SP0246-UTR) or SEQ ID NO: 150 (SP0131-A1-UTR), SEQ ID NO: 439 (LVR_0243), SEQ ID NO: 440 (SP0247), SEQ ID NO: 441 (SP0248), SEQ ID NO: 452 (SP0249), SEQ ID NO: 463 (SP0250), SEQ ID NO: 464 (SP0251), SEQ ID NO: 465 (SP0252-UTR), SEQ ID NO: 466 (SP0253), SEQ ID NO: 467 (SP0254-UTR), SEQ ID NO: 468 (SP0255-UTR), SEQ ID NO: 469 (SP0266-UTR), SEQ ID NO: 470 (SP0267-UTR), SEQ ID NO: 471 (SP0268-UTR), SEQ ID NO: 472 (SP0269-UTR), SEQ ID NO: 473 (SP0269-UTR), NO: 440 (LVR_0412) and SEQ ID NO: 441 (A1 promoter), or any LSP selected from SEQ ID NO: 270 to SEQ ID NO: 341 or SEQ ID NO: 342 to SEQ ID NO: 430 as disclosed herein, wherein the synthetic liver-specific promoter is capable of promoting liver-specific transgene expression and has activity in hepatocytes, and the activity is at least 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 125%, 150%, 175%, 200%, 250%, 300%, 350% or 400% of the activity of the TBG promoter of SEQ ID NO: 435.

[0225] In some embodiments of the methods for treating Pompe disease disclosed herein, the synthetic liver-specific promoter is selected from any or any LSP promoter selected from any one of SEQ ID NO: 97, SEQ ID NO: 98, or SEQ ID NO: 99, or a variant thereof having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% nucleotide sequence identity thereto. In some embodiments of the methods for treating Pompe disease disclosed herein, the synthetic liver-specific promoter is selected from any or any LSP promoter selected from SEQ ID NO: 97, SEQ ID NO: 98, or SEQ ID NO: 99, or a variant thereof having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% nucleotide sequence identity thereto, wherein the synthetic liver-specific promoter is capable of promoting liver-specific transgene expression and has an activity in hepatocytes that is at least 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 125%, 150%, 175%, 200%, 250%, 300%, 350%, or 400% of the activity of the TBG promoter of SEQ ID NO: 435.

[0226] In some embodiments, to achieve appropriate levels of GAA expression, the rAAV genotype comprises a liver-specific promoter (LSP). The LSP enables expression of operably linked genes in the liver, and in some embodiments can be an inducible LSP. In one embodiment, the LSP is located 5' upstream and is operably linked to a heterologous nucleic acid sequence encoding a GAA protein. Exemplary liver-specific promoters are disclosed herein, and the exemplary liver-specific promoters include, for example, an M3 liver-specific promoter comprising the sequence of SEQ ID NO: 99, or a functional variant having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more of SEQ ID NO: 99.

[0227] In one embodiment, the hepatic promoter is a promoter that has some expression in the liver. In one embodiment, the promoter that has some expression in the liver is an M2 hepatic promoter comprising the sequence of SEQ ID NO: 98, or a functional variant having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more of SEQ ID NO: 98.

[0228] In some embodiments, the synthetic liver-specific promoter comprises SEQ ID NO: 99, or a nucleic acid sequence that is at least 50%, preferably 60%, 70%, 80%, 90%, or 95% identical to the source regulatory nucleic acid sequence. In some embodiments, the synthetic liver-specific promoter comprises SEQ ID NO: 99, or a nucleic acid sequence that is at least 80%, or at least 90%, or 95% identical to nucleotides 1-26 of SEQ ID NO: 99.

[0229] In some embodiments, a synthetic liver-specific promoter that is at least 50%, 60%, 70%, 80%, 90%, or 95% identical to SEQ ID NO: 99 comprises a nucleic acid sequence in which 2%, or 1%, or fewer, of the nucleotides of SEQ ID NO: 99 are altered. In some embodiments, a synthetic liver-specific promoter useful in the methods and compositions disclosed herein is the same length as SEQ ID NO: 99, is essentially unchanged, is longer than SEQ ID NO: 99 by 1, 2, 3, 4, 5, or 6 nucleotides, or is shorter than SEQ ID NO: 99 by 1, 2, 3, 4, 5, or 6 nucleotides. In some embodiments, no nucleotides are deleted when compared to SEQ ID NO: 99. In some embodiments, no nucleotides are inserted when compared to SEQ ID NO: 99. In some embodiments, all modifications made to SEQ ID NO: 99 are nucleotide substitutions.

[0230] In some embodiments, the synthetic liver-specific promoter that is at least 50%, 60%, 70%, 80%, 90% or 95% identical to SEQ ID NO: 99 comprises a source regulatory nucleic acid sequence that is active in liver and the second cell or tissue is muscle; or a source regulatory nucleic acid sequence that is active in liver and the second cell or tissue is CNS; or a source regulatory nucleic acid sequence that is active in muscle and the second cell or tissue is liver; or a source regulatory nucleic acid sequence that is active in muscle and the second cell or tissue is CNS.

[0231] In some embodiments, a liver-specific promoter that is a functional variant of a given promoter element preferably retains at least 80% of its activity, more preferably retains at least 90% of its activity, more preferably retains at least 95% of its activity, and still more preferably retains 100% of its activity (compared to a reference promoter comprising an unmodified promoter element). Suitable assays for assessing liver-specific promoter activity are disclosed in Examples 12 and 13 of International Application WO2021102107, which are incorporated herein by reference in their entirety.

[0232] In some embodiments, liver-specific promoters include, but are not limited to, transthyretin promoter (TTR), LSP promoter (LSP), synthetic liver-specific promoters. For example, in some embodiments of the methods and compositions disclosed herein, the promoter is a liver-specific promoter (LSP) and can be selected from any liver-specific promoter, including but not limited to transthyretin promoter (TTR), liver-specific promoter (LSP) (e.g., disclosed in 5,863,541 (TTR promoter)), or LSP promoter (PNAS; 96: 3906-3910, 1999, see, e.g., page 3906, Materials and Methods, rAAV construction), synthetic liver promoters, the references of which are incorporated herein by reference in their entirety. Other liver promoters, such as synthetic liver promoters, can be used.

[0233] In some embodiments, the TTR promoter is a truncated TTR promoter, for example, comprising SEQ ID NO: 431 or SEQ ID NO: 12 disclosed in International WO2020102645 (incorporated herein by reference in its entirety), or a variant thereof having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% nucleotide sequence identity thereto. In some embodiments, the LSP is a TBG promoter, for example, comprising SEQ ID NO: 435 or a variant thereof having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% nucleotide sequence identity thereto.

[0234] Other liver-specific promoters include, but are not limited to, promoters for LDL receptor, factor VIII, factor IX, phenylalanine hydroxylase (PAH), ornithine transcarbamylase (OTC), and α1-antitrypsin (hAAT), as well as the HCB promoter. Other liver-specific promoters include AFP (alpha-fetoprotein) gene promoters and albumin gene promoters (as disclosed in EP Patent Publication 0 415731), α-1 antitrypsin gene promoters (as disclosed in Rettenger, Proc. Natl. Acad. Sci. 91 (1994) 1460-1464), fibrinogen gene promoters, APO-A1 (apolipoprotein A1) gene promoters, and promoters for liver transferases (e.g., SGOT, SGPT, and gamma-glutamyl transferase). See also 2001 / 0051611 and PCT patent publications WO 90 / 07936 and WO 91 / 02805, which are incorporated herein by reference in their entireties. In some embodiments, the liver-specific promoter is a recombinant liver-specific promoter, for example, as disclosed in US20170326256A1, which is incorporated herein by reference in its entirety.

[0235] In some embodiments, the liver-specific promoters are the hepatitis B X gene promoter and the hepatitis B core protein promoter. In some embodiments, the liver-specific promoters can be used with their respective enhancers. The enhancer element can be attached to the 5' or 3' end of the nucleic acid encoding the GAA polypeptide. The hepatitis B X gene promoter and its enhancer can be obtained from the viral genome as a 332 base pair EcoRV-NcoI DNA fragment using the method described in Twu, J Virol. 61 (1987) 3448-3453. The hepatitis B core protein promoter can be obtained from the viral genome as a 584 base pair BamHI-BglII DNA fragment using the method described in Gerlach, Virol 189 (1992) 59-66. Negative regulatory sequences may need to be removed from the BamHI-BglII fragment prior to insertion.

[0236] It is contemplated that the selection of a liver-specific promoter for expressing a GAA polypeptide is combined or coupled with the selection of a signal sequence. Specifically, without wishing to be bound by theory, if a strong liver-specific promoter is selected, a signal sequence should be selected that is sufficient to secrete the expressed GAA extracellularly to avoid intracellular accumulation of GAA and any associated cytotoxicity, and / or to avoid the production of anti-GAA antibodies.

[0237] It is contemplated that the LSP is selected in conjunction with the signal sequence so that the strength of the liver-specific promoter (LSP) operably linked to the nucleic acid encoding the GAA polypeptide can compete with the ability of the cell to secrete the expressed GAA protein. Therefore, if the liver-specific promoter is strong, the specific signal sequence must also be effective enough to allow the expressed GAA to be secreted from the cell so that the GAA does not accumulate and produce cytotoxicity and / or induce an immune response. Therefore, the cellular secretion pathway and the selected signal sequence must be able to match the level of GAA expressed by the AAV, where the level of GAA expression depends on the transduction efficiency of the AAV (determined by the AAV dose and capsid) and the strength of the liver-specific promoter. G. UTR, regulatory sequences, and intronic sequences

[0238] In some embodiments, the liver-specific promoter as described above is operably linked to one or more additional regulatory sequences. For example, the additional regulatory sequences can enhance expression compared to a liver-specific promoter that is not operably linked to additional regulatory sequences. Generally, it is preferred that the additional regulatory sequences do not substantially reduce the specificity of the liver-specific promoter.

[0239] For example, a liver-specific promoter can be operably linked to a sequence encoding UTR (e.g., 5′ and / or 3′UTR), introns, UTR (e.g., 5′ or 3′UTR) + introns, etc. In some embodiments, a liver-specific promoter is operably linked to a sequence encoding UTR (e.g., 5′UTR). 5′UTR may include a variety of elements that can regulate gene expression. The 5′UTR in a natural gene starts from the transcription start site and ends at one nucleotide before the start codon of the coding region. It should be noted that the 5′UTR referred to herein may be the entire naturally occurring 5′UTR, or it may be part of a naturally occurring 5′UTR. 5′UTR may also be partially or entirely synthetic. In eukaryotes, 5′UTR has a medium length of about 150nt, but in some cases, they can be significantly longer. The regulatory sequences that can be found in 5′UTR are disclosed in International Application WO2021102107, which is incorporated herein by reference in their entirety.

[0240] In some embodiments, the 5-UTR sequence is located 3' to a liver-specific promoter as disclosed herein and 5' to a heterologous nucleic acid sequence (eg, encoding a signal peptide and a GAA polypeptide).

[0241] In one embodiment, an exemplary 5-UTR sequence comprises, for example, a 24 bp sequence of SEQ ID NO: 41, or a functional variant having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more of SEQ ID NO: 41.

[0242] In one embodiment, the exemplary 5-UTR sequence comprising SEQ ID NO:41 is the sequence of SEQ ID NO:40, or a functional variant having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more of SEQ ID NO:40.

[0243] In some embodiments, the 5-UTR sequence comprises SEQ ID NO: 41 or SEQ ID NO: 40, or a nucleic acid sequence that is at least 50%, preferably 60%, 70%, 80%, 90%, or 95% identical to the source regulatory nucleic acid sequence. In some embodiments, the 5-UTR sequence comprises SEQ ID NO: 41 or SEQ ID NO: 40, or a nucleic acid sequence that is at least 80%, or at least 90%, or 95% identical to the nucleotides of SEQ ID NO: 41 or SEQ ID NO: 40.

[0244] In some embodiments, a 5-UTR that is at least 50%, 60%, 70%, 80%, 90%, or 95% identical to SEQ ID NO: 41 or SEQ ID NO: 40 comprises a nucleic acid sequence in which 2%, or 1%, or fewer, of the nucleotides in SEQ ID NO: 41 or SEQ ID NO: 40 are altered. In some embodiments, a 5-UTR sequence useful in the methods and compositions disclosed herein is the same length as SEQ ID NO: 41 or SEQ ID NO: 40, is essentially unchanged, is longer than the length of SEQ ID NO: 41 or SEQ ID NO: 40 by 1, 2, 3, 4, 5, or 6 nucleotides, or is shorter than the length of SEQ ID NO: 41 or SEQ ID NO: 40 by 1, 2, 3, 4, 5, or 6 nucleotides.

[0245] Introns in 5'UTR are connected to regulate gene expression and mRNA output. In some embodiments, the liver-specific promoter as described above is operably connected to the sequence of the 5'UTR encoding the gene derived from CMV major immediate (immediate) gene (CMV-IE gene). For example, the 5'UTR from the CMV-IE gene suitably includes CMV-IE gene exon 1 and CMV-IE gene exon 1 or part thereof. In some cases, considering the connection with 5'UTR, the promoter element can be modified, for example, the sequence downstream of the transcription start site (TSS) in the promoter element can be removed (for example, replaced with 5'UTR).

[0246] The CMV-IE 5′UTR is described in Simari et al., Molecular Medicine 4: 700-706, 1998 “Requirements for Enhanced Transgene Expression by Untranslated Sequences from the Human Cytomegalovirus Immediate-Early Gene”, which is incorporated herein by reference. Variants of the CMV-IE 5′UTR sequence discussed in Simari et al. are also described in WO2002 / 031137 (incorporated by reference), and the regulatory sequences disclosed therein may also be used. Other UTRs that can be used in combination with promoters are known in the art, for example, in Leppek, K., Das, R. & Barna, M. “Functional 5′UTR mRNA structures in eukaryotic translation regulation and how to find them”. Nat Rev Mol Cell Biol 19, 158-174 (2018), which is incorporated by reference.

[0247] In some embodiments, the sequence encoding the 5'UTR comprises SEQ ID NO: 145 as disclosed herein, or a functional variant thereof. In some embodiments, the functional variant may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical thereto. SEQ ID NO: 145 as disclosed herein encodes the CMV-IE 5'UTR.

[0248] In some embodiments, the sequence encoding the 5'UTR comprises SEQ ID NO: 446 as disclosed herein, or a functional variant thereof. In some embodiments, the functional variant may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto. SEQ ID NO: 446, as disclosed herein, is a modified CMV-IE intron sequence.

[0249] In some embodiments, the 5'UTR comprises a nucleic acid motif that functions as a protein translation start site (e.g., a sequence that defines a Kozak sequence in the produced mRNA). For example, in some embodiments, the sequence encoding the 5'UTR comprises the sequence motif GCCACC at or near its 3' end. Other Kozak sequences or other protein translation initiation sites known in the art may be used (e.g., Marilyn Kozak, "Point Mutations Define a Sequence Flanking the AUG Initiator Codon That Modulates Translation by Eukaryotic Ribosomes" Cell, Vol. 44, 283-292, January 31, 1986; Marilyn Kozak, "At Least Six Nucleotides Preceding the AUG Initiator Codon Enhance Translation in Mammalian Cells" J. Mol. Rid. (1987) 196. 947-950; Marilyn Kozak, "An analysis of 5'-noncoding sequences from 699vertebrate messenger RNAs" Nucleic Acids Research. Vol. 15 (20) 1987, all of which are incorporated herein by reference in their entirety). The protein translation initiation site (e.g., Kozak sequence) is preferably positioned proximal to the start codon.

[0250] In some embodiments, the sequence encoding the 5'UTR comprises SEQ ID NO: 438 or a functional variant thereof as disclosed herein. In some embodiments, the functional variant may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical thereto. The 5'UTR comprises six nucleotides, GCCACC, which define a Kozak sequence located at the 3' end of the CMV-IE 5'UTR.

[0251] In some embodiments, the rAAV expressing GAA used in the methods of treating Pompe disease as disclosed herein comprises an intron sequence located 3' to the promoter sequence and 5' to the heterologous nucleic acid (i.e., 5' to the nucleic acid encoding the signal peptide and GAA polypeptide). The intron sequence serves to enhance one or more of: mRNA stability, mRNA transport out of the nucleus, and / or expression and / or regulation of the expressed GAA polypeptide. In alternative embodiments, the rAAV genotype does not comprise an intron sequence.

[0252] In one embodiment, the UTR sequences described herein can be used as the 3' UTR.

[0253] According to the present invention, the synthetic liver-specific promoter can be operably linked to a sequence encoding UTR (e.g., 5' and / or 3' UTR) and / or introns, etc. In some embodiments, the synthetic liver-specific promoter as described herein is operably linked to a sequence encoding 5' UTR and introns. In some embodiments, the 5' UTR and introns are derived from the CMV major immediate gene (CMV-IE gene). CMV-IE 5' UTR and introns are described as follows: Simari et al., Molecular Medicine 4: 700-706, 1998 "Requirements for Enhanced Transgene Expression by Untranslated Sequences from the Human Cytomegalovirus Immediate-Early Gene", which is incorporated herein by reference. Variants of the CMV-IE 5' UTR and intron sequences discussed in Simari et al. are also described in WO2002 / 031137 (incorporated by reference), and the regulatory sequences disclosed therein can also be used. In some embodiments, the 5'UTR or the 5'UTR and introns suitably comprise a nucleic acid motif that functions as a protein translation initiation site (e.g., a sequence that defines a Kozak sequence in the resulting mRNA). For example, in some embodiments, the sequence encoding the 5'UTR comprises the sequence motif GCCACC at or near its 3' end.Other Kozak sequences or other protein translation initiation sites known in the art may be used (e.g., Marilyn Kozak, "Point Mutations Define a Sequence Flanking the AUG Initiator Codon That Modulates Translation by Eukaryotic Ribosomes" Cell, Vol. 44, 283-292, January 31, 1986; Marilyn Kozak, "At Least Six Nucleotides Preceding the AUG Initiator Codon Enhance Translation in Mammalian Cells" J. Mol. Rid. (1987) 196, 947-950; Marilyn Kozak, "An analysis of 5'-noncoding sequences from 699 vertical messenger RNAs" Nucleic Acids Research. Vol. 15 (20) 1987, all of which are incorporated herein by reference in their entirety). The protein translation initiation site (e.g., Kozak sequence) is preferably positioned immediately adjacent to the start codon.

[0254] In some embodiments, any of the promoters described herein or variants thereof are linked to sequences encoding a 5'UTR and / or a 5'UTR and an intron to provide a composite promoter. Such composite promoters may be referred to herein as simply "composite promoters" or, in some cases, simply as "promoters" for brevity.

[0255] In some embodiments, the intron sequence is an MVM intron sequence, such as, but not limited to, the intron sequence of SEQ ID NO: 442, or a nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto.

[0256] In some embodiments, the intron sequence is an HBB2 intron sequence, such as, but not limited to, the intron sequence of SEQ ID NO: 443 or SEQ ID NO: 444, or a nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto.

[0257] In some embodiments of the methods and compositions disclosed herein, the recombinant AAV vector comprises a heterologous nucleic acid sequence further comprising an intron sequence located 5' to the sequence encoding the secretory signal peptide and 3' to the promoter. In some embodiments, the intron sequence comprises an MVM sequence or an HBB2 sequence, wherein the MVM sequence comprises the nucleic acid sequence of SEQ ID NO: 442, or a nucleic acid sequence having at least about 75%, or 80%, or 85%, or 90%, or 95%, or 98%, or 99% sequence identity to SEQ ID NO: 442, and the HBB2 sequence comprises the nucleic acid sequence of SEQ ID NO: 443 or SEQ ID NO: 444, or a nucleic acid sequence having at least about 75%, or 80%, or 85%, or 90%, or 95%, or 98%, or 99% sequence identity to SEQ ID NO: 443 or SEQ ID NO: 444.

[0258] In some embodiments, the intron sequence is a ubiquitin C (UBC) intron sequence (e.g., intron 1 from the UBC gene) or a portion thereof (e.g., as disclosed in Bianchi et al., 2009, Gene, 448(1); 88-101), wherein the intron 1 sequence of the UBC gene is 812 bp and starts at chromosomal position 124,914,586 and ends at 124,913,775. In some embodiments, the intron sequence is a UBC intron, such as, but not limited to, the intron sequence of SEQ ID NO: 445, or a nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% nucleotide sequence identity to SEQ ID NO: 445.

[0259] In some embodiments, the rAAV genotype comprises an intron sequence selected from the group consisting of: a human β-globin b2 (or HBB2) intron, a FIX intron, a chicken β-globin intron, a CMVIE intron, a UBC intron, an HBB intron sequence, an MVM sequence, and an SV40 intron. In some embodiments, the intron is intron 1 from human RNA pol II. In some embodiments, the intron is optionally a modified intron, such as a modified HBB2 intron (see, e.g., SEQ ID NO: 17 in WO2018046774A1), a modified FIX intron (see, e.g., SEQ ID NO: 19 in WO2018046774A1), or a modified chicken β-globin intron (see, e.g., SEQ ID NO: 21 in WO2018046774A1), or a modified HBB2 or FIX intron disclosed in WO2015 / 162302, which are herein incorporated by reference in their entireties. H.Poly-A sequence and terminator sequence

[0260] In some embodiments, the rAAV vector genome comprises at least one poly-A tail located 3′ downstream of the heterologous nucleic acid gene encoding the GAA polypeptide. Any polyA sequence can be used, including but not limited to hGH poly A, BGH poly A, SV40 poly A, synpA poly A, etc. In some embodiments, the poly A is a synthetic poly A sequence. In some embodiments, the rAAV vector genome comprises two poly-A tails, such as an hGH poly A sequence and another poly A sequence, wherein a spacer nucleic acid sequence is located between the two poly A sequences.

[0261] In some embodiments, the polyA signal is located 3' to the heterologous nucleic acid sequence encoding the GAA polypeptide. In some embodiments, the rAAV genome comprises 3' to the nucleic acid encoding the GAA polypeptide, a first polyA sequence and a reverse RNA polymerase II terminator sequence (rev RNA PolII terminator sequence), and a 3' ITR. Non-limiting examples of the first poly A sequence are hGH poly A, BGH poly A, SV40 poly A, or any functional fragment thereof in the 5' to 3' direction. Non-limiting examples of the reverse RNA polymerase II terminator sequence are hGH poly A, BGH poly A, SV40 poly A, or any functional fragment thereof in the 3' to 5' direction.

[0262] In some embodiments, the rAAV genome comprises 3′ to the nucleic acid encoding the GAA polypeptide, a first poly A sequence, a spacer nucleic acid sequence (e.g., between 100-400 bp, or about 100-250 bp, or about 250-400 bp), a second poly A sequence, a spacer nucleic acid sequence, and a 3′ ITR.

[0263] In some embodiments, the first and / or second poly A sequence is an hGH poly A sequence, and in some embodiments, the first and second poly A sequences are synthetic poly A sequences. In some embodiments, the first poly A sequence is an hGH poly A sequence and the second poly A sequence is a synthetic sequence, or vice versa—that is, in alternative embodiments, the first poly A sequence is a synthetic poly A sequence and the second poly A sequence is an hGH poly A sequence.

[0264] In some embodiments, the polyA sequence is selected from any one of the following: SEQ ID NO: 42, SEQ ID NO: 43 or SEQ ID NO: 44, wherein SEQ ID NO: 44 comprises the signal AATAAA or a poly A nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity to any one of SEQ ID NO: 42, SEQ ID NO: 43 or SEQ ID NO: 44.

[0265] In some embodiments, the polyA sequence is selected from any one of the following: SEQ ID NO: 46 or SEQ ID NO: 47, or a polyA nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity to any one of SEQ ID NO: 46 or SEQ ID NO: 47.

[0266] In some embodiments, the poly A sequence is, for example, SEQ ID NO: 15 (hGH poly A sequence) disclosed in International WO2021102107, or a poly A nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity to SEQ ID NO: 15 disclosed in International Application WO2021102107. In some embodiments, the hGH poly sequence contemplated for use is described in Anderson et al., J. Biol. Chem 264 (14); 8222-8229, 1989 (see, e.g., page 8223, column 2, paragraph 1), which is incorporated herein by reference in its entirety.

[0267] In one embodiment, the recombinant AAV disclosed herein comprises a transcription terminator signal sequence or a transcription pause signal sequence in its genome in a reverse orientation between poly A and 3'ITR. In one embodiment, the recombinant AAV disclosed herein comprises a transcription terminator signal sequence or a transcription pause signal sequence in its genome, and the transcription terminator signal sequence or the transcription pause signal sequence is located between poly A and 3'ITR in a 3' to 5' direction. Any transcription termination signal can be used, including, for example, a reverse natural poly A sequence or a synthetic poly A signal from any species, or a fragment thereof, or other nucleic acid structure terminators known in the art. Exemplary poly A signals and / or transcription terminators include, but are not limited to, poly A signals of BGH, SV40, HGH, beta globin, RNA polymerase II transcription pause signal from the α2 globin gene, transcription termination signal of pol III, or a fragment thereof and any combination thereof.

[0268] In some embodiments, the transcription terminator signal sequence is a reverse RNA polymerase II terminator sequence, which, in a 5′ to 3′ orientation, is SEQ ID NO: 45, or a rev RNA Pol II terminator sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% nucleotide sequence identity to any one of SEQ ID NO: 45, wherein SEQ ID NO: 45, oriented in a 5′ to 3′ orientation, is located between 3′ of the poly A sequence and 5′ of the right ITR sequence (or 3′ ITR).

[0269] As described herein, the transcription terminator signal or reverse RNA polymerase II terminator sequence is also interchangeably referred to as "reverse poly A", which refers to a polyA signal sequence located downstream of the nucleic acid encoding GAA and upstream of the 3' ITR in a 3' to 5' direction. Any natural or synthetic poly A in a 3' to 5' direction can be used as a reverse poly A. In some embodiments, the reverse poly A is a poly A (pA) described in International Publication No. WO2019143950 and U.S. Application Publication No. US20200340013, which are incorporated herein by reference in their entirety.

[0270] For the sake of clarity, "reverse poly A," "double-stranded RNA termination element," and "reverse RNA polymerase II terminator sequence" are used interchangeably herein. In the 3' to 5' direction, the reverse poly A or termination element does not allow transcription from the 3' ITR, and thus double-stranded RNA is not transcribed from the 3' ITR. The reverse poly A or double-stranded RNA termination element can be heterologous, for example, from a different gene (e.g., different from the gene of interest), or homologous (e.g., the same gene as the gene of interest). In various embodiments, the poly A signal comprises a double-stranded RNA transcription element or reverse poly A. For example, the poly A signal of various aspects of the invention described herein comprises a full-length poly A signal in the 5' to 3' direction and another poly A signal in the 3' to 5' direction. In some embodiments, the 5' end of the double-stranded RNA termination element or inverted poly A sequence and the 3' end of the poly A signal are immediately adjacent to each other, or are separated by at least 1 nucleotide, or are separated by at least 2 nucleotides, or are separated by at least 3 nucleotides, or are separated by at least 4 nucleotides, or are separated by at least 5 nucleotides, or are separated by at least 6 nucleotides, or are separated by at least 7 nucleotides, or are separated by at least 8 nucleotides, or are separated by at least 9 nucleotides, or are separated by at least 10 nucleotides, or are separated by more. In some embodiments, the poly A signal does not comprise a double-stranded RNA transcription element or an inverted poly A. In some embodiments, the poly A signal comprises AATAAA (SEQ ID NO: 467) or AAUAAA (SEQ ID NO: 468). In some embodiments, the poly A signal comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10 repeats or more of AATAAA (SEQ ID NO: 467) or AAUAAA (SEQ ID NO: 468). In some embodiments, the poly A signal comprises a transcription termination signal of Pol III as described in "Delineation of the Exact Transcription Termination Signal for Type 3 Polymerase III. Mol Ther Nucleic Acids. 2018 Mar 2; 10: 36-44" (incorporated herein by reference in its entirety). In some embodiments, the one or more transcription termination signals of Pol III are in the 3' to 5' direction. In some embodiments, the poly A signal comprises TTTT. In some embodiments, the poly A signal comprises AAAAAAA (SEQ ID NO: 469).The poly A sequence is as described in "Definition of an efficient synthetic poly(A) site" Genes Dev. 1989 Jul; 3(7): 1019-25. doi: 10.1101 / gad.3.7.1019.", which is incorporated herein by reference in its entirety. All of the above-mentioned poly A sequences and / or terminator sequences described herein can be used as reverse sequences, for example, in a 3' to 5' direction.

[0271] In some aspects of the invention described herein, the polyA sequence comprises a polyA sequence and a terminator sequence, for example, the polyA sequence comprises an hGH poly A sequence and a Pol III terminator sequence. In various aspects of the invention, the poly A sequence and the Pol III terminator sequence are interchangeably referred to as "poly A." In various aspects of the invention described herein, the poly A sequence further comprises an inverted RNA polymerase II terminator sequence, or an RNA polymerase II transcription pause signal sequence, or an inverted Poly A. Without limitation, an example of an inverted RNA polymerase II terminator sequence, or an RNA polymerase II transcription pause signal sequence, or an inverted Poly A is the 3' sequence of the human hemoglobin alpha gene.

[0272] In some embodiments, the poly-A tail can be engineered to stabilize RNA transcripts transcribed from the rAAV vector genome, including transcripts of heterologous genes, which in one embodiment are GAA; and in alternative embodiments, the poly-A tail can be engineered to contain destabilizing elements.

[0273] In one embodiment, the polyA is a bidirectional polyA sequence. Bidirectional polyA sequences are usually isolated from viral DNA, for example, SV40 polyA is a bidirectional polyA.

[0274] In some embodiments of the methods for treating Pompe disease disclosed herein, the recombinant AAV vector comprises at least one polyA sequence located 3' of the nucleic acid encoding the GAA gene and 5' of the 3' ITR sequence. In some embodiments, the polyA is a full-length polyA (fl-polyA) sequence. In some embodiments, the polyA is a truncated polyA sequence disclosed in WO2021102107, which is incorporated herein by reference in its entirety.

[0275] In embodiments, the poly-A tail can be engineered to become a destabilizing element by changing its length. In embodiments, the poly-A tail can be lengthened or shortened.

[0276] In some embodiments, there is a 3' untranslated region (3'UTR) located between the heterologous gene encoding the GAA polypeptide and the poly-A tail. In some embodiments, there is a 3'UTR located 3' to the nucleic acid sequence encoding the GAA polypeptide. In some embodiments, the 3' untranslated region (3'UTR) comprises the GAA 3'UTR (SEQ ID NO: 50) or 3'UTR (SEQ ID NO: 49) as disclosed herein.

[0277] In another embodiment, the promoter region, or 3'UTR or polyA region may contain a destabilizing element that is a target sequence for a microRNA (miRNA). When the miRNA binds to the miRNA target sequence, the miRNA has the ability to silence (repress translation and promote degradation) RNA transcripts. Therefore, in some embodiments, the addition or deletion of a seed region within the 3-UTR or polyA tail can increase or decrease protein expression, such as a GAA polypeptide. In some embodiments, the miRNA target region is a synthetic miRNA target region that is targeted by an artificial miRNA (amiRNA) according to methods known in the art.

[0278] In another embodiment, the seed region can also be engineered into the 3' untranslated region (3'UTR) between the heterologous gene and the poly-A tail. In a further embodiment, the destabilizing agent can be an siRNA. The coding region of the siRNA can be included in the rAAV vector genome and is generally located downstream (3' of the poly-A tail).

[0279] In all aspects of the methods for treating Pompe disease disclosed herein, the rAAV genome may also include a stuffer DNA nucleic acid sequence. An exemplary stuffer DNA sequence is SEQ ID NO: 71 disclosed in International Application WO2021102107, or a nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto. In some embodiments, the stuffer sequence is, for example, located 3′ of the poly-A tail and 5′ of the 3′ITR sequence. In some embodiments, the stuffer DNA sequence comprises a synthetic polyadenylation signal in a reverse orientation.

[0280] In some embodiments, a stuffer nucleic acid sequence (also referred to as a "spacer" nucleic acid fragment) can be located between the poly A sequence and the 3' ITR (i.e., the stuffer nucleic acid sequence is located 3' to the poly A sequence and 5' to the 3' ITR). Such a stuffer nucleic acid sequence can be approximately 30 bp, 50 bp, 75 bp, 100 bp, 150 bp, 200 bp, 250 bp, 300 bp, or longer than 300 bp. In some embodiments of the methods and compositions disclosed herein, the stuffer nucleic acid fragment is between 20-50 bp, 50-100 bp, 100-200 bp, 200-300 bp, 300-500 bp, or any integer between 20-500 bp. An exemplary filling region (or spacer) nucleic acid sequence can be selected from any one of the following: SEQ ID NO: 16, SEQ ID NO: 71 or SEQ ID NO: 78 disclosed in international application WO2021102107, or a nucleic acid sequence that is at least about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO: 16, SEQ ID NO: 71 or SEQ ID NO: 78 disclosed in international application WO2021102107. E.CS sequence

[0281] In some embodiments of the methods and compositions disclosed herein, the recombinant AAV vector comprises a heterologous nucleic acid sequence, which may further comprise a collagen stability (CS) sequence located 3' of the nucleic acid encoding the GAA polypeptide and 5' of the 3' ITR sequence. In some embodiments, the rAAV genome disclosed herein comprises a heterologous nucleic acid sequence, which may optionally comprise a collagen stability sequence (CS or CSS) located 3' of the nucleic acid encoding the GAA polypeptide and 5' of the nucleic acid encoding the polyA signal. In some embodiments, the CS sequence may be replaced with a 3' UTR sequence disclosed herein.

[0282] Exemplary collagen stabilizing sequences include CCCAGCCCACTTTTCCCCAA or a sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. Exemplary collagen stabilizing sequences can have the amino acid sequence of PSPLFP or an amino acid sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. The CS sequence is disclosed in Holick and Liebhaber, Proc. Nat. Acad. Sci. 94: 2410-2414, 1997 (see, e.g., FIG3 , p. 5205), which is incorporated herein by reference in its entirety. I.AAV ITR

[0283] The rAAV vectors or genomes as disclosed herein for use in methods of treating Pompe disease can comprise AAV ITRs with desired properties and can be designed to modulate the activity of and cellular responses to the vector incorporating the ITRs. In another embodiment, the AAV ITRs are synthetic AAV ITRs with desired properties and can be designed to manipulate the activity of and cellular responses to vectors comprising one or two synthetic ITRs, including as set forth in U.S. Patent No. 9,447,433, which is incorporated herein by reference.

[0284] In another embodiment, the ITR exhibits modified transcriptional activity relative to a naturally occurring ITR (e.g., ITR2 from AAV2). It is known that the ITR2 sequence inherently has promoter activity. It also inherently has termination activity similar to a poly(A) sequence. Although at a reduced level relative to ITR2, the minimal functional ITR of the present invention exhibits transcriptional activity as shown in the Examples. Thus, in some embodiments, the ITR has transcriptional function. In other embodiments, the ITR is defective for transcription. In some embodiments, the ITR can act as a transcription insulator, for example, preventing transcription of a transgene cassette present in the vector when the vector is integrated into a host chromosome.

[0285] One aspect of the invention relates to rAAV vector genomes comprising at least one synthetic AAV ITR, wherein the nucleotide sequence of one or more transcription factor binding sites in the ITR is deleted and / or replaced relative to the sequence of a naturally occurring AAV ITR (e.g., ITR2). In some embodiments, it is a minimal functional ITR in which one or more transcription factor binding sites are deleted and / or replaced. In some embodiments, at least one transcription factor binding site is deleted and / or replaced, for example, at least 5 or more or 10 or more transcription factor binding sites, for example, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 transcription factor binding sites.

[0286] In another embodiment, an rAAV vector comprising an rAAV vector genome as described herein comprises a polynucleotide comprising at least one synthetic AAV ITR, wherein one or more CpG islands (cytosine bases immediately following guanine bases (CpG), wherein the cytosines so arranged tend to be methylated) that typically appear at or near the transcription start site in the ITR are deleted and / or replaced. In an embodiment, the absence or reduction in the number of CpG islands can reduce the immunogenicity of the rAAV vector. This is due to reduced or complete inhibition of TLR-9 binding to rAAV vector DNA sequences (occurring at CpG islands). It is also well known that methylation of CpG motifs causes transcriptional silencing. It is expected that the removal of CpG motifs in ITRs will result in reduced TLR-9 recognition and / or reduced methylation, and thus reduced transgene silencing. In some embodiments, it is a minimal functional ITR in which one or more CpG islands are deleted and / or replaced. In an embodiment, it is known that AAVITR2 contains 16 CpG islands, one or more or all 16 of which can be deleted.

[0287] In some embodiments, at least one CpG motif is deleted and / or replaced, such as at least 4 or more or 8 or more CpG motifs, such as at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 CpG motifs.

[0288] In another embodiment, the synthetic ITR comprises, consists essentially of, or consists of one of the nucleotide sequences listed in Table 4. In other embodiments, the synthetic ITR comprises, consists essentially of, or consists of a nucleotide sequence that is at least 80% identical (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to any of the nucleotide sequences listed in Table 4. In some embodiments, the ITR is a sequence disclosed in Figure 1 of Samulski et al., 1983, Cell, 33; 135-143 (referred to as "Samulski et al., 1983," which is incorporated herein by reference in its entirety), which discloses modified ITR sequences in Figure 1. In some embodiments, the ITR sequence comprises or consists of a nucleotide sequence that is at least 80% identical (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to one of the ITR sequences in Figure 1 disclosed in Samulski et al., 1993. In some embodiments, the ITR comprises or consists of a nucleotide sequence that is at least 80% identical (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% or 99.5% identical) to the ITR sequence to the right of pSM609 (which lacks 9 bp) disclosed in the middle subgraph of Figure 1 disclosed in Samulski et al., 1983. In some embodiments, the ITR comprises a nucleotide sequence that is at least 80% identical (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% or 99.5% identical) to the ITR sequence of any one of SEQ ID NO: 79 to SEQ ID NO: 84 and SEQ ID NO: 450 to SEQ ID NO: 451.

[0289] In some embodiments, the ITR sequence (e.g., the right ITR (or 3' ITR)) is SEQ ID NO: 80 or SEQ ID NO: 82, or a nucleotide sequence that is at least 80% identical (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical) to SEQ ID NO: 80 or SEQ ID NO: 82. In some embodiments, the ITR sequence (e.g., the left ITR (or 5' ITR)) is SEQ ID NO: 79 or SEQ ID NO: 81, or a nucleotide sequence that is at least 80% identical (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical) to SEQ ID NO: 79 or SEQ ID NO: 81.

[0290] Table 4: Exemplary synthetic ITR sequences II. Vectors and Viral Particles

[0291] In one embodiment, the rAAV vector disclosed herein (also referred to as rAAV virions) comprises a capsid protein and an rAAV genome in the capsid protein. The rAAV capsid of the rAAV virion for treating Pompe disease is any one of the capsids listed in Table 3 herein, or any one of the capsids listed in Table 1 in International Applications WO2020 / 102645 and WO2020 / 102667 (each of which is incorporated herein by reference in its entirety). In one embodiment, the rAAV capsid of the rAAV virion for treating Pompe disease is an AAV8 capsid. In one embodiment, the rAAV vector is an rAAV8 vector.

[0292] Table 3: Table 3: AAV serotypes and exemplary published corresponding capsid sequences

[0293] In one embodiment, the AAV vectors disclosed herein (also referred to as rAAV virions) comprise a capsid protein from any of those disclosed in WO2019 / 241324 (incorporated herein by reference in its entirety). In some embodiments of the invention described herein, the rAAV vector comprises a liver-specific capsid, for example, selected from the liver-specific capsids of XL32 and XL32.1 disclosed in WO2019 / 241324 (incorporated herein by reference in its entirety). In some embodiments, the rAAV vector is AAVXL32 or AAVXL32.1 as disclosed in WO2019 / 241324 (incorporated herein by reference in its entirety).

[0294] Exemplary chimeric or variant capsid proteins that can be used as AAV capsids in the rAAV vectors described herein can be selected from Table 2 of U.S. Provisional Application No. 62,937,556, filed November 19, 2019 (specifically incorporated herein by reference), or can be used with any combination of wild-type capsid proteins and / or other chimeric or variant capsid proteins currently known or later identified, and each of which is incorporated herein. In some embodiments, the rAAV vectors contemplated for use are chimeric vectors, such as those disclosed in 9,012,224 and US 7,892,809, which are incorporated herein by reference in their entireties.

[0295] In some embodiments, the rAAV vector is a haploid rAAV vector as disclosed in U.S. applications US2018 / 0371496 and PCT / US18 / 22725, or a polyploid rAAV vector as disclosed in, for example, PCT / US2018 / 044632 and U.S. application Ser. No. 16 / 151,110, filed Jul. 31, 2018, each of which is incorporated herein by reference in its entirety. In some embodiments, the rAAV vector is an rAAV3 vector, as disclosed in 9,012,224 and WO2017 / 106236, each of which is incorporated herein by reference in its entirety.

[0296] In a specific embodiment, rAAV is an AAVXL32 or AAVXL32.1 AAV vector as disclosed in WO2019 / 241324 (incorporated herein by reference in its entirety). In some embodiments, the rAAV vector comprises a capsid disclosed in WO2019241324A1 or international patent application PCT / US2019 / 036676 (incorporated herein by reference in their entirety). In some embodiments, the AAV vector is an AAV8 vector or a reasonable haploid comprising an AAV8 capsid protein. In some embodiments, the recombinant AAV vector is a chimeric AAV vector, a haploid AAV vector, a hybrid AAV vector, or a polyploid AAV vector. In some embodiments, the recombinant AAV vector is a rational haploid vector, a mosaic AAV vector, a chemically modified AAV vector, or an AAV vector from any AAV serotype, such as any AAV serotype disclosed in Table 1 of International Applications WO2020 / 102645 and WO2020 / 102667, each of which is incorporated herein in its entirety.

[0297] In an embodiment, the rAAV vector used in the treatment of Pompe disease as disclosed herein is an AAV3b capsid. The AAV3b capsids encompassed for use are described in 2017 / 106236 and 9,012,224 and 7,892,809, and in International Application PCT / US19 / 61653 filed on November 15, 2019, and International Applications WO2020 / 102645 and WO2020 / 102667, each of which is incorporated herein in its entirety. In addition, the AAV3b capsids of the AAV vectors for use according to the methods disclosed herein are disclosed in International Patent Applications WO 2020 / 102645 and WO2021102107, which are incorporated herein by reference in their entirety.

[0298] In some embodiments, the AAV3b capsid comprises SEQ ID NO: 44 as disclosed in International Patent Applications WO2020 / 102645 and WO2021102107. In embodiments, the AAV capsid used in the treatment of Pompe disease can be a modified AAV capsid derived in whole or in part from the AAV capsid set forth in SEQ ID NO: 44. In some embodiments, amino acids from the AAV3b capsid set forth in SEQ ID NO: 44 can be amino acids from another capsid of a different AAV serotype, or replaced with amino acids from another capsid of a different AAV serotype, wherein the substituted and / or inserted amino acids can be from any AAV serotype and can include naturally occurring amino acids or partially or completely synthetic amino acids.

[0299] In another embodiment, the AAV capsid used in the treatment of Pompe disease is an AAV3b265D capsid. In this particular embodiment, the AAV3b265D capsid comprises a modification in the amino acid sequence of the two-fold axis loop of the AAV3b capsid by replacing amino acid G265 of the AAV3b capsid with D265. In some embodiments, the AAV3b265D capsid comprises SEQ ID NO: 46. However, the modified viral capsids of the present invention are not limited to the AAV capsid set forth in SEQ ID NO: 46 as set forth in international patent applications WO2020 / 102645 and WO2021102107. In some embodiments, the amino acids from AAV3b265D as set forth in SEQ ID NO: 46 can be amino acids from a capsid of an AAV of a different serotype, or replaced with amino acids from a capsid of an AAV of a different serotype, wherein the substituted and / or inserted amino acids can be from any AAV serotype and can include naturally occurring amino acids or partially or fully synthetic amino acids.

[0300] In another embodiment, the rAAV vector used in the treatment of Pompe disease as disclosed herein is an AAV3b265D549A capsid. In this particular embodiment, the AAV3b265D549A capsid comprises modifications in the amino acid sequence of the double-column of the AAV3b capsid by replacing amino acid G265 of the AAV3b capsid with D265 and amino acid T549 of the AAV3b capsid with A549. In some embodiments, the AAV3b265D549A capsid comprises SEQ ID NO: 50 as disclosed in international patent applications WO2020 / 102645 and WO2021102107. However, the modified viral capsids of the present invention are not limited to the AAV capsid set forth in SEQ ID NO: 50. In some embodiments, the amino acids from AAV3b265D549A as set forth in SEQ ID NO: 50 can be amino acids from a capsid of an AAV of a different serotype, or substituted with amino acids from a capsid of an AAV of a different serotype, wherein the substituted and / or inserted amino acids can be from any AAV serotype and can include naturally occurring amino acids or partially or completely synthetic amino acids. In some embodiments, the amino acids from AAV3bSASTG (i.e., an AAV3b capsid comprising the Q263A / T265 mutations) can be amino acids from a capsid of an AAV of a different serotype, or substituted with amino acids from a capsid of an AAV of a different serotype, wherein the substituted and / or inserted amino acids can be from any AAV serotype and can include naturally occurring amino acids or partially or completely synthetic amino acids.

[0301] In another embodiment, the rAAV vector used in the treatment of Pompe disease as disclosed herein is an AAV3b549A capsid. In this particular embodiment, the AAV3b549A capsid comprises a modification in the amino acid sequence of the double-column of the AAV3b capsid by replacing amino acid T549 of the AAV3b capsid with A549. In some embodiments, the AAV3b549A capsid comprises SEQ ID NO: 52 as disclosed in international patent applications WO 2020 / 102645 and WO2021102107. However, the modified viral capsids of the present invention are not limited to the AAV capsid set forth in SEQ ID NO: 52. In some embodiments, the amino acids from AAV3b549A as set forth in SEQ ID NO: 52 can be amino acids from a capsid of an AAV of a different serotype, or replaced with amino acids from a capsid of an AAV of a different serotype, wherein the substituted and / or inserted amino acids can be from any AAV serotype and can include naturally occurring amino acids or partially or fully synthetic amino acids.

[0302] In another embodiment, the rAAV vector used in the treatment of Pompe disease as disclosed herein is an AAV3bQ263Y capsid. In this specific embodiment, the AAV3bQ263Y capsid comprises a modification in the amino acid sequence of the double-column of the AAV3b capsid by replacing amino acid Q263 of the AAV3b capsid with Y263. In some embodiments, the AAV3b549A capsid comprises SEQ ID NO: 54 as disclosed in international patent applications WO 2020 / 102645 and WO2021102107. However, the modified viral capsids of the present invention are not limited to the AAV capsid set forth in SEQ ID NO: 54. In some embodiments, the amino acids from AAV3bQ263Y as set forth in SEQ ID NO: 54 can be amino acids from a capsid of an AAV of a different serotype, or replaced with amino acids from a capsid of an AAV of a different serotype, wherein the substituted and / or inserted amino acids can be from any AAV serotype and can include naturally occurring amino acids or partially or fully synthetic amino acids.

[0303] In another embodiment, the rAAV vector used in the treatment of Pompe disease as disclosed herein is of the AAV3bSASTG serotype or comprises an AAV3bSASTG capsid. In this specific embodiment, the AAV3b SASTG capsid comprises modifications in the amino acid sequence to comprise a SASTG mutation, in particular, the AAV3b capsid is modified to resemble the AAV2 Q263A / T265 subvariant (as disclosed in Messina EL et al., Adeno-associated viral vectors based on serotype 3b use components of the fibroblast growth factor receptor signaling complex for efficient transduction. Hum. Gene Ther. 2012 Oct: 23(10): 1031-4; Piacentino III, Valentino et al., "X-linked inhibitor of apoptosis protein-mediated attenuation of apoptosis. using a novel cardiac-enhanced adeno-associated viral vector." Human gene therapy 23.6(2012): 635-646, both of which are incorporated herein by reference in their entirety) by introducing these modifications at similar positions in the AAV3b capsid. Thus, in some embodiments, the rAAV vector used in the treatment of Pompe disease as disclosed herein is an AAV3bSASTG serotype or comprises an AAV3bSASTG capsid comprising an AAV3b Q263A / T265 capsid. In some embodiments, the amino acids from AAV3bSASTG can be amino acids from a capsid of an AAV of a different serotype, or replaced with amino acids from a capsid of an AAV of a different serotype, wherein the replaced and / or inserted amino acids can be from any AAV serotype and can include naturally occurring amino acids or partially or fully synthetic amino acids.

[0304] The desired tissue can be targeted using an appropriate capsid. For example, the central nervous system can be targeted using an AAV9 or rhesus capsid, or a reasonable haploid can be targeted using at least one of the AAV9 or rhesus viral proteins. Muscle can be targeted using myo AAV, see, for example, WO2019 / 2071323 and WO2022 / 020616, which are incorporated herein by reference in their entireties.

[0305] To facilitate its introduction into cells, the rAAV vector genome used in the present invention is a recombinant nucleic acid construct comprising: (1) a heterologous sequence to be expressed (in one embodiment, a polynucleotide encoding a GAA polypeptide), and (2) viral sequence elements that promote the integration and expression of the heterologous gene. The viral sequence elements may include those sequences of the cis-AAV vector genome required for DNA replication and packaging (e.g., functional ITRs) into the AAV capsid. In an embodiment, the heterologous gene encodes GAA, which is useful for correcting GAA deficiency in patients with Pompe disease. In an embodiment, such rAAV vector genomes may also comprise a marker or reporter gene. In an embodiment, the rAAV vector genome may have one or more AAV3b wild-type (WT) cis genes that are replaced or deleted in whole or in part, but retain functional flanking ITR sequences. III. Optimized rAAV Vector Genome

[0306] In some embodiments of the methods and compositions disclosed herein, the optimized rAAV vector genome is generated by any of the elements disclosed herein and in any combination, comprising a nucleic acid sequence encoding a promoter, ITR, poly-A tail, an element capable of increasing or decreasing heterologous gene expression, and in one embodiment, the nucleic acid sequence is codon-optimized for in vivo expression of GAA protein (i.e., wild-type GAA or codon-optimized GAA); and may optionally comprise one or more elements to reduce immunogenicity. Such optimized rAAV vector genomes can be used with any AAV capsid that is tropistic for the tissues and cells in which the rAAV vector genome is to be transduced and expressed.

[0307] In some embodiments, the rAAV genome lacks the AAV P5 promoter or a fragment thereof, which is typically located upstream of the liver-specific promoter disclosed herein. Typically, the P5 promoter controls the expression of the AAV rep / cap protein during AAV replication. In some embodiments, the P5 promoter fragment is present in an rAAV vector disclosed herein that contains predicted transcription factor binding sites, such as cyclic AMP-responsive element binding protein 3 (CREB3), which can be activated by endoplasmic reticulum (ER) / Golgi stress (Sampieri 2019), activating transcription factor 2 (ATF2), which is also involved in stress response (Watson 2017), and nuclear receptor subfamily 1 group 1 member 2 (NR1I2) (also known as pregnane X receptor [PXR]), which is known to be enriched in the liver and activated by pregnane steroids, rifampicin, and other molecules including dexamethasone (NR1I2_HGNC) (Xing 2020). Thus, in some embodiments, the AAV P5 promoter fragment is removed from the rAAV genome without affecting the desired performance of the GAA box. In some embodiments, the rAAV vector further comprises an RNA polymerase II termination sequence located between the polyA signal and the 3' ITR. Exemplary terminal sequences are SEQ ID NO: 45 or SEQ ID NO: 465, wherein the latter introduces two stop codons and a restriction site (e.g., XhoI) in place of TAG and is located immediately downstream of the last encoded amino acid of hGAA and immediately upstream of the 3' UTR. IV. Subjects Eligible for Treatment A. Pompe disease

[0308] As disclosed herein, recombinant AAV expressing GAA protein can be used in methods for treating Pompe disease. Pompe disease is a rare inherited disorder caused by a deficiency of an enzyme, acid alpha-glucosidase (GAA), which is necessary for the breakdown of glycogen, a storage form of sugar used for energy. Pompe disease is also known as glycogen storage disease type II, GSD II, glycogen storage disease type II, glycogen storage disease type II, acid maltase deficiency, alpha-1,4-glucosidase deficiency, glycogen diffuse cardiomegaly, and the cardiac form of systemic glycogenosis. The accumulation of glycogen leads to progressive muscle weakness (myopathy) throughout the body and affects various body tissues, particularly in the heart, skeletal muscle, liver, respiratory system, and nervous system.

[0309] Glycogen storage disease type II, also known as Pompe disease, is a rare metabolic disorder inherited in an autosomal recessive manner and caused by a deficiency of the lysosomal enzyme acid alpha-glucosidase (GAA). This disorder leads to the accumulation of lysosomal glycogen and the destruction of skeletal, smooth, and cardiac muscle. The severity of Pompe disease ranges from a severe infantile myopathy with severe hypotonia and hypertrophic cardiomyopathy (infantile-onset Pompe disease [IOPD]) to a late-onset myopathy (LOPD). The deficiency in GAA can range from complete to partial deficiency of GAA and correlates with clinical severity. LOPD manifests as proximal leg weakness and, in some cases, respiratory insufficiency without significant cardiac involvement but can progress to fatal respiratory failure.

[0310] Early-onset disease (or infantile-onset, IOPD) results from a complete or near-complete deficiency of GAA. Symptoms begin in the first few months of life and progress rapidly, with feeding difficulties, poor weight gain, muscle weakness, floppy feet, and head lag. Breathing difficulties often accompany lung infections. The heart is severely enlarged. Many infants with Pompe disease also have an enlarged tongue. Without Lumizyme treatment, most infants die before their first birthday from cardiac or respiratory complications.

[0311] Late-onset (or juvenile / adult-onset, LOPD) Pompe disease results from a partial deficiency of GAA. Its onset can occur as early as the first decade of childhood or as late as the sixth decade of adulthood and is therefore characterized by a slow progression. The primary symptom is proximal muscle weakness, which gradually progresses to respiratory muscle weakness, and death from respiratory failure occurs over a period of several years. The heart is usually spared.

[0312] The clinical manifestations of Pompe disease can vary greatly depending on the age of onset and the residual GAA activity. Residual GAA activity is related to the amount and tissue distribution of glycogen accumulation, as well as the severity of the disease. Infantile Pompe disease (less than 1% of normal GAA activity) is the most severe form and is characterized by hypotonia, generalized muscle weakness, and hypertrophic cardiomyopathy, as well as extensive glycogen accumulation in the heart and other muscle tissues. Death typically occurs within the first year of life due to cardiopulmonary failure. Juvenile-onset (1%-10% of normal GAA activity) and adult-onset (10%-40% of normal GAA activity) Pompe disease are more clinically heterogeneous, with greater variation in age of onset, clinical manifestations, and disease progression. Juvenile- and adult-onset Pompe disease are generally characterized by the absence of severe cardiac involvement, a later age of onset, and slower disease progression, but eventual respiratory or limb muscle involvement leads to significant morbidity and mortality. Although life expectancy may vary, death is usually due to respiratory failure.

[0313] In any embodiment of the methods disclosed herein, the GAA enzyme suitable for treating Pompe disease comprises wild-type human GAA, or a fragment or sequence variant thereof that retains the ability to cleave α1-4 bonds in linear oligosaccharides. In some embodiments of the methods and compositions disclosed herein, the GAA protein is encoded by a GAA nucleic acid sequence (e.g., SEQ ID NO: 1-SEQ ID NO: 18 disclosed herein, or an N-terminal truncation thereof as disclosed in Table 1 herein). In some embodiments of the methods and compositions disclosed herein, the GAA protein is encoded by a codon-optimized GAA nucleic acid sequence for any one or more of the following, e.g., (1) enhanced expression in vivo, (2) reduction of CpG islands, or (3) reduction of innate immune responses. In some embodiments of the methods and compositions disclosed herein, the GAA protein is encoded by a codon-optimized GAA nucleic acid sequence, e.g., any nucleic acid sequence selected from any one of SEQ ID NO: 1-SEQ ID NO: 18, or a nucleic acid sequence having at least 60%, or 70%, or 80%, 85%, or 90%, or 95%, or 98%, or 99% sequence identity to SEQ ID NO: 1-SEQ ID NO: 18, said nucleic acid sequence encoding a GAA polypeptide, wherein the amino acid at position 199 is R (199R), the amino acid at position 233 is H (233H), and the amino acid at position 780 is I (780I), compared to the wild-type GAA protein.

[0314] In some embodiments of the methods and compositions disclosed herein, the rAAV vectors described herein transduce the liver of a subject and secrete hGAA polypeptide into the blood perfusing the patient's tissues, where the hGAA polypeptide is taken up by cells and transported to lysosomes, where the GAA enzyme acts to eliminate substances that have accumulated in the lysosomes due to enzyme deficiency. In order for lysosomal enzyme replacement therapy to be effective, the therapeutic enzyme must be delivered to the lysosomes within the appropriate cells of the tissue that exhibits the storage defect.

[0315] In some embodiments, upon administration, the AAV vector selectively expresses and secretes GAA from transduced hepatocytes. The primary mechanism of action of the hGAA polypeptide-expressing AAV vectors disclosed herein is to secrete sustained low levels of endogenous GAA from the liver into the systemic circulation to provide therapeutic exposure levels of GAA to tissues (e.g., muscle, but not limited to muscle), leading to glycogen removal and restoration of cellular structure and function. B. Increased GAA activity in subjects with Pompe disease

[0316] In any embodiment of the methods disclosed herein, administration of the AAV vector expressing GAA is to muscle and can be performed by any appropriate method, including intravenous administration, intraarterial administration, and / or intraperitoneal administration. Exemplary modes of administration include oral, rectal, transmucosal, intranasal, inhalation (e.g., by aerosol), oral (e.g., sublingual), vaginal, intrathecal, intraocular, transdermal, intrauterine (or intraocular), parenteral (e.g., intravenous, subcutaneous, intradermal, intramuscular [including skeletal muscle, diaphragm and / or myocardial administration], intradermal, intrapleural, intracerebral and intraarticular), topical (e.g., to both skin and mucosal surfaces, including airway surfaces, and transdermal administration), intralymphatic, etc., as well as direct tissue or organ injection (e.g., to the liver, skeletal muscle, myocardium, diaphragm or brain). In any given case, the most appropriate route will depend on the nature and severity of the condition being treated and / or prevented and the nature of the specific vector used.

[0317] In any embodiment of the methods disclosed herein, according to the present invention, administration of the AAV vector expressing GAA is to skeletal muscle, and includes, but is not limited to, administration to skeletal muscles in the limbs (e.g., upper arm, lower arm, thigh and / or calf), back, neck, head (e.g., tongue), chest, abdomen, pelvis / perineum and / or fingers / toes. Suitable skeletal muscles for injection are disclosed in International Application No. WO2021102107, which is incorporated herein by reference in its entirety.

[0318] In any embodiment of the method disclosed herein, the rAAV vector and / or rAAV genome is administered to the skeletal muscle, liver, diaphragm, costal muscle and / or myocardial cells of the subject. For example, a conventional syringe and needle can be used to inject rAAV virion suspension into an animal. The parenteral administration of the rAAV vector and / or rAAV genome by injection can be performed by, for example, bolus injection or continuous infusion. The injection formulation can be present in unit dosage form, for example, in a multi-dose container or ampoule with an added preservative. The composition can take the form of a suspension, solution or emulsion in an oily or aqueous solvent, and can include reagents for pharmaceutical preparations, such as suspending agents, stabilizers and / or dispersants. Alternatively, the rAAV vector and / or rAAV genome as disclosed herein can be in powder form (e.g., lyophilized) to be constituted with a suitable solvent (e.g., sterile pyrogen-free water) before use.

[0319] In certain embodiments, more than one administration (e.g., two, three, four, five, six, seven, eight, nine, ten, etc., or more administrations) can be utilized to achieve the desired level of GAA expression over a variety of time intervals (e.g., hourly, daily, weekly, monthly, yearly, etc.). Administration can be a single dose or cumulative (continuous administration) and can be readily determined by one skilled in the art. As disclosed herein, it is contemplated that treatment of Pompe disease according to the methods disclosed herein comprises a one-time administration of an effective dose of a pharmaceutical composition comprising an AAV vector encoding a GAA polypeptide.

[0320] However, in alternative embodiments, when long-term ERT is not administered to the subject, treatment of a subject with Pompe disease may comprise multiple administrations of a pharmaceutical composition comprising an AAV vector encoding a GAA polypeptide, wherein the multiple administrations may be performed over a period of time, for example, once a year, or once every six months, or about once every two years, or about once every three years, or about once every four years, or about once every five years, or at intervals longer than 5 years. The timing of administration may vary between individuals, depending on factors such as the severity of the individual's symptoms. For example, in some embodiments, an effective dose of an AAV vector encoding a GAA polypeptide disclosed herein may be administered to an individual once a year, or once every two years, or once every six months, for an indefinite period of time, or until the individual no longer requires treatment. One of ordinary skill in the art will recognize that the individual's condition may be monitored during treatment and the effective amount of the AAV vector encoding the GAA polypeptide administered may be adjusted accordingly.

[0321] The injections disclosed herein containing AAV vectors encoding GAA polypeptides can be prepared in conventional forms, either as liquid solutions or suspensions, or as solid forms suitable for dissolving or suspending in liquids before injection, or as emulsions. Alternatively, the AAV vectors encoding GAA polypeptides disclosed herein can be administered in a local rather than systemic manner, for example, in a reservoir formulation or a sustained-release formulation. In addition, viral vectors and / or viral capsids can be delivered by adhering to surgically implanted matrices (e.g., as described in U.S. Patent Publication No. US-2004-0013645-A1). In some embodiments, the AAV vectors encoding GAA polypeptides disclosed herein can be administered to the lungs of a subject by any appropriate means, optionally by administering an aerosol suspension of inhalable particles containing viral vectors and / or viral capsids (which are inhaled by the subject). Inhalable particles can be liquid or solid. Aerosols of liquid particles containing viral vectors and / or viral capsids can be produced by any appropriate means, for example, using a pressure-driven aerosol nebulizer or ultrasonic nebulizer, as known to those skilled in the art. See, eg, US Patent No. 4,501,729. Aerosols of solid particles containing viral vectors and / or capsids can also be prepared by techniques known in the pharmaceutical art using any solid particle pharmaceutical aerosol generator.

[0322] In some embodiments, the AAV vectors encoding GAA polypeptides disclosed herein can be formulated in a solvent, emulsion, or other diluent in an amount sufficient to dissolve the rAAV vector disclosed herein. In other aspects of this embodiment, the rAAV vectors and / or rAAV genomes encoding GAA polypeptides disclosed herein can be formulated in an amount of solvent, emulsion, or other diluent such as less than about 90% (v / v), less than about 80% (v / v), less than about 70% (v / v), less than about 65% (v / v), less than about 60% (v / v), less than about 55% (v / v), less than about 50% (v / v), less than about 45% (v / v), less than about 40% (v / v), less than about 35% (v / v), less than about 30% (v / v), less than about 25% (v / v), less than about 20% (v / v), less than about 15% (v / v), less than about 10% (v / v), less than about 5% (v / v), or less than about 1% (v / v). In other aspects, the rAAV vectors and / or rAAV genomes encoding GAA polypeptides disclosed herein can contain a solvent, emulsion, or other diluent in an amount ranging from, for example, about 1% (v / v) to 90% (v / v), about 1% (v / v) to 70% (v / v), about 1% (v / v) to 60% (v / v), about 1% (v / v) to 50% (v / v), about 1% (v / v) to 40% (v / v), or about 1% (v / v) to 50% (v / v). % (v / v), about 1% (v / v) to 30% (v / v), about 1% (v / v) to 20% (v / v), about 1% (v / v) to 10% (v / v), about 2% (v / v) to 50% (v / v), about 2% (v / v) to 40% (v / v), about 2% (v / v) to 30% (v / v), about 2% (v / v) to 20% (v / v), about 2% (v / v) to 10% (v / v) / v), about 4% (v / v) to 50% (v / v), about 4% (v / v) to 40% (v / v), about 4% (v / v) to 30% (v / v), about 4% (v / v) to 20% (v / v), about 4% (v / v) to 10% (v / v), about 6% (v / v) to 50% (v / v), about 6% (v / v) to 40% (v / v), about 6% (v / v) to 30% (v / v) ), about 6% (v / v) to 20% (v / v), about 6% (v / v) to 10% (v / v), about 8% (v / v) to 50% (v / v), about 8% (v / v) to 40% (v / v), about 8% (v / v) to 30% (v / v), about 8% (v / v) to 20% (v / v), about 8% (v / v) to 15% (v / v), or about 8% (v / v) to 12% (v / v).

[0323] In any embodiment of the methods disclosed herein, the AAV vector encoding the GAA polypeptide can be of any AAV serotype, including but not limited to being encapsulated by any AAV8 capsid, or any AAV3b capsid selected from the group consisting of: AAV3b capsid (SEQ ID NO: 452); AAV3b265D capsid (SEQ ID NO: 454), AAV3b ST (S663V + T492V) capsid (SEQ ID NO: 456), AAV3b265D549A capsid (SEQ ID NO: 458); AAV3b549A capsid (SEQ ID NO: 460); AAV3bQ263Y capsid (SEQ ID NO: 462) or AAV3bSASTG capsid (i.e., an AAV3b capsid comprising the Q263A / T265 mutations).

[0324] To facilitate delivery of the AAV vector encoding the GAA polypeptide disclosed herein, it can be mixed with a carrier or excipient. Carriers and excipients that can be used include physiological saline (particularly sterile, pyrogen-free saline), salt buffers (e.g., citrate buffer, phosphate buffer, acetate buffer, and bicarbonate buffer), amino acids, urea, alcohols, ascorbic acid, phospholipids, proteins (e.g., serum albumin), EDTA, sodium chloride, liposomes, mannitol, sorbitol, and glycerol. USP-grade carriers and excipients are particularly suitable for delivering viral particles to human subjects.

[0325] In addition to the aforementioned formulations, the AAV vectors encoding GAA polypeptides disclosed herein can also be formulated as depot preparations. Such long-acting formulations can be administered by implantation (e.g., subcutaneously or intramuscularly) or by IM injection. Thus, for example, the rAAV vectors and / or rAAV genomes disclosed herein can be formulated with a suitable polymeric material or hydrophobic material (e.g., as an emulsion in an acceptable oil) or an ion exchange resin, or as a sparingly soluble derivative.

[0326] In any embodiment of the methods disclosed herein, the method is to treat Pompe disease caused by GAA deficiency in a subject, wherein an AAV vector encoding a GAA polypeptide disclosed herein is administered to a subject suffering from Pompe disease, and following administration, GAA is secreted from cells in the liver, and the secreted GAA is taken up by cells in skeletal muscle tissue, cardiac muscle tissue, diaphragm tissue, or a combination thereof, wherein the uptake of the secreted GAA causes a decrease in lysosomal glycogen storage in the tissue, including but not limited to muscle. In some embodiments, the AAV vector encoding the GAA polypeptide disclosed herein is encapsidated in a capsid, for example, by any AAV3b capsid selected from the group consisting of: AAV3b capsid (SEQ ID NO: 452); AAV3b265D capsid (SEQ ID NO: 454), AAV3b ST (S663V + T492V) capsid (SEQ ID NO: 456), AAV3b265D549A capsid (SEQ ID NO: 458); AAV3b549A capsid (SEQ ID NO: 460); AAV3bQ263Y capsid (SEQ ID NO: 462) or AAV3bSASTG capsid (i.e., an AAV3b capsid comprising the Q263A / T265 mutations).

[0327] In a specific embodiment, the drug is administered in a pharmaceutically acceptable carrier at a concentration of at least about 1.6×10 12 to about 4.0×10 12 In further embodiments, the dosage of the viral vector and / or capsid to be administered to a subject depends on the mode of administration, the severity and type of Pompe disease to be treated and / or prevented (i.e., LOPD or IOPD), the condition, age, and sex of the individual subject, as well as the specific viral vector or capsid, the nucleic acid encoding the GAA polypeptide to be delivered, etc., and can be determined in a routine manner.

[0328] Exemplary dosages for achieving therapeutic effects are titers of at least about 1.0E9 vg / kg to 5.0E13 vg / kg, such as 1.0E9 vg / kg to 5.0E12 vg / kg; 5.0E9 vg / kg to 5.0E12 vg / kg; 5.0E9 vg / kg to 1.0E12 vg / kg; 5.0E9 vg / kg to 5.0E11 vg / kg; 5.0E9 vg / kg to 5.0E10 vg / kg; and 1.0E9 vg / kg to 1.0E10 vg / kg, 1.5×10 11 vg / kg, or at least about 1.5×10 12 vg / kg, or at least about 4.0×10 12vg / kg. It is contemplated that the dosage for achieving a therapeutic effect disclosed herein can also be determined by the strength of the liver-specific promoter (LSP) operably linked to the nucleic acid encoding the GAA polypeptide, as well as the specific signal sequence and the ability of the cell to cleave the signal sequence when secreted from the cell. In contrast, when the liver-specific promoter is stronger than the LPS (SEQ ID NO: 97) used in the AAV8-LSPhGAA vector, the dosage of the AAV encoding the GAA polypeptide disclosed herein can be lower than about 1.6×10 12 However, the dose of AAV should be titrated and determined based on the level of GAA expressed in the cells, as determined by the transduction efficiency of the AAV capsid and LSP and the ability of the cells to secrete the expressed GAA polypeptide, to avoid GAA accumulation in the transfected cells and any associated cytotoxicity.

[0329] In another aspect, disclosed herein are methods for treating Pompe disease by administering a nucleic acid encoding GAA to a cell, the method comprising: contacting the cell with a rAAV vector and / or rAAV genome disclosed herein under conditions such that the nucleic acid is introduced into the cell and expressed to produce GAA. In some embodiments, the cell is a cell in vivo. In some embodiments, the cell is a mammalian cell in vivo. C. Improve motor neuron function in mammals

[0330] In any embodiment of the methods disclosed herein, the AAV vectors encoding GAA polypeptides disclosed herein are used in a method of increasing phrenic nerve activity in a mammal suffering from Pompe disease and / or insufficient GAA levels. For example, an AAV vector encoding a GAA polypeptide as disclosed herein, e.g., a rAAV vector and / or a rAAV genome encapsidated in a capsid, e.g., encapsidated by AAV8 or any AAV3b capsid selected from the group consisting of: AAV3b capsid (SEQ ID NO: 452); AAV3b265D capsid (SEQ ID NO: 454); AAV3b ST (S663V + T492V) capsid (SEQ ID NO: 456); AAV3b265D549A capsid (SEQ ID NO: 458); AAV3b549A capsid (SEQ ID NO: 460); AAV3bQ263Y capsid (SEQ ID NO: 462); or AAV3bSASTG capsid, can be administered to the central nervous system (e.g., neurons). In another embodiment, retrograde transport of the AAV vector encoding the GAA polypeptide disclosed herein from the diaphragm (or other muscles) to the phrenic nerve or other motor neurons can result in biochemical and physiological correction of Pompe disease. These same principles can also be applied to other neurodegenerative diseases.

[0331] In embodiments, the rAAV capsid of the rAAV virion for treating Pompe disease is any of those listed in Table 1 as disclosed in International Applications WO2020 / 102645 and WO2020 / 102667, each of which is incorporated herein by reference in its entirety, and includes any of AAV8, or AAV3 or AAV3b serotypes (including but not limited to AAV3b serotypes AAV3b265D, AAV3b265D549A, AAV3b549A, AAV3bQ263Y, AAV3bSASTG (i.e., AAV3b capsid comprising Q263A / T265 mutations)), which is capable of alleviating the symptoms of Pompe disease. The invention further comprises any one or more of the following symptoms: (i) weakness in the patient's lower extremities (including the legs, trunk and / or arms), (ii) shortness of breath, difficulty moving, lung infection, a large curve in the spine, difficulty breathing during sleep, an enlarged liver, an enlarged tongue and / or joint stiffness, (iii) a decrease in the patient's pain, pain, and / or discomfort in a patient with Pompe disease by, for example, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90% or at least 95% compared to a patient not receiving the same treatment. In other aspects of this embodiment, any serotype of AAVGAA is capable of alleviating any one or more of the following symptoms: (i) weakness in the patient's lower extremities (including the legs, trunk, and / or arms), (ii) shortness of breath, difficulty exercising, lung infection, a large curvature in the spine, difficulty breathing during sleep, an enlarged liver, an enlarged tongue, and / or joint stiffness, (iii) a reduction in, for example, about 10% to about 100%, about 20% to about 100%, about 30% to about 100%, about 40% to about 100%, about 50% to about 100%, about 60% to about 70% in a patient with Pompe disease compared to a patient not receiving the same treatment. To about 100%, about 70% to about 100%, about 80% to about 100%, about 10% to about 90%, about 20% to about 90%, about 30% to about 90%, about 40% to about 90%, about 50% to about 90%, about 60% to about 90%, about 70% to about 90%, about 10% to about 80%, about 20% to about 80%, about 30% to about 80%, about 40% to about 80%, about 50% to about 80%, or about 60% to about 80%, about 10% to about 70%, about 20% to about 70%, about 30% to about 70%, about 40% to about 70%, or about 50% to about 70%.

[0332] In any of the embodiments of the methods and compositions disclosed herein, at least one symptom associated with Pompe disease or at least one adverse side effect associated with Pompe disease is reduced by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%, and the severity of at least one symptom associated with Pompe disease or at least one adverse side effect is reduced by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%. In another embodiment, at least one symptom associated with Pompe disease or at least one adverse side effect associated with Pompe disease is reduced by about 10% to about 100%, about 20% to about 100%, about 30% to about 100%, about 40% to about 100%, about 50% to about 100%, about 60% to about 100%, about 70% to about 100%, about 80% to about 100%, about 10% to about 90%, about 20% to about 9 ...50% to about 100%, about 50% to about 100%, about About 90%, about 40% to about 90%, about 50% to about 90%, about 60% to about 90%, about 70% to about 90%, about 10% to about 80%, about 20% to about 80%, about 30% to about 80%, about 40% to about 80%, about 50% to about 80%, or about 60% to about 80%, about 10% to about 70%, about 20% to about 70%, about 30% to about 70%, about 40% to about 70%, or about 50% to about 70%. V. Administration Method

[0333] Without wishing to be bound by theory, the only current treatment for Pompe disease is long-term administration of recombinant human GAA (rhGAA) ERT, typically administered on an every-other-week schedule. Herein, the inventors have demonstrated that subjects with Pompe disease can take a long break from their normal ERT regimen (e.g., a long period of ERT cessation) without clinical regression if a specific dose of an AAV vector expressing a GAA polypeptide disclosed herein is administered to the patient. In some embodiments, cessation of long-term ERT administration is initiated approximately at the time the AAV vector is administered to the subject (e.g., the day before, the day of administration, or the day after), or in some embodiments, cessation of long-term ERT administration can occur at about 26 weeks after administration of the AAV vector or at any time point between about 24 and about 26 weeks.

[0334] In some embodiments, after an initial period of discontinuation of long-term ERT administration for an extended period of time, supplemental ERT can be administered to a subject administered a GAA-expressing AAV vector disclosed herein, wherein the supplemental ERT is administered about 6 months, about 1 year, or more than 1 year after discontinuation of long-term ERT. In other words, and without wishing to be bound by theory, the technology disclosed herein relates to a method by which a subject with Pompe disease administered a GAA-expressing AAV vector disclosed herein can take a break or "vacation" from normal long-term ERT administration. That is, according to the methods disclosed herein, a subject administered a GAA-expressing AAV vector disclosed herein can be free of long-term ERT administration for an extended period of time. In some embodiments, the methods disclosed herein allow for flexibility in conventional ERT regimens because extended breaks or discontinuation of long-term ERT administration do not result in clinical decline—that is, the subject remains clinically stable despite the absence of ongoing long-term ERT.

[0335] In some embodiments, the methods disclosed herein encompass re-administration of ERT after cessation of ERT administration for an extended period of time (referred to herein as "supplemental ERT"), and allow for flexibility in conventional ERT regimens because the continued production of GAA expressed by AAV enables the flexibility of ERT. In some embodiments, the supplemental ERT is a pulsed administration of ERT, as disclosed herein. In some embodiments, the supplemental ERT is administered at shorter intervals, at lower doses, at irregular doses, or at irregular intervals compared to the prior chronic ERT administration.

[0336] Thus, the methods disclosed herein provide significant advantages for subjects with Pompe disease, including, but not limited to, reducing or eliminating the rigorous and arduous weekly or every other week infusions of long-term rhGAA ERT therapy, which is significantly time-consuming and geographically limited, and prevents patients with Pompe disease from traveling for extended periods of time outside the area where they are receiving ERT infusions. Furthermore, as disclosed herein, the absence of ERT administration also reduces any side effects due to anti-rhGAA antibodies to ERT and also avoids the need to administer immunosuppressants that are typically co-administered with ERT. Thus, the methods of treating Pompe disease disclosed herein provide greater flexibility in the treatment of Pompe disease and improve the quality of life and lifestyle of subjects with Pompe disease.

[0337] Thus, in one embodiment, the technology relates to a method of treating Pompe disease in a subject, the method comprising administering to the subject a pharmaceutical composition comprising a recombinant adeno-associated viral (AAV) vector comprising in its genome a heterologous nucleic acid sequence encoding an alpha-glucosidase (GAA) polypeptide in an expressible form, in the absence of administration of long-term GAA enzyme replacement therapy (ERT) for an extended period of time (e.g., administration of ERT may be stopped or interrupted at about 24 weeks or about 26 weeks or earlier following administration of the recombinant AAV), wherein the heterologous nucleic acid is operably linked to a liver-specific promoter. In some embodiments, the dose of a recombinant AAV comprising a nucleic acid encoding a GAA polypeptide ranges from 1.0E11 vg / kg to 5.0E13 vg / kg, and in some embodiments, GAA is expressed to a level that allows the subject to achieve a serum level of AAV-expressed GAA within the following pharmaceutically active range for at least two weeks after administration: 160 nmol / mL / hr to ≤2,260 nmol / mL / hr, 165 nmol / mL / hr to ≤2,260 nmol / mL / hr, 175 nmol / mL / hr to ≤2,260 nmol / mL / hr, 180 nmol / mL / hr to ≤2,260 nmol / mL / hr, 185 nmol / mL / hr to ≤2,260 nmol / mL / hr, 189 nmol / mL / hr to ≤2,260 nmol / mL / hr. In some embodiments, the dose of AAV expressing the GAA polypeptide ranges from 11.0E11 vg / kg to 5.0E13 vg / kg, and in some embodiments, the dose does not exceed 4.0E11 vg / kg. 12 vg / kg, and in some embodiments, GAA is expressed to a level that allows the subject to achieve a serum level of GAA expressed by the AAV within the pharmaceutically active range of 189 nmol / mL / hr to ≤2,260 nmol / mL / hr for at least two weeks following administration. In some embodiments, the dose of the AAV expressing GAA does not exceed 4.0E 12 vg / kg, and in some embodiments, GAA is expressed to a level that results in a serum level of AAV-expressed GAA in the pharmaceutically active range of 189 nmol / mL / hr to ≤2,260 nmol / mL / hr in the subject for at least two weeks following administration.

[0338] In some embodiments, the dose of AAV expressing GAA does not exceed 5.0E 11 vg / kg. In some embodiments, the dosage range is 1.0E 9 vg / kg to 5.0E 11 vg / kg.

[0339] In some embodiments, the dose of AAV expressing GAA does not exceed 5.0E13 vg / kg. In some embodiments, the dose ranges from 1.0E9 vg / kg to 5.0E13 vg / kg.

[0340] In particular, the technology described herein relates to the discovery that a single infusion of a rAAV vector expressing human acid alpha-glucosidase (GAA) can serve as an independent alternative to repeated infusions of enzyme replacement therapy (ERT) using recombinant human GAA protein (rhGAA). The inventors demonstrated that a single administration of an AAV expressing GAA resulted in long-term transduction of the normal GAA gene into hepatocytes and sustained constitutive expression of GAA in the systemic circulation. Thus, the inventors demonstrate herein that administration of a composition comprising an AAV expressing hGAA can replace the biweekly exogenous ERT infusions that subjects with Pompe disease typically receive. That is, the inventors have demonstrated herein that subjects with Pompe disease who are administered an AAV expressing hGAA can discontinue ERT long-term.

[0341] In particular, described herein is a method for treating Pompe disease in a subject by administering a composition comprising an AAV vector expressing an alpha-glucosidase (GAA) protein to a subject in need thereof, wherein GAA enzyme replacement therapy is not administered concurrently to the subject. In some embodiments, the technology relates to a method for administering an AAV expressing GAA, wherein the subject can stop GAA enzyme replacement therapy (ERT) for a long period of time, for example, at least 3 months, at least 4 months, at least 5 months, at least 1 year, at least 1 year and a half, and at any time point within 6 months or longer. In some embodiments, the subject stops ERT shortly before or on the day of administering the AAV expressing GAA, and remains clinically stable for at least one or more symptoms disclosed herein. In some embodiments, the subject stops ERT within 1-2 days before or after administering the AAV expressing GAA and within 1-2 days and at any time within about 6 months after administration, and remains clinically stable for at least one or more Pompe disease symptoms as disclosed herein for at least 6 months.

[0342] Furthermore, the inventors have discovered that, according to the methods and dosage ranges disclosed herein, Pompe disease patients administered AAV expressing GAA have little or no immune response to the GAA protein expressed by the AAV. Thus, in some embodiments, little or no immunomodulation or administration of immunosuppressants is required at, before, or after administration of AAV to a subject, and thus, no normal immunosuppressant regimen is required, which is typically administered when administering a viral vector or performing gene therapy to a subject.

[0343] Thus, in all embodiments herein, the method of treating Pompe disease comprises, consists essentially of, or consists of administering an AAV vector expressing GAA as disclosed herein, in the absence of ERT for Pompe disease, and in the absence of immunomodulation. In some embodiments, the subject has late-onset Pompe disease (LOPD) or infantile Pompe disease.

[0344] In all aspects disclosed herein, the AAV comprises a nucleotide sequence containing inverted terminal repeats (ITRs), a promoter, a heterologous gene, a poly-A tail, and potentially other regulatory elements for treating Pompe disease (e.g., late-onset Pompe disease (LOPD)), wherein the heterologous gene is GAA, and wherein the vector (e.g., rAAV) can be administered to a patient at a therapeutically effective dose and delivered to appropriate tissues and / or organs to express the heterologous GAA gene and treat the disease (e.g., Pompe disease).

[0345] In some embodiments, after an initial period of discontinuation of long-term ERT administration for an extended period of time, supplemental ERT can be administered to a subject administered a GAA-expressing AAV vector disclosed herein, wherein the supplemental ERT is administered about 6 months, about 1 year, or more than 1 year after discontinuation of long-term ERT. In other words, and without wishing to be bound by theory, the technology disclosed herein relates to a method by which a subject with Pompe disease administered a GAA-expressing AAV vector disclosed herein can take a break or "vacation" from normal long-term ERT administration. That is, according to the methods disclosed herein, a subject administered a GAA-expressing AAV vector disclosed herein can be free of long-term ERT administration for an extended period of time. In some embodiments, the methods disclosed herein allow for flexibility in conventional ERT regimens because extended breaks or discontinuation of long-term ERT administration do not result in clinical decline—that is, the subject remains clinically stable despite the absence of ongoing long-term ERT.

[0346] In some embodiments, the methods disclosed herein encompass re-administration of ERT after cessation of ERT administration for an extended period of time (referred to herein as "supplemental ERT"), and allow for flexibility in conventional ERT regimens because the continued production of GAA expressed by AAV enables the flexibility of ERT. In some embodiments, the supplemental ERT is a pulsed administration of ERT, as disclosed herein. In some embodiments, the supplemental ERT is administered at shorter intervals, at lower doses, at irregular doses, or at irregular intervals compared to the prior chronic ERT administration.

[0347] Thus, the methods disclosed herein provide significant advantages for subjects with Pompe disease, including, but not limited to, reducing or eliminating the rigorous and arduous weekly or every other week infusions of long-term rhGAA ERT therapy, which is significantly more time-consuming and geographically limited, and prevents patients with Pompe disease from traveling for extended periods of time outside the area where they are receiving ERT infusions. Furthermore, the absence of ERT administration, as disclosed herein, also reduces any side effects caused by anti-rhGAA antibodies to ERT and also avoids the need to administer immunosuppressants that are typically co-administered with ERT. Thus, the methods of treating Pompe disease disclosed herein provide greater flexibility in the treatment of Pompe disease and improve the quality of life and lifestyle of subjects with Pompe disease.

[0348] Thus, in one embodiment, the technology relates to a method of treating Pompe disease in a subject, the method comprising administering to the subject a pharmaceutical composition comprising a recombinant adeno-associated viral (AAV) vector comprising in its genome a heterologous nucleic acid sequence encoding an alpha-glucosidase (GAA) polypeptide in an expressible form, in the absence of administration of long-term GAA enzyme replacement therapy (ERT) for an extended period of time (e.g., administration of ERT may be stopped or interrupted at about 24 weeks or about 26 weeks or earlier following administration of the recombinant AAV), wherein the heterologous nucleic acid is operably linked to a liver-specific promoter. In some embodiments, the dose of a recombinant AAV comprising a nucleic acid encoding a GAA polypeptide ranges from 1.0E9 vg / kg to 5.0E13 vg / kg, and in some embodiments, GAA is expressed to a level that allows the subject to achieve a serum level of AAV-expressed GAA within the following pharmaceutically active range for at least two weeks after administration: 160 nmol / mL / hr to ≤2,260 nmol / mL / hr, 165 nmol / mL / hr to ≤2,260 nmol / mL / hr, 175 nmol / mL / hr to ≤2,260 nmol / mL / hr, 180 nmol / mL / hr to ≤2,260 nmol / mL / hr, 185 nmol / mL / hr to ≤2,260 nmol / mL / hr, 189 nmol / mL / hr to ≤2,260 nmol / mL / hr. In some embodiments, the dose of AAV expressing GAA polypeptide ranges from 1.0E9 vg / kg to 5.0E13 vg / kg, and in some embodiments, GAA is expressed to a level that allows a subject to achieve a serum level of GAA expressed by the AAV within the pharmaceutically active range of 189 nmol / mL / hr to ≤2,260 nmol / mL / hr for at least two weeks following administration. In some embodiments, the dose of AAV expressing GAA ranges from 1.0E9 vg / kg to 5.0E13 vg / kg, and in some embodiments, GAA is expressed to a level that allows a subject to achieve a serum level of GAA expressed by the AAV within the pharmaceutically active range of 189 nmol / mL / hr to ≤2,260 nmol / mL / hr for at least two weeks following administration.

[0349] In particular, the technology described herein relates to the discovery that a single infusion of a rAAV vector expressing human acid alpha-glucosidase (GAA) can serve as an independent alternative to repeated infusions of enzyme replacement therapy (ERT) using recombinant human GAA protein (rhGAA). The inventors demonstrated that a single administration of an AAV expressing GAA resulted in long-term transduction of the normal GAA gene into hepatocytes and sustained constitutive expression of GAA in the systemic circulation. Thus, the inventors demonstrate herein that administration of a composition comprising an AAV expressing hGAA can replace the biweekly exogenous ERT infusions that subjects with Pompe disease typically receive. That is, the inventors have demonstrated herein that subjects with Pompe disease who are administered an AAV expressing hGAA can discontinue ERT long-term.

[0350] In particular, described herein is a method for treating Pompe disease in a subject by administering a composition comprising an AAV vector expressing an alpha-glucosidase (GAA) protein to a subject in need thereof, wherein GAA enzyme replacement therapy is not administered concurrently to the subject. In some embodiments, the technology relates to a method for administering an AAV expressing GAA, wherein the subject can stop GAA enzyme replacement therapy (ERT) for a long period of time, for example, at least 3 months, at least 4 months, at least 5 months, at least 1 year, at least 1 year and a half, and at any time point within 6 months or longer. In some embodiments, the subject stops ERT shortly before or on the day of administering the AAV expressing GAA, and remains clinically stable for at least one or more symptoms disclosed herein. In some embodiments, the subject stops ERT within 1-2 days before or after administering the AAV expressing GAA and within 1-2 days and at any time within about 6 months after administration, and remains clinically stable for at least one or more Pompe disease symptoms as disclosed herein for at least 6 months.

[0351] Furthermore, the inventors have discovered that, according to the methods and dosage ranges disclosed herein, Pompe disease patients administered AAV expressing GAA have little or no immune response to the GAA protein expressed by the AAV. Thus, in some embodiments, little or no immunomodulation or administration of immunosuppressants is required at, before, or after administration of AAV to a subject, and thus, no normal immunosuppressant regimen is required, which is typically administered when administering a viral vector or performing gene therapy to a subject.

[0352] Thus, in all embodiments herein, the method of treating Pompe disease comprises, consists essentially of, or consists of administering an AAV vector expressing GAA as disclosed herein, in the absence of ERT for Pompe disease, and in the absence of immunomodulation. In some embodiments, the subject has late-onset Pompe disease (LOPD) or infantile Pompe disease.

[0353] Disclosed herein are generally methods of treating a subject with Pompe disease, the methods comprising administering to a subject with Pompe disease a pharmaceutical composition comprising or consisting essentially of a recombinant adenovirus-associated (AAV) vector comprising in its genome a heterologous nucleic acid sequence encoding a polypeptide comprising an alpha-glucosidase (GAA) polypeptide, wherein the heterologous nucleic acid is operably linked to a liver-specific promoter, and wherein the subject has not been administered GAA enzyme replacement therapy (ERT) for an extended period of time, or may have had an extended break from ERT. In one embodiment, ERT is continued, but at least one of the dosage or frequency is reduced.

[0354] Without wishing to be bound by theory, the inventors have discovered methods for treating Pompe disease by AAV-mediated delivery of GAA to a subject, wherein the rAAV expresses GAA to a steady state shortly after administration, thereby allowing the subject to discontinue ERT as early as possible, or at or about the time of rAAV administration, for example, ERT can be discontinued one day before administration, on the day of administration, one day after administration, within one week of administration, or within two weeks of administration. As disclosed herein, the steady state of GAA expressed by the rAAV disclosed herein is a serum level of GAA within the pharmacologically active range of 189 nmol / mL / hr to ≤2,260 nmol / mL / hr.

[0355] In some embodiments, the methods of treating Pompe disease by rAAV expressing GAA as disclosed herein comprise administering a therapeutically effective amount of rAAV to produce serum levels of expressed hGAA within the pharmacologically active range of 189 nmol / mL / hr to 410 nmol / mL / hr, or 410 nmol / mL / hr to ≤2,260 nmol / mL / hr.

[0356] In some embodiments, the methods for treating Pompe disease using rAAV expressing GAA as disclosed herein comprise administering rAAV to produce serum levels of expressed hGAA in the range of 189 nmol / mL / hr to ≤2,260 nmol / mL / hr, and wherein the subject achieves clinical stability of one or more symptoms of Pompe disease. Clinical stability includes stabilization of any one or more of the following parameters: 6MWT (6-minute walk test), FVC (forced vital capacity). In some embodiments, clinical stability refers to stable levels of motor function (as determined by the 6MWT) and / or lung function (as determined by FVC) in two consecutive assessments no less than 3 months apart. In some embodiments, clinically stable levels of motor function as determined by the 6MWT are a decrease of ≤12%, or a decrease of less than 43 meters from baseline in two consecutive assessments no less than 3 months apart. In other words, clinically stable levels of motor function as determined by the 6MWT are within a range of a decrease of 0%-12% from baseline in two consecutive assessments no less than 3 months apart.

[0357] In some embodiments, the clinically stable level of lung function as determined by % of FVC predicted in the upright position decreases by ≤15% from baseline on two consecutive assessments that are no less than 3 months apart. In other words, the clinically stable level of lung function as determined by % of FVC predicted in the upright position decreases by 1%-14% from baseline on two consecutive assessments that are no less than 3 months apart.

[0358] In some embodiments, the baseline level of 6MWT or FVC is the level measured before or at the time of administration of rAAV expressing GAA. In some embodiments, when GAA ERT is administered to a subject in parallel, the baseline level of 6MWT or FVC is the level measured before or at the time of administration of rAAV expressing GAA. In some embodiments, when a subject stops GAA ERT, the baseline level of 6MWT or FVC is the level measured before or at the time of administration of rAAV expressing GAA. In some embodiments, the baseline level of 6MWT or FVC is the level measured before or at the time of administration of rAAV expressing GAA. In some embodiments, the baseline level of 6MWT or FVC is the level before stopping GAA ERT, for example, at about 24 weeks to about 26 weeks. In some embodiments, clinical stability is maintained before and after ERT is stopped in a Pompe disease patient, wherein the patient receives a single administration of an AAV comprising a nucleic acid encoding GAA, which is administered at the time of, before, or after ERT administration. Maintenance of clinical stability indicates that 6MWT and / or FVC are within the baseline range as described herein.

[0359] In some embodiments, the methods disclosed herein for treating Pompe disease using rAAV expressing GAA comprise administering an amount of rAAV to cause glycogen levels in one or more tissues to decrease to within a normal range, wherein the normal range is the glycogen levels in a comparable tissue of a subject without Pompe disease. A. AAV-hGAA Dosage

[0360] In some embodiments, the methods disclosed herein involve administering a rAAV expressing GAA to a human subject at a dose ranging from 1.0E11 vg / kg to 5.0E13 vg / kg. In some embodiments, cessation of ERT can occur at the time of administration of the rAAV expressing GAA, or at about 24 weeks or 26 weeks after administration of the recombinant AAV. In some embodiments, administration of the rAAV expressing GAA disclosed herein can achieve therapeutic correction of disease pathophysiology even in the absence of ERT, and can also achieve protection of the immune response to expressed hGAA, such as measured by antibodies to expressed hGAA, thereby indicating that patients with Pompe disease who are administered an AAV expressing hGAA disclosed herein can have long-term cessation of ERT, which is further discussed, for example, in International Patent Application No. PCT / US2023 / 013713, which is incorporated herein by reference in its entirety.

[0361] In some embodiments, according to the methods for treating Pompe disease disclosed herein, the dosage of the rAAV vector or rAAV genome to be administered to a subject depends on the mode of administration, the promoter used, the signal peptide used, the severity of Pompe disease or other disease to be treated and / or prevented, the condition of the individual subject, the particular viral vector or capsid used, the liver-specific promoter used, and the nucleic acid to be delivered, including but not limited to a nucleic acid encoding a signal peptide attached 5′ to a nucleic acid encoding an expressible GAA polypeptide, and the like, and can be determined in a routine manner.

[0362] In some embodiments, a therapeutically effective amount of a rAAV vector expressing GAA is an amount that produces a steady-state serum GAA concentration similar to the GAA pharmacological activity achieved by long-term GAAERT (e.g., within 5%, 10%, 20% of these levels). For example, the target serum GAA concentration at steady state ranges from about 160 nmol / mL / hr to ≤2,260 nmol / mL / hr, about 189 nmol / mL / hr to ≤2,260 nmol / mL / hr, or ranges from 410 nmol / mL / hr to ≤2,260 nmol / mL / hr. In some embodiments, the dose of a rAAV vector expressing GAA is a therapeutically effective amount that achieves a steady-state target serum GAA concentration that confers pharmacological activity in the range of 189 nmol / mL / hr to ≤2,260 nmol / mL / hr. In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount to increase tissue GAA levels in a subject to >0.30 μmol 4MU / min / g tissue, wherein the normal range of tissue GAA levels in a subject without Pompe disease is 0.36±0.13 μmol 4MU / min / g tissue. In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount to increase tissue GAA levels in a subject to between 0.25 μmol 4MU / min / g tissue and 0.4 μmol 4MU / min / g tissue. In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount that produces normal tissue GAA levels of about 0.36 μmol 4MU / min / g tissue, for example, about 0.25 μmol 4MU / min / g tissue, or about 0.26 μmol 4MU / min / g tissue, or about 0.27 μmol 4MU / min / g tissue, or about 0.28 μmol 4MU / min / g tissue, or about 0.29 μmol 4MU / min / g tissue, or about 0.30 μmol 4MU / min / g tissue, or about 0.31 μmol 4MU / min / g tissue, or about 0.32 μmol 4MU / min / g tissue, or about 0.33 μmol 4MU / min / g tissue, or about 0.34 μmol 4MU / min / g tissue, or about 0.35 μmol 4MU / min / g tissue, or about 0.36 μmol 4 MU / min / g tissue, or about 0.37 μmol 4 MU / min / g tissue, or about 0.38 μmol 4 MU / min / g tissue, or about 0.39 μmol 4 MU / min / g tissue, or about 0.40 μmol 4 MU / min / g tissue.

[0363] In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount that increases tissue GAA levels in a subject to between 0.1 μmol 4MU / min / g tissue and 0.5 vmol 4MU / min / g tissue. In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount that produces normal tissue GAA levels greater than about 0.36 vmol 4MU / min / g tissue. In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount that increases tissue GAA levels or levels in a subject to between 0.2 μmol 4MU / min / g tissue and 0.4 μmol 4MU / min / g tissue. In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount that increases tissue GAA level in a subject to within 40%, or within 30%, or within 20%, or within 10%, or within 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% of normal muscle tissue GAA level, which is 0.36 ± 0.13 (μmol 4 MU / min / g tissue), wherein the normal muscle tissue GAA level is a reference level for GAA in a subject without Pompe disease. In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount that increases tissue GAA level in a subject to greater than 0.1 μmol 4 MU / min / gr tissue, wherein the normal GAA level in a subject with Pompe disease ranges from 0.05 ± 0.04 (μmol 4 MU / min / g tissue). In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount that increases tissue GAA content in a subject to a therapeutically effective amount of more than 2-fold, or 3-fold, or 4-fold, or 5-fold, or 6-fold, or 7-fold, or 8-fold, or 9-fold, or 10-fold, or more than 10-fold the level of GAA content in a subject with Pompe disease. In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount that increases tissue GAA content in a subject to a therapeutically effective amount of about 50%, or about 40%, or about 30%, or about 20%, or about 10%, or about 9%, about 8%, about 7%, about 6%, about 5%, about 4%, about 3%, about 2%, or about 1% of the level of GAA content in a subject with Pompe disease. In some embodiments, GAA activity in muscle is at least 1.5-fold, at least 2-fold, at least 3-fold, at least 5-fold, at least 8-fold, or at least 10-fold the level before AAV administration. In some embodiments, GAA activity in muscle is at least 1.5-fold, at least 2-fold, at least 3-fold, at least 5-fold, at least 8-fold, or at least 10-fold the level after cessation of long-term ERT for at least about 24 weeks.

[0364] In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount that reduces tissue glycogen levels in a subject to within a range of 0.25% of wet tissue weight to about 1.5% of wet tissue weight. In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount that reduces muscle tissue glycogen levels in a subject to within 40%, or within 30%, or within 20%, or within 10%, or within 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% of the normal muscle tissue glycogen content in a subject without Pompe disease, which is 0.99% ± 0.74 (% wet tissue weight), which is the normal muscle tissue glycogen content (measured as % wet tissue weight).

[0365] In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount of GAA that exhibits a 3- to 5-fold improvement in the therapeutic index.

[0366] In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount such that the subject has clinically stable levels of hGAA 10 weeks, or at least 20 weeks, or 30 weeks after AAV administration.

[0367] In embodiments, as used herein, the term "effective amount" is synonymous with "therapeutically effective amount," "effective dose," or "therapeutically effective dose," without limitation. In embodiments, the effectiveness of a therapeutic compound for treating Pompe disease as disclosed herein can be determined by observing an improvement in an individual based on one or more clinical symptoms and / or physiological indicators associated with Pompe disease, without limitation. In embodiments, improvement in symptoms associated with Pompe disease can be demonstrated by a reduced need for concurrent treatment.

[0368] In some embodiments, exemplary dosages for achieving therapeutic effects of rAAV vectors expressing hGAA as disclosed herein are in the range of 1.0E 9 vg / kg to 5.0E 11 In some embodiments, the dose administered to a subject is at least about 1.0 E 9 vg / kg, at least about 1.0E 10vg / kg, at least about 1.0E11 vg / kg, at least about 1.0E12 vg / kg, about 1.1E12 vg / kg, about 1.2E12 vg / kg, about 1.3E12 vg / kg, about 1.4E12 vg / kg, about 1.5E12 vg / kg, about 1.6E12 vg / kg, about 1.7E12 vg / kg, about 1.8E12 vg / kg, about 1.9E12 vg / kg, about 2.0E12 vg / kg, about 3.0E12 vg / kg, about 4.0E12 vg / kg, about 5.0E12 vg / kg, about 6.0E12 vg / kg, about 7.0E12 vg / kg, about 8.0E12 vg / kg, about 9.0E12 vg / kg or about 10E14 vg / kg. In some embodiments, administration of rAAV is accompanied by an immunomodulator, eg, prednisone, methotrexate, or a combination thereof. In some embodiments, the rAAV of the invention is packaged in an AAV XL 32 or AAV XL 32.1 capsid.

[0369] In preferred embodiments, exemplary dosages for achieving a therapeutic effect according to the methods as disclosed herein are titers of 1.2E12 to 4.0E12 vg / kg, e.g., at least about 1.0E12 vg / kg, about 1.1E12 vg / kg, about 1.2E12 vg / kg, about 1.3E12 vg / kg, about 1.4E12 vg / kg, about 1.5E12 vg / kg, about 1.6E12 vg / kg, about 1.7E12 vg / kg, about 1.8E12 vg / kg, about 1.9E12 vg / kg, about 2.0E12 vg / kg, about 2.1E12 vg / kg, about 2.2E12 vg / kg , about 2.3E12 vg / kg, about 2.4E12 vg / kg, about 2.5E12 vg / kg, about 2.6E12 vg / kg, about 2.7E12 vg / kg, about 2.8E12 vg / kg, about 2.9E12 vg / kg, about 3.0E12 vg / kg, about 3.1E12 vg / kg, about 3.2E12 vg / kg, about 3.3E12 vg / kg, about 3.4E12 vg / kg, about 3.5E12 vg / kg, about 3.6E12 vg / kg, about 3.7E12 vg / kg, about 3.8E12 vg / kg, about 3.9E12 vg / kg, about 4.0E12 vg / kg.

[0370] In a preferred embodiment, exemplary dosages for achieving a therapeutic effect according to the methods disclosed herein are titers of 1.0E11 vg / kg to 5.0E13 vg / kg, e.g., 1.0E11 vg / kg, 1.1E11 vg / kg, 1.2E11 vg / kg, 1.3E11 vg / kg, 1.4E11 vg / kg, 1.5E11 vg / kg, 1.6E11 vg / kg, 1.7E11 vg / kg, 1.8E11 vg / kg, 1.9E11 vg / kg, about 1.0E12 vg / kg, about 1.1E12 vg / kg, about 1.2E12 vg / kg, about 1.3E12 vg / kg, about 1.4E12 vg / kg, about 1.5E12 vg / kg, about 1.6E12 vg / kg, about 1.7E12 vg / kg, about 1.8E12 vg / kg, about 1 .9E12 vg / kg, about 2.0E12 vg / kg, about 3.0E12 vg / kg, about 4.0E12 vg / kg, about 5.0E12 vg / kg, about 6.0E12 vg / kg, about 7.0E12 vg / kg, about 8.0E12 vg / kg, about 9.0E12 vg / kg, about 1.0E13 vg / kg, about 1.2E13 vg / kg, about 1.2E13 vg / kg, about 1.3E13 vg / kg, about 1.4E13 vg / kg, about 1.5E13 vg / kg, about 1.6E13 vg / kg, about 1.7E13 vg / kg, about 1.8E13 vg / kg, about 1.9E13 vg / kg, about 2.0E13 vg / kg, about 3.0E13 vg / kg, about 4.0E13 vg / kg, about 5.0E13 vg / kg.

[0372] In some embodiments, exemplary dosages of the hGAA-expressing rAAV vector for use in the methods of treating Pompe disease as disclosed herein to achieve a therapeutic effect are titers of at least about 1.0E12 vg / kg to 4.0E12 vg / kg, or about 1.2E12 vg / kg to 3.0E12 vg / kg, or about 1.2E12 vg / kg to 2.5E12 vg / kg, or about 2.5E12 vg / kg to 4.0E12 vg / kg.

[0373] In some embodiments, the dosage can be adjusted by one of ordinary skill in the art, for example, when a promoter stronger than the LSP of SEQ ID NO: 97 is operably linked to the nucleic acid encoding GAA, the administered dose can be less than 1.0E12 vg / kg, or less than about 5.0E11 vg / kg. Conversely, in another embodiment, the dosage can be adjusted by one of ordinary skill in the art, for example, when a liver-specific promoter weaker than the LSP of SEQ ID NO: 97 used in the AAV8-LSPhGAA vector is operably linked to the nucleic acid encoding GAA, the administered dose of the rAAV vector can be greater than about 1.6E12 vg / kg, or greater than about 5.0E12 vg / kg. Exemplary dosages for achieving a therapeutic effect are titers of at least about 1.0E12 vg / kg. 5 vg / kg、1.0E 6 vg / kg、1.0E 7 vg / kg、1.0E 8 vg / kg、1.0E 9 vg / kg、1.0E 10 vg / kg、1.0E 11 vg / kg、1.0E 12 vg / kg, optionally about 1.0E 10 to about 1.0E 12 Transduction units (vg / kg), and optionally not more than about 4.0E 12 vg / kg, or alternatively about 3.0E 12 Transduction units (vg / kg).

[0374] In one embodiment, no percentage of the administered dose of a hGAA-expressing rAAV vector as disclosed herein remains in the liver after administration (eg, at least 1 week, 2 weeks, 3 weeks, 4 weeks, or more after administration).

[0375] In one embodiment, less than 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, %, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%.

[0376] In one embodiment, the administered rAAV vector expressing hGAA as disclosed herein has less than 1.0 E 9 vg / kg to 5.0E 11 vg / kg is retained in the liver.

[0377] In one embodiment, after administration (e.g., at least 1 week, 2 weeks, 3 weeks, 4 weeks or more after administration), the following amount of the administered rAAV vector expressing hGAA as disclosed herein remains in the liver: less than 1.0 E 9 vg / kg、1.0E 10vg / kg, 1.0E11vg / kg, 1.0E12vg / kg, 1.1E12vg / kg, 1.2E12vg / kg, 1.3E12vg / kg, 1.4E12vg / kg, 1.5E12vg / kg, 1.6E12vg / kg, 1 .7E12vg / kg, 1.8E12vg / kg, 1.9E12vg / kg, 2.0E12vg / kg, 3.0E12vg / kg, 4.0E12vg / kg, 5.0E12vg / kg, 6.0E12vg / kg, 7.0E12vg / kg, 8.0E12vg / kg, 9.0E12vg / kg, 1.0E13vg / kg, 1.2E13vg / kg, 1.2E13vg / kg, 1.2E13vg / kg, 1.3E13vg / kg, 1.4E13vg / kg, 1.5E 13vg / kg, 1.6E13vg / kg, 1.7E13vg / kg, 1.8E13vg / kg, 1.9E13vg / kg, 2.0E13vg / kg, 3.0E13vg / kg, 4.0E13vg / kg or 5.0E13vg / kg.

[0378] In further embodiments, administration of rAAV vectors or rAAV genomes according to the methods disclosed herein to treat a subject with Pompe disease can result in production of GAA protein with a blood circulation half-life of 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, or longer.

[0379] In some embodiments, the methods for treating Pompe disease as disclosed herein involve a single dose of rAAV expressing hGAA for treating a subject in a single administration. However, in some embodiments, the rAAV dose can be provided to the subject in the form of multiple administrations, for example, the rAAV dose can be divided into sub-doses and administered in multiple administrations.

[0380] In some embodiments, it is contemplated that the methods disclosed herein for treating Pompe disease can include multiple administrations of a single dose of rAAV expressing hGAA, i.e., after an initial or defined period of time following the first administration, the subject can be treated with a booster administration of rAAV expressing hGAA (i.e., a second, third, fourth, etc.) The dose of the booster administration (i.e., the second, third, fourth, or fifth, etc.) can be the same as the dose (amount) of rAAV-hGAA administered in the first administration, or can be a higher dose or a lower dose, depending on the factors mentioned above, including, but not limited to, a therapeutically effective dose for achieving any one or more of the following: (i) serum GAA levels indicative of steady-state GAA expression, (ii) reduced glycogen levels and / or maintenance of glycogen levels in muscle within a normal range, and (iii) one or more symptoms of Pompe disease, including muscle function and / or lung function within clinically stable levels. As disclosed herein, the steady state of GAA expressed by the rAAV disclosed herein is a serum level of GAA within the pharmacologically active range of 165 nmol / mL / hr to ≤2260 nmol / mL / hr or 189 nmol / mL / hr to ≤2260 nmol / mL / hr. The stability of one or more symptoms of Pompe disease can be determined by the clinical stability parameters disclosed herein and include a stable state of 6MWT (6-minute walk test) and / or FVC (forced vital capacity) in two consecutive assessments at an interval of not less than 3 months as disclosed herein. In some embodiments, the clinically stable level of motor function determined by the 6MWT is a decrease of ≤12%, or a decrease of less than 43 m from baseline in two consecutive assessments at an interval of not less than 3 months. In some embodiments, the clinically stable level of pulmonary function, as determined by FVC% predicted in an upright position, decreases from baseline by ≤15% in two consecutive assessments at an interval of not less than 3 months.

[0381] In embodiments, according to the methods for treating Pompe disease as disclosed herein, the time period between the first administration of the rAAV vector and the subsequent administration (i.e., booster administration) is selected from any of the following: about 4 months, about 6 months, about 7 months, about 8 months, about 9 months, about 12 months, about 18 months, about 24 months, or about 3 years, about 4 years, about 5 years, or more than 5 years.

[0382] In another embodiment, administration of a rAAV vector or rAAV genome as disclosed herein for treating Pompe disease results in weight gain, e.g., at least 0.5 pounds, at least 1 pound, at least 1.5 pounds, at least 2 pounds, at least 2.5 pounds, at least 3 pounds, at least 3.5 pounds, at least 4 pounds, at least 4.5 pounds, at least 5 pounds, at least 5.5 pounds, at least 6 pounds, at least 6.5 pounds, at least 7 pounds, at least 7.5 pounds, at least 8 pounds, at least 8.5 pounds, at least 9 pounds, at least 9.5 pounds, at least 10 pounds, at least 10.5 pounds, at least 11 pounds, at least 11.5 pounds, at least 12 pounds, at least 12.5 pounds, at least 13 pounds, at least 13.5 pounds, at least 14 pounds, at least 14.5 pounds, at least 15 pounds, at least 20 pounds, at least 25 pounds, at least 30 pounds, at least 50 pounds.

[0383] In another embodiment, AAVGAA of any serotype as disclosed herein for use in treating Pompe disease causes weight gain, e.g., from 0.5 lbs to 50 lbs, from 0.5 lbs to 30 lbs, from 0.5 lbs to 25 lbs, from 0.5 lbs to 20 lbs, from 0.5 lbs to 15 lbs, from 0.5 lbs to 10 lbs, from 0.5 lbs to 7.5 lbs, from 0.5 lbs to 5 lbs, from 1 lb to 15 lbs, from 1 lb to 10 lbs, from 1 lb to 7.5 lbs, from 1 lb to 5 lbs, from 2 lbs to 10 lbs, from 2 lbs to 7.5 lbs. B. Stop long-term ERT

[0384] Treatment of Pompe disease is typically performed by administering long-term enzyme replacement therapy (ERT) using recombinant human acid α-glucosidase (rhGAA), and has previously been reported to prolong the survival of both LOPD and IOPD patients by improving lung and muscle function. However, Schoser et al. reported that after a period of stabilization, these parameters continued to decline over time (see Schoser et al., 2017 Neurol, 264: 621-30). In addition, ERT using recombinant GAA protein has many disadvantages, including but not limited to the short half-life of the administered recombinant GAA in the blood, the lack of effective skeletal muscle uptake, the possibility of a high titer antibody response, and even some patients do not respond to ERT, as well as the strict administration of recombinant GAA infusions every 2 weeks (which can take 5 to 8 hours). Furthermore, although disease progression is slower compared to untreated subjects, the benefits of ERT may not be durable, and many patients die or remain debilitated despite high treatment compliance (Tarnopolsky et al., 2016 Can J Neurol Sci, 43:472-85).

[0385] The reduced efficacy of subjects receiving recombinant GAA protein ERT is partly due to the immune response to ERT, in which high and persistent anti-GAA antibody titers (HSAT) are formed. Compared with patients who do not form antibodies or only form low-titer antibodies, subjects with HSAT show a greatly increased mortality rate (Banugaria et al., 2011). In addition, the ability to use immunosuppression to prevent antibody formation in subjects at risk of HSAT (which significantly prolongs survival) confirms the clinical relevance of HSAT (Mendelsohn et al., 2009; Banugaria et al., 2013; Kazi et al., 2017).

[0386] If subjects with Pompe disease have residual GAA enzyme activity, they are considered cross-reactive immune material (CRIM) positive; if no residual GAA activity is detected, they are considered CRIM negative. Based on aggregated clinical research data, 28% of Pompe disease cases are infantile, of which approximately 85% are classic infantile, and three-quarters of these are CRIM positive (Kemper, Comeau, & Green, 2013). Determining CRIM status in newly diagnosed IOPD patients is important because this allows for preventive immunomodulatory measures to be taken before initiating ERT, thereby compensating for the most severe damaging effects of HSAT. CRIM-negative Pompe disease subjects develop HSAT and show significantly reduced efficacy of ERT using rhGAA (Amalfitano et al., 2001). In the first pilot study of ERT for Pompe disease using Chinese hamster ovary cell-derived rhGAA, two CRIM-negative subjects developed higher anti-GAA antibody titers than a third CRIM-positive subject. This corresponds to a significantly reduced efficacy of ERT in CRIM-negative subjects. The relevance of antibody formation to therapeutic efficacy in Pompe disease is underscored by the poor response to ERT in CRIM-negative subjects, which is associated with the development of HSAT (Kishnani et al., 2010).

[0387] Although no LOPD subjects are CRIM-negative, some develop high antibody responses to rhGAA, which can interfere with optimal ERT efficacy (Patel et al., 2012; de Vries et al., 2017, “LUMIZYME Prescribing Information,” 2014). Furthermore, all Pompe disease subjects develop some degree of anti-GAA antibody response, the impact of which on ERT efficacy is unclear.

[0388] In some embodiments, a rAAV vector expressing a GAA polypeptide as disclosed herein can be used in a method of treating a subject with Pompe disease, comprising administering an AAV expressing hGAA as disclosed herein, thereby enabling the subject to discontinue administration of long-term ERT for an extended period of time. In particular, a rAAV vector expressing a GAA polypeptide as disclosed herein can be administered to a subject with Pompe disease, thereby enabling the subject to reduce or eliminate the clinical need for long-term hGAA ERT for an extended period of time.

[0389] Thus, another aspect of the technology disclosed herein relates to a method for treating Pompe disease by administering a composition comprising a rAAV vector expressing a GAA polypeptide disclosed herein to a subject suffering from Pompe disease, wherein, in some embodiments, the method enables a subject suffering from Pompe disease to stop or discontinue long-term administration of recombinant human GAA (rhGAA) ERT (which is typically administered on a weekly or biweekly schedule). In some embodiments, if a subject is administered a specific dose of an AAV vector expressing a GAA polypeptide as disclosed herein, the method disclosed herein enables a subject suffering from Pompe disease to rest for a long period of time in a normal ERT schedule (e.g., long-term discontinuation of ERT). In some embodiments, discontinuation of long-term ERT begins at about the time the AAV vector is administered to the subject (e.g., the day before, the day of administration, or the day after administration); or in some embodiments, discontinuation of long-term ERT may occur at about 24 weeks after administration of the AAV vector, or at any time between about 24 and 26 weeks after administration.

[0390] As disclosed herein, "long-term ERT" refers to the standard of care treatment for subjects with Pompe disease, including IOPD and LOPD, and generally comprises a regimen of regular and frequent (e.g., weekly or biweekly) intravenous administration of recombinant human alglucosidase alpha protein (rhGAA) to the subject without any breaks in the regimen, and wherein the administered rhGAA protein provides an exogenous source of GAA. (alglucosidase alfa) was the first product approved in the United States for the treatment of Pompe disease in 2006, and (alglucosidase alfa) is an exemplary current standard of care (SOC) treatment for patients with infantile and late-onset Pompe disease. The normal dosing regimen for long-term ERT is intravenous administration of alglucosidase alfa at a dose of 20 mg / kg as an infusion every two weeks (LUMIZYME Prescribing Information 2014).

[0391] As disclosed herein, in some embodiments, the methods disclosed herein, performed by administering an AAV expressing hGAA disclosed herein, allow for the discontinuation or cessation of administration of long-term ERT for an extended period of time. In some embodiments, the extended period of time is at least about 3 months, or at least about 6 months, or at least about 1 year, or more than 1 year.

[0392] As disclosed herein, with reference to a period of time for discontinuation of administration of long-term ERT, a "long period of time" refers to a period of time longer than 1 month, and in some embodiments, longer than missing up to 5 administrations of ERT.

[0393] Thus, in some embodiments, methods for treating a subject with Pompe disease using an AAV expressing hGAA disclosed herein comprise administering to the subject a pharmaceutical composition comprising an AAV expressing GAA, and wherein the subject is not administered long-term GAA enzyme replacement therapy (ERT) for an extended period of time. In some embodiments, the discontinuation or cessation of administration of long-term ERT occurs at any time between 1-2 days and at least 24 weeks after administration of the AAV-GAA vector. That is, in some embodiments, the treated subject can stop administration of ERT on the day of, before, or after administration of AAV-GAA. In some embodiments, a subject treated according to the methods disclosed herein can stop ERT after about 1 week, or about 2 weeks, or about 3 weeks, or about 1 month, or about 2 months, or about 3 months, or about 4 months, or about 5 months, or about 6 months after administration of AAV-GAA.

[0394] According to the methods disclosed herein, the exact timeline for discontinuation of ERT or cessation of ERT for each subject can be determined by one of ordinary skill, but without wishing to be bound by theory, encompassed herein are methods of treating a subject with Pompe disease by administering an AAV expressing hGAA, wherein ERT is discontinued at a time point when the serum level of GAA achieved by expression of AAV-hGAA is close to or about a serum level within the pharmacologically active range of at least 165 nmol / mL / hr or at least 189 nmol / mL / hr (e.g., 189 nmol / mL / hr to ≤2260 nmol / mL / hr). In some embodiments, encompassed herein are methods wherein ERT is discontinued at a time point when the serum level of GAA achieved by expression of AAV-hGAA is within 50%, or within 60%, or within 70%, or within 80% of the serum level within the pharmacologically active range of 189 nmol / mL / hr. In some embodiments, contemplated herein are methods of treating Pompe disease by administering an AAV expressing an hGAA polypeptide, wherein ERT is discontinued at a time point when GAA serum levels achieved by expression of AAV-hGAA are within 50%, or within 60%, or within 70%, or within 80% of the pharmacologically active range of 165 nmol / mL / hr to about 2000 nmol / mL / hr.

[0395] In some embodiments, contemplated herein are methods of treating Pompe disease by administering an AAV expressing an hGAA polypeptide as disclosed herein, wherein ERT is discontinued at a time point such that GAA serum levels achieved by a normal ERT regimen are replaced by GAA serum levels achieved by expression of AAV-hGAA. For example, as serum GAA levels due to recombinant hGAA from a previous ERT administration decrease, serum GAA levels achieved by expression of AAV-hGAA simultaneously increase, such that discontinuation or cessation of ERT does not result in a decrease in clinical stability of one or more symptoms of Pompe disease in the subject, as measured by 6MWT or FVC according to the methods disclosed herein. For illustrative purposes only, in some embodiments, ERT discontinuation or cessation occurs when the administered AAV-hGAA results in expressed GAA reaching a GAA serum level that is clinically stable for one or more symptoms of Pompe disease in the subject, e.g., a clinically stable level of motor function as determined by the 6MWT of ≤12% decrease, or a decrease of ≤43 m from baseline on two consecutive assessments no less than 3 months apart, or a clinically stable level of pulmonary function as determined by FVC% in the upright position of ≤15% decrease from baseline on two consecutive assessments no less than 3 months apart, thereby rendering recombinant hGAA from the last ERT administration superfluous.

[0396] In some embodiments, the methods of treating Pompe disease as disclosed herein by administering an AAV expressing an hGAA polypeptide as disclosed herein enable long-term discontinuation of ERT for a period of about 1 year, or about 15 months, or about 18 months, or about 24 months, or about 30 months, or greater than 30 months, while maintaining clinical stabilization of one or more symptoms of Pompe disease as measured by 6MWT and / or FVC%.

[0397] Thus, the rAAV vectors encoding GAA polypeptides as disclosed herein and the methods as disclosed herein provide significant advantages for subjects with Pompe disease, including, but not limited to, reducing or eliminating the rigorous and arduous weekly or biweekly infusions of long-term rhGAA ERT treatment, which is significantly time-consuming and geographically limited, and prevents patients with Pompe disease from traveling for extended periods of time away from the area where they are given ERT infusions. Furthermore, as disclosed herein, the absence of ERT administration also reduces any side effects due to anti-rhGAA antibodies to ERT and also avoids the need to administer immunosuppressants that are typically co-administered with ERT. Thus, the methods disclosed herein for treating Pompe disease by administering AAV expressing hGAA polypeptides create greater flexibility in the treatment of Pompe disease and improve the quality of life and lifestyle of subjects with Pompe disease. C. Administration of Supplemental ERT

[0398] In some embodiments, the methods disclosed herein for treating Pompe disease by administering an AAV vector expressing an hGAA polypeptide allow a subject to take a break or "vacation" from the normal long-term ERT regimen. That is, according to the methods disclosed herein, a subject administered an AAV vector expressing GAA disclosed herein can be free of long-term ERT for an extended period of time. In addition, in some embodiments, after an initial period of discontinuation of long-term ERT administration for an extended period of time, a subject administered an AAV vector expressing GAA disclosed herein can be administered supplemental ERT, wherein the supplemental ERT is administered about 6 months, or about 1 year, or more than 1 year after discontinuation of long-term ERT. Thus, the methods disclosed herein for treating Pompe disease by administering an AAV vector expressing an hGAA polypeptide allow for flexibility in the normal long-term ERT regimen, allowing for extended breaks or absences in the administration of long-term ERT without resulting in clinical decline—that is, the subject remains clinically stable despite the lack of ongoing long-term ERT administration for an extended period of time.

[0399] In some embodiments, the methods disclosed herein for treating Pompe disease by administering AAV expressing hGAA polypeptides encompass the re-administration of ERT after a prolonged period of cessation of ERT administration (referred to herein as "supplemental ERT"), and allow for flexibility in the normal ERT regimen, as the continued production of GAA expressed by AAV allows for the inclusion of ERT flexibility. In some embodiments, the supplemental ERT is a pulsed administration of ERT, as disclosed herein. In some embodiments, the supplemental ERT is administered at shorter intervals, at lower doses, at irregular doses, or at irregular intervals, compared to the prior long-term ERT administration.

[0400] In some embodiments, the methods of treating Pompe disease by administering an AAV expressing an hGAA polypeptide as disclosed herein encompass resuming ERT after at least 6 months to about 1 year without long-term ERT administration (referred to herein as "supplemental ERT"). In some embodiments, the supplemental ERT can be short-term and can be followed by discontinuation of a second, long-term period of ERT administration. In some embodiments, the supplemental ERT can continue for any period of time between 3 months and about 2 years, such as about 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, or about 1 year.

[0401] In some embodiments, the methods of treating Pompe disease by administering an AAV expressing an hGAA polypeptide as disclosed herein encompass administering rAAV expressing GAA to a subject with Pompe disease, wherein long-term ERT is continued after administration of the recombinant AAV. However, the dose and / or frequency of ERT is lower than before administration of the recombinant AAV vector. For example, after administration of the AAV vector, long-term ERT can be administered once every 3 weeks, once a month, once every two months, once every 3 months, once every 4 months, once every 5 months, or once every 6 months, for at least 24 weeks after administration of the AAV-GAA. In one embodiment, the dose of long-term ERT can be reduced. In one method, a pulsed administration regimen of long-term ERT can be employed after administration of the AAV vector, thereby enabling the use of irregular dosing schedules and / or amounts. As discussed herein, in some embodiments, administration of long-term ERT as disclosed herein can be stopped at 24 weeks or earlier.

[0402] In some embodiments, because the administered AAV vectors continuously express GAA, the methods disclosed herein allow for flexibility in the administration of long-term ERT or supplemental ERT, such that if a subject plans to skip, or inadvertently or accidentally skips one or more ERT doses of a long-term ERT or supplemental ERT regimen, the subject will remain clinically stable. Currently, if ERT is missed, a larger amount of ERT is required to return to the same clinical level.

[0403] In some embodiments, the supplemental ERT is administered less frequently, at a lower dose, at irregular doses, or at irregular intervals compared to the prior long-term ERT administration. For example, in some embodiments, the dose of rhGAA administered in the supplemental ERT is less than 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, 2%, or 1% of the normal dose of rhGAA administered in a long-term ERT regimen.

[0404] In some embodiments, the supplemental ERT is administered as a pulse administration. In alternative embodiments, the conventional dosing regimen of long-term ERT administration or supplemental ERT can be interrupted or stopped as a subject is administered an rAAV vector composition disclosed herein, wherein the long-term ERT or supplemental ERT is administered by pulse administration. For example, in some embodiments, the administration of long-term ERT or supplemental ERT can be administered by pulse administration. In certain embodiments, a subject administered a composition can have pulse administration of long-term ERT or supplemental ERT.

[0405] In certain embodiments, pulses of supplemental ERT are appropriate, provided that the subject has been administered an AAV vector composition as disclosed herein at a dose sufficient to maintain sustained expression of GAA to maintain clinical stability and / or to maintain serum GAA levels at or above 189 nmol / hr* (e.g., during an "ERT holiday" or the entire period of ERT cessation when regularly scheduled ERT is not administered). In certain embodiments, the methods disclosed herein allow a subject to undergo pulses of supplemental ERT throughout the subject's lifetime.

[0406] In some embodiments, the administration regimen of supplemental ERT can have intermittent breaks during which the administration of ERT is discontinued (eg, "ERT holidays" or periods of discontinuation during which the administration regimen of ERT is discontinued).

[0407] In some embodiments, the methods encompass administration of supplemental ERT by pulse administration, wherein the pulse administration of supplemental ERT occurs at least monthly, at least every other month, or at least every 6 months, or at least annually, or every other year. Because the methods disclosed herein comprise administering an AAV vector at a sufficient dose to continuously express GAA in a subject and maintain serum GAA levels at or above 189 nmol / hr*, if supplemental ERT is administered, pulse administration can substantially reduce the amount of ERT administered to the patient per dose or per entire treatment regimen, while improving efficacy and allowing for increased flexibility in the ERT administration regimen. This significantly saves time, effort, and expense, and more importantly, improves the quality of life for Pompe disease patients, while lower ERT doses can reduce any side effects, including anti-GAA antibodies to the administered rhGAA protein.

[0408] In some embodiments, the administration of supplemental ERT is pulse administration. In certain embodiments, the pulse administration comprises administering supplemental ERT for about 8 weeks, followed by about 4 weeks without administering supplemental ERT. In some embodiments, the pulse administration comprises administering supplemental ERT for about 6 weeks (i.e., 6 weekly infusions, or 3 infusions every two weeks), followed by about 2 weeks without administering supplemental ERT. In certain embodiments, the pulse administration comprises administering supplemental ERT for about 4 weeks, followed by about 2 weeks without administering supplemental ERT. In some embodiments, the pulse administration comprises administering supplemental ERT for about 2 weeks, followed by about 2 weeks without administering supplemental ERT. D. No long-term immune suppression

[0409] In another aspect, the technology relates to methods of treating Pompe disease by administering an AAV expressing an hGAA polypeptide as disclosed herein, wherein the composition comprising the AAV-GAA vector is administered to a subject without ongoing immunosuppression. That is, in some embodiments, immunosuppression is not administered to the subject chronically.

[0410] In some embodiments, an immunosuppressant or immunomodulator is administered intermittently or transiently to a subject, e.g., as an immunoprophylaxis to prevent or reduce any immune response to the administered AAV vector, thereby allowing subsequent or booster administration of a GAA-expressing AAV vector according to the methods disclosed herein, if needed.

[0411] In some embodiments, the immunomodulator is administered to the subject at or about the time of administration of the GAA-expressing AAV vector disclosed herein, for an initial period. For example, administration of the immunomodulator begins about 24 hours before administration of the GAA-expressing AAV vector to the subject. In some embodiments, administration of the immunomodulator begins about 24 hours before AAV administration and is administered for at least 1 day, or at least 2 days, or at least 3 days, or at least 4 days, or at least 5 days, or at least 6 days, or about 1 week, or more than 1 week after administration of the GAA-expressing AAV vector. In some embodiments, administration of the immunomodulator begins at or about 24 hours before AAV administration and is administered for no more than 1 day, or 2 days, 3 days, or 4 days, or 5 days, or 6 days, or 1 week, or 2 weeks, or 3 weeks, or 1 month after administration of the GAA-expressing AAV vector.

[0412] In some embodiments, the immunomodulator is administered to the subject at a gradually decreasing dose, e.g., at a first dose for a first time period, at a second, lower dose for a second time period, and at a third dose lower than the second dose for a third time period, and so on, until no immune response to AAV or GAA is generated. For example, in some embodiments, a first dose of the immunomodulator is initiated at or about 24 hours prior to administration of the AAV and is administered for at least 1 day, or at least 2 days, or at least 3 days, or at least 4 days, or at least 5 days, or at least 6 days, or about 1 week, or about 2 weeks, or about 3 weeks, or about 4 weeks, and then the immunomodulator is reduced to a third dose (lower than the second dose) for a third time period (e.g., at least 1 day, or at least 2 days, or at least 3 days, or at least 4 days, or at least 5 days, or at least 6 days, or about 1 week).

[0413] For purposes of example only, in some embodiments, the methods for treating Pompe disease as disclosed herein include administering prednisone as an immunosuppressant (i.e., immunoprophylaxis) at an initial dose of 60 mg (orally) starting 24 hours prior to AAV vector administration. In some embodiments, prednisone is administered orally at 60 mg per day until the end of the fourth week after vector administration, after which, at the beginning of the fifth week, the dose of prednisone is reduced to a second dose level of 55 mg orally per day and maintained for 7 days. In some embodiments, at the beginning of the sixth week, the dose is reduced to a third dose level of 50 mg orally per day and maintained for 7 days, and so on, such that after the four-week initial immunosuppressant dose, the dose of the immunosuppressant (i.e., prednisone) is reduced by 5 mg / day per week.

[0414] The use of prednisone as an immunosuppressant is exemplified herein for immunoprophylaxis according to the methods disclosed herein. However, it is contemplated that prednisone may be replaced by different immunomodulators and administration regimens known to those of ordinary skill in the art.

[0415] In some embodiments, normal immunoprophylaxis to prevent immune reactivity to expressed GAA is stopped or discontinued on day 1, shortly before, or shortly after administration of rAAV expressing GAA according to the methods as disclosed herein. (i) Immunomodulation and immunosuppression:

[0416] As disclosed herein, in some embodiments, the method of treating Pompe disease is performed by administering an AAV expressing hGAA polypeptide disclosed herein without the need for ongoing immunosuppression. That is, in some embodiments, immunosuppression is not administered to a subject over a long period of time, and is administered only for a short and predetermined period of time, including an initial period (using an initial dose) and a tapering period (using a gradually decreasing dose) after administration of an AAV vector expressing GAA to a subject. Thus, in some embodiments, immunosuppression is administered for 4 weeks to up to about 15 weeks after administration of an AAV vector expressing GAA, and can be administered at an initial dose and a tapering dose as disclosed herein.

[0417] Thus, in some embodiments, the methods and compositions for treating Pompe disease using the AAV vectors and AAV genomes as described herein further comprise administering an immunomodulatory agent for an initial period and a subsequent taper period. In some embodiments, the immunomodulatory agent can be administered at the time of, before, or after administration of the rAAV vector.

[0418] In any embodiment of the methods and compositions disclosed herein, the subject to which the rAAV vector or rAAV genome disclosed herein is administered is also administered an immunosuppressant. Known methods cause the suppression of the immune response of patients administered AAV. Methods known in the art include administering an immunosuppressant, such as a proteasome inhibitor, to the patient. For example, a type of such proteasome inhibitor known in the art is bortezomib disclosed in, for example, U.S. Patent No. 9,169,492 and U.S. Patent Application No. 15 / 796,137, both of which are incorporated herein by reference. In another embodiment, the immunosuppressant can be an antibody, including polyclonal, monoclonal, scFv or other antibody-derived molecules capable of suppressing an immune response (e.g., by eliminating or suppressing antibody-producing cells). In a further embodiment, the immunosuppressive element can be a short hairpin RNA (shRNA). In this embodiment, the coding region of the shRNA is contained in the rAAV box and is generally located downstream (3′ of the poly-A tail). shRNAs can be targeted to reduce or eliminate the expression of immunostimulatory agents such as cytokines, growth factors (including transforming growth factor β1 and β2, TNF, and others known to the public).

[0419] In some embodiments, the immunomodulator is an immunoglobulin degrading enzyme, such as IdeS, IdeZ, IdeS / Z, Endo S, or a functional variant thereof. Non-limiting examples of references to these immunoglobulin degrading enzymes and their uses are described in US 7,666,582, US 8,133,483, US20180037962, US 20180023070, US 20170209550, US 8,889,128, WO2010 / 057626, US 9,707,279, US 8,323,908, US 20190345533, US20190262434, and WO2020 / 016318, each of which is incorporated herein by reference in its entirety.

[0420] In some embodiments, the immunomodulator or immunosuppressant is a proteasome inhibitor. In certain aspects, the proteasome inhibitor is bortezomib. In some aspects of this embodiment, the immunomodulator includes bortezomib and the anti-CD20 antibody rituximab. In other aspects of this embodiment, the immunomodulator includes bortezomib, rituximab, methotrexate and intravenous gamma globulin. Non-limiting examples of such references disclosing proteasome inhibitors and their combinations with rituximab, methotrexate and intravenous gamma globulin are described in US 10,028,993, US 9,592,247 and US 8,809,282, each of which is incorporated herein by reference in its entirety. One such proteasome inhibitor known in the art (e.g., disclosed in U.S. Patent No. 9,169,492 and U.S. Patent Application No. 15 / 796,137) is bortezomib, both of which are incorporated herein by reference.

[0421] In another embodiment, the immunosuppressant can be an antibody, including polyclonal, monoclonal, scFv or other antibody-derived molecules that can suppress an immune response (e.g., by eliminating or suppressing antibody-producing cells). In a further embodiment, the immunosuppressive element can be a short hairpin RNA (shRNA). In this embodiment, the coding region of the shRNA is contained in the rAAV box and is generally located downstream (3' of the poly-A tail). The shRNA can be targeted to reduce or eliminate the expression of immunostimulants, such as cytokines, growth factors (including transforming growth factor β1 and β2, TNF and other publicly known factors).

[0422] In an alternative embodiment, the immunomodulator is an inhibitor of NF-κB pathway. In some aspects of this embodiment, the immunomodulator is rapamycin or a functional variant thereof. The non-limiting examples of the references disclosing rapamycin and its uses (such as described in US 10,071,114, US 20160067228, US 20160074531, US 20160074532, US20190076458, US10,046,064) are incorporated into their entirety. In other aspects of this embodiment, the immunomodulator is a synthetic nanocarrier containing an immunosuppressant. Non-limiting examples of references for immunosuppressants, immunosuppressants coupled to synthetic nanocarriers, synthetic nanocarriers containing rapamycin and / or tolerogenic synthetic nanocarriers, their dosages, administration and uses are US 20150320728, US 20180193482, US 20190142974, US 20150328333, US 20160243253, US 10,039,822, US 20190076522, US 20160022650, US 10,441,651, US 10,420,835, US 20150320870, US 2014035636, US 10,434,088, US 10,335,395, US 20200069659, US 10,357,483, US 20140335186, US 10,668,053, US 10,357,482, US 20160128986, US 20160128987, US 20200038462, US 20200038463, each of which is incorporated by reference in its entirety.

[0423] In some embodiments, the immunomodulatory agent is a synthetic nanocarrier containing rapamycin (ImmTOR TM Nanoparticles) (Kishimoto et al., 2016, Nat Nanotechnol, 11(10):890-899; Maldonado et al., 2015, PNAS, 112(2):E156-165), as disclosed in US20200038463, U.S. Patent 9,006,254, each of which is incorporated herein in its entirety. In some embodiments, the immunomodulator is an engineered cell, for example, an immune cell modified using SQZ technology as disclosed in WO2017192786, which is incorporated herein by reference in its entirety.

[0424] In some embodiments, the immunomodulator is selected from the group consisting of poly-ICLC, 1018 ISS, aluminum salts, Amplivax, AS15, BCG, CP-870,893, CPG7909, CyaA, dSLIM, GM-CSF, IC30, IC31, Imiquimod, ImuFact IMP321, IS Patch, ISS, ISCOMATRIX, Juvlmmune, LipoVac, MF59, monophosphoryl lipid A, Montanide IMS1312, Montanide ISA 206, Montanide ISA 50V, Montanide ISA-51, OK-432, OM-174, OM-197-MP-EC, ONTAK, PEPTEL, carrier systems, PLGA microparticles, resiquimod, SRL172, virosomes and other virus-like particles, YF-17D, VEGF trap, R848, beta-glucan, Pam3Cys and Aquila's QS21stimulon. In yet further embodiments, the immunomodulator or adjuvant is poly-ICLC.

[0425] In some embodiments, immunomodulators are small molecules that inhibit the innate immune response in cells, such as chloroquine (a TLR signaling inhibitor) and 2-aminopurine (a PKR inhibitor), and can also be administered in a composition comprising at least one rAAV disclosed herein. Some non-limiting examples of commercially available TLR signaling inhibitors include BX795, chloroquine, CLI-095, OxPAPC, polymyxin B, and rapamycin (all available from INVIVOGEN). TM In addition, inhibitors of pattern recognition receptors (PRRs) involved in innate immune signaling, such as 2-aminopurine, BX795, chloroquine, and H-89, can also be used in the compositions and methods comprising at least one rAAV vector disclosed herein for in vivo protein expression disclosed herein.

[0426] In some embodiments, the rAAV vector may also encode a negative regulator of innate immunity, such as NLRX1. Thus, in some embodiments, the rAAV vector may also optionally encode one or more of NLRX1, NS1, NS3 / 4A, or A46R, or any combination thereof. Furthermore, in some embodiments, the composition comprising at least one rAAV vector as disclosed herein may further comprise a synthetic modified RNA encoding an inhibitor of the innate immune system to prevent the innate immune response generated by a tissue or subject.

[0427] In some embodiments, the immunomodulator for administering as disclosed herein is an immunosuppressant. As used herein, the term "immunosuppressive drug or agent" is intended to include agents that inhibit or interfere with normal immune function. Examples of immunosuppressants compatible with the methods disclosed herein include agents that inhibit T cell / B cell costimulatory pathways, such as agents that interfere with the coupling of T cells and B cells through CTLA4 and B7 approaches, as disclosed in U.S. Patent Publication No. 2002 / 0182211. In one embodiment, the immunosuppressant is cyclosporine A. Other examples include mycophenolate mofetil, rapamycin, and antithymocyte globulin. In one embodiment, according to the method for administering as disclosed herein, the immunosuppressive drug is administered with a composition comprising at least one rAAV vector as disclosed herein, or can be administered with a separate composition, but simultaneously with a composition comprising at least one rAAV vector, or before or after it is administered. The immunosuppressive drug is administered with a formula compatible with the administration route, and is administered to the subject in a dosage sufficient to achieve the desired therapeutic effect. In some embodiments, an immunosuppressive drug is administered transiently and for a time sufficient to induce tolerance to a rAAV vector as disclosed herein.

[0428] It is known that a variety of methods can cause the suppression of the immune response of patients given AAV. Methods known in the art include administering immunosuppressants, such as proteasome inhibitors, to patients. For example, a type of such proteasome inhibitor known in the art (such as disclosed in U.S. Patent No. 9,169,492 and U.S. Patent Application No. 15 / 796,137) is bortezomib, both of which are incorporated herein by reference. In some embodiments, the immunosuppressant can be an antibody, including polyclonal, monoclonal, scFv or other antibody-derived molecules that can suppre...

Claims

1. A recombinant adenovirus-associated (rAAV) vector comprising in its genome: a. 5' and 3' AAV inverted terminal repeat (ITR) sequences, and b. a heterologous nucleic acid sequence located between the 5' and 3' ITRs, the heterologous nucleic acid sequence encoding all or part of an endogenous GAA signal peptide, a heterologous signal peptide and an α-glucosidase (GAA) polypeptide, in, The GAA polypeptide comprises amino acid residues 28-952 of SEQ ID NO: 1, amino acid residues 57-952 of SEQ ID NO: 1, or an N-terminal GAA polypeptide fragment comprising amino acid residues 28, 28-29, 28-30, 28-31, 28-32, or 28-33 of SEQ ID NO: 1 and a deletion of any number of amino acids from about 5 amino acids to about 40 amino acids immediately following the N-terminal GAA polypeptide fragment of SEQ ID NO: 1, wherein the heterologous signal peptide may be inserted directly after the N-terminal GAA polypeptide fragment and before the remaining amino acids of the GAA polypeptide, wherein the heterologous signal peptide is optionally fused to amino acid position 57 of the remaining amino acids of the GAA polypeptide, and wherein the GAA polypeptide may extend to amino acid 952 of SEQ ID NO: 1 or a functional fragment thereof, and wherein the nucleic acid sequence encoding the GAA polypeptide may be codon-optimized, and wherein the heterologous nucleic acid is operably linked to a liver-specific promoter.

2. The recombinant AAV vector according to claim 1, wherein The codon-optimized nucleic acid sequence encoding the GAA polypeptide is selected from the group consisting of SEQ ID NO: 1-SEQ ID NO: 18 or a functional fragment thereof.

3. The recombinant AAV vector according to claim 1, wherein The nucleic acid encoding SEQ ID NO: 3 is wild-type.

4. The recombinant AAV vector of claim 1, further comprising at least one of a UTR or an inverted RNA pol II terminator sequence.

5. The recombinant AAV vector according to claim 1, comprising the nucleic acid sequence of SEQ ID NO: 23 or a functional variant thereof.

6. The recombinant AAV vector according to claim 1, wherein The heterologous nucleic acid sequence encodes a GAA protein, which comprises a signal peptide fused to the GAA polypeptide, wherein the signal peptide is an endogenous GAA signal peptide, or a heterologous signal peptide, or a combination thereof.

7. The recombinant AAV vector according to any one of claims 1 to 6, wherein The AAV genome comprises, in a 5' to 3' orientation: a.5'ITR; b. Liver-specific promoter sequence; c.5'UTR sequence; d. a nucleic acid encoding part or all of an endogenous GAA signal peptide; e. a nucleic acid encoding a heterologous signal peptide or the N-terminal GAA polypeptide fragment; f. a nucleic acid encoding an α-glucosidase (GAA) polypeptide, wherein the GAA polypeptide is functionally active; g. poly A sequence; and h. Reverse RNA pol II terminator sequence.

8. The recombinant AAV vector according to any one of claims 1 to 7, wherein The UTR is either 5' or 3'.

9. The recombinant AAV vector according to any one of claims 1 to 8, wherein The nucleic acid encoding the signal peptide encodes a signal sequence selected from any one of the following: endogenous GAA signal peptide, fibronectin signal peptide (FN1), IL-2wt signal peptide, modified IL-2 signal peptide, IL2 (1-3) signal peptide, IgG signal peptide, AAT signal peptide, A2M signal peptide or PZP signal peptide or active fragments thereof having signal peptide activity.

10. The recombinant AAV vector according to any one of claims 1 to 9, wherein The nucleic acid sequence encodes a GAA polypeptide having the amino acid sequence of SEQ ID NO: 1 or a polypeptide having at least 80% sequence identity with SEQ ID NO: 1, wherein the amino acid residue at position 199 is R (199R), the amino acid residue at position 223 is H (223H), and the amino acid residue at position 780 is I (780I).

11. The recombinant AAV vector according to any one of claims 1 to 10, wherein The nucleic acid sequence encoding the GAA polypeptide is SEQ ID NO: 3, or a nucleic acid sequence encoding a GAA polypeptide having at least 80% sequence identity with SEQ ID NO: 1 and having at least 80%, at least 85%, or at least 90% sequence identity with SEQ ID NO: 3, wherein the amino acid residue at position 199 is R (199R), the amino acid residue at position 223 is H (223H), and the amino acid residue at position 780 is I (780I).

12. The recombinant AAV vector according to any one of claims 1 to 10, wherein The 5'UTR sequence comprises SEQ ID NO:41 or a nucleic acid having at least 80% sequence identity to SEQ ID NO:

41.

13. The recombinant AAV vector according to any one of claims 1 to 11, wherein The 5'UTR sequence comprises SEQ ID NO:40 or a nucleic acid having at least 80% sequence identity to SEQ ID NO:

40.

14. The recombinant AAV vector according to any one of claims 1-13, further comprising an intron sequence located 5' to the nucleic acid sequence encoding the signal peptide and 3' to the promoter.

15. The recombinant AAV vector according to claim 14, wherein The intron sequence is selected from the group consisting of: MVM sequence, HBB2 sequence, CMVIE intron sequence, UBC intron sequence or SV40 sequence.

16. The recombinant AAV vector according to any one of claims 1 to 15, wherein The GAA polypeptide is an N-terminally truncated GAA polypeptide selected from any one disclosed in Table 1.

17. The recombinant AAV vector according to any one of claims 1-16, further comprising at least one poly A sequence located 3' to the nucleic acid encoding the GAA gene and 5' to the 3' ITR sequence.

18. The recombinant AAV vector according to any one of claims 1 to 17, wherein The heterologous nucleic acid sequence further comprises a 3'UTR sequence or an RNA pol II terminator sequence, wherein the 3'UTR sequence is located 3' to the nucleic acid encoding the GAA polypeptide and 5' to the 3'ITR sequence, or is located between the nucleic acid encoding the GAA polypeptide and the poly A sequence.

19. The recombinant AAV vector according to any one of claims 1 to 18, wherein The heterologous nucleic acid sequence further comprises a 3' intron sequence or an RNA pol II terminator sequence, wherein the 3' intron sequence is located 3' to the nucleic acid encoding the GAA polypeptide and 5' to the 3' ITR sequence, or is located between the nucleic acid encoding the GAA polypeptide and the poly A sequence.

20. The recombinant AAV vector according to any one of claims 1 to 19, wherein The ITRs contain insertions, deletions or substitutions.

21. The recombinant AAV vector according to claim 20, wherein One or more CpG islands in the ITR are removed.

22. The recombinant AAV vector according to any one of claims 1 to 21, wherein a. The nucleic acid encoding the signal peptide is selected from any one of the group consisting of: AAT signal peptide (e.g., SEQ ID NO: 67) or an active fragment thereof having secretory signal activity, such as a nucleic acid encoding an amino acid sequence having at least about 75%, or 80%, or 85%, or 90%, or 95%, or 98%, or 99% sequence identity to SEQ ID NO: 67; a fibronectin signal peptide (FN1) (e.g., SEQ ID NO:73-SEQ ID NO:75) or an active fragment thereof having secretory signal activity, such as a nucleic acid encoding an amino acid sequence having at least about 75%, or 80%, or 85%, or 90%, or 95%, or 98%, or 99% sequence identity to SEQ ID NO:73 to SEQ ID NO:75; An endogenous GAA signal peptide (SEQ ID NO: 51) or an active fragment thereof having secretory signal activity, such as a nucleic acid encoding an amino acid sequence having at least about 75%, or 80%, or 85%, or 90%, or 95%, or 98%, or 99% sequence identity to SEQ ID NO: 51; hIGF2 signal peptide (e.g., SEQ ID NO: 72) or an active fragment thereof having secretory signal activity, such as a nucleic acid encoding an amino acid sequence having at least about 75%, or 80%, or 85%, or 90%, or 95%, or 98%, or 99% sequence identity to SEQ ID NO: 72; IgG1(201) signal peptide (SEQ ID NO:54) or an active fragment thereof having secretory signal activity, such as a nucleic acid encoding an amino acid sequence having at least about 75%, or 80%, or 85%, or 90%, or 95%, or 98%, or 99% sequence identity to SEQ ID NO:54; wtIL2 leader peptide (SEQ ID NO: 55) or an active fragment thereof having secretory signal activity, such as a nucleic acid encoding an amino acid sequence having at least about 75%, or 80%, or 85%, or 90%, or 95%, or 98%, or 99% sequence identity to SEQ ID NO: 55; A mutated IL2 leader peptide (SEQ ID NO: 56) or an active fragment thereof having secretory signal activity, such as a nucleic acid encoding an amino acid sequence having at least about 75%, or 80%, or 85%, or 90%, or 95%, or 98%, or 99% sequence identity to SEQ ID NO: 56; and b. The nucleic acid encoding the GAA polypeptide is selected from any one of the group consisting of: SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, or a nucleic acid sequence having at least 60%, or 70%, or 80%, 85% or 90% or 95%, or 98%, or 99% sequence identity to SEQ ID NO:1 to SEQ ID NO:

18.

23. The recombinant AAV vector according to claim 22, wherein The nucleic acid encoding the GAA polypeptide is selected from: SEQ ID NO: 3; or a nucleic acid sequence encoding a GAA polypeptide having at least 85% sequence identity to SEQ ID NO: 1 and having at least 60%, or 70%, or 80%, 85%, or 90%, or 95%, or 98%, or 99% sequence identity to SEQ ID NO: 3, wherein the amino acid residue at position 199 is R (199R), the amino acid residue at position 223 is H (223H), and the amino acid residue at position 780 is I (780I).

24. The recombinant AAV vector according to any one of claims 1 to 23, wherein The nucleic acid encoding the GAA polypeptide encodes a GAA polypeptide starting from any of amino acid residues 35, 40, 50, 57, 60, 68, 69, 70, 72, 74, 779, 790, 791, 792, 793 or 796 of SEQ ID NO:1, or a sequence that is 80% identical to SEQ ID NO:1, wherein amino acid residue 199 is R (199R), amino acid residue 223 is H (223H), and amino acid residue 780 is I (780I).

25. The recombinant AAV vector according to claim 24, wherein The GAA polypeptide has an endogenous GAA signal peptide or a heterologous signal peptide attached to the N-terminus of the GAA polypeptide, wherein the endogenous signal peptide has the amino acid sequence of SEQ ID NO: 59 or a sequence having at least 80% sequence identity to SEQ ID NO: 59, and the heterologous signal peptide is selected from the group consisting of: SEQ ID NO: 60 (201 IgG signal peptide), or IL2 wild-type signal peptide (SEQ ID NO: 61), modified IL2 signal peptide (SEQ ID NO: 62), A2M signal peptide (SEQ ID NO: 63), or PZP signal peptide (SEQ ID NO: 64), or an artificial signal peptide (SEQ ID NO: 65), or cathpetsin L signal peptide (SEQ ID NO: 66), or a signal peptide having at least 90% sequence identity to SEQ ID NO: 60 to SEQ ID NO:

66.

26. The recombinant AAV vector according to any one of claims 1 to 25, wherein The liver-specific promoter is selected from any one of the following: SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 91 to SEQ ID NO: 96, SEQ ID NO: 146 to SEQ ID NO: 150 or SEQ ID NO: 439 to SEQ ID NO: 441, or a liver-specific promoter having at least 80% sequence identity with SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 91 to SEQ ID NO: 96, SEQ ID NO: 146 to SEQ ID NO: 150 or SEQ ID NO: 439 to SEQ ID NO:

441.

27. The recombinant AAV vector according to any one of claims 1 to 25, wherein The liver-specific promoter is selected from any one of the following: SEQ ID NO: 98 or SEQ ID NO: 99, or a liver-specific promoter having at least 80% sequence identity with SEQ ID NO: 98 or SEQ ID NO:

99.

28. The recombinant AAV vector according to any one of claims 1 to 25, wherein The liver-specific promoter is SEQ ID NO: 97, or a liver-specific promoter having at least 80% sequence identity to SEQ ID NO:

97.

29. The recombinant AAV vector according to any one of claims 1 to 28, wherein The recombinant vector is produced from the plasmid of SEQ ID NO:

27.

30. The recombinant AAV vector according to any one of claims 1 to 29, wherein The nucleic acid comprises SEQ ID NO: 25 or a functional fragment thereof.

31. The recombinant AAV vector according to any one of claims 1 to 30, wherein The recombinant AAV vector is a chimeric AAV vector, a haploid AAV vector, a hybrid AAV vector or a polyploid AAV vector.

32. The recombinant AAV vector according to any one of claims 1 to 31, wherein The recombinant AAV vector is a rational haploid vector, a mosaic AAV vector, a chemically modified AAV vector or an AAV vector from any AAV serotype.

33. The recombinant AAV vector according to any one of claims 1 to 32, wherein The recombinant AAV vector is selected from the group consisting of: an AAVXL32 vector, an AAVXL32.1 vector, an AAV8 vector, or a haploid AAV8 vector comprising at least one AAV8 capsid protein.

34. The recombinant AAV vector according to any one of claims 1 to 33, wherein The serotype is AAV3b.

35. The recombinant AAV vector according to claim 34, wherein The AAV3b serotype comprises one or more mutations in the capsid protein selected from any of the following: 265D, 549A, Q263Y.

36. The recombinant AAV vector according to claim 35, wherein The AAV3b serotype is selected from any one of the following: AAV3b265D, AAV3b265D549A, AAV3b549A or AAV3bQ263Y, or AAV3bSASTG.

37. The recombinant AAV vector according to any one of claims 1 to 36, wherein The poly A sequence is a full-length HGF poly A sequence.

38. The recombinant AAV vector according to claim 37, wherein The poly A sequence is selected from SEQ ID NO:42, SEQ ID NO:43 or SEQ ID NO:44, or a nucleic acid sequence having at least 80% sequence identity to SEQ ID NO:42 to SEQ ID NO:

44.

39. The recombinant AAV vector according to any one of claims 1 to 38, wherein The reverse RNA polII terminator sequence is SEQ ID NO: 45, or a nucleic acid sequence having at least 80% sequence identity with SEQ ID NO:

45.

40. A pharmaceutical composition comprising the recombinant AAV vector of any one of the preceding claims in a pharmaceutically acceptable carrier.

41. A method for treating a subject suffering from Pompe disease or glycogen storage disease type II (GSD II, acid maltase deficiency) or alpha-glucosidase (GAA) polypeptide deficiency, the method comprising administering to the subject any one of the recombinant AAV vectors, or rAAV genomes, or nucleic acid sequences of any of the preceding claims.

42. The method according to claim 41, wherein: The AAV vector is produced from the plasmid of SEQ ID NO:

27.

43. The method according to any one of claims 41-42, wherein: The recombinant AAV vector comprises the nucleic acid sequence of SEQ ID NO: 3 or a functional fragment thereof.

44. The method according to any one of claims 41 to 43, wherein: The recombinant AAV vector comprises the nucleic acid sequence of SEQ ID NO: 23 or a functional variant thereof.

45. The method according to any one of claims 41 to 44, wherein: The GAA polypeptide is secreted from the liver of the subject, and the secreted GAA is taken up by skeletal muscle tissue, cardiac muscle tissue, diaphragm tissue, or a combination thereof, wherein the uptake of the secreted GAA causes a decrease in lysosomal glycogen storage in the tissue.

46. ​​The method of claim 45, wherein: The administration to the subject is selected from any one of intramuscular administration, subcutaneous administration, intraspinal administration, intracisternal administration, intrathecal administration, and intravenous administration.

47. The method according to any one of claims 41 to 46, wherein: The recombinant AAV vector is a chimeric AAV vector, a haploid AAV vector, a hybrid AAV vector or a polyploid AAV vector.

48. The method according to any one of claims 41 to 47, wherein: The recombinant AAV vector is a rational haploid vector, a mosaic AAV vector, a chemically modified AAV vector or an AAV vector from any AAV serotype.

49. The method according to any one of claims 41 to 48, wherein: The recombinant AAV vector is an AAVXL32 vector or an AAVXL32.1 vector or an AAV8 vector, or a haploid AAV8 vector comprising at least one AAV8 capsid protein.

50. The method according to any one of claims 41 to 49, wherein: The recombinant AAV vector is an AAV8 vector.

51. The method according to any one of claims 41 to 50, wherein: The recombinant AAV vector was administered at a dose range of 1.0E11 vg / kg to 5.0E13 vg / kg.

52. The method of any one of claims 41-51, further comprising receiving GAA protease replacement therapy and stopping GAA protease replacement therapy (ERT) on the same day, the next day, or any time between day 1 and week 26 after administration of the recombinant AAV vector.

53. A nucleic acid construct comprising SEQ ID NO: 3 or a nucleic acid sequence having at least 80% sequence identity to SEQ ID NO:

3.

54. The nucleic acid according to claim 53, wherein The nucleic acid sequence of SEQ ID NO:3, or expression of a nucleic acid having 80% sequence identity thereto, encodes a GAA polypeptide having at least 80% sequence identity to SEQ ID NO:1, and wherein R is present at position 199, H is present at position 223, and I is present at position 780.

55. A nucleic acid construct comprising SEQ ID NO: 23 or a nucleic acid sequence having at least 80% sequence identity to SEQ ID NO:

23.

56. The nucleic acid construct of claim 55, comprising SEQ ID NO: 3 or SEQ ID NO: 25, or a nucleic acid sequence having at least 80% sequence identity to SEQ ID NO: 3 or SEQ ID NO:

25.

57. The nucleic acid according to claim 56, wherein The nucleic acid sequence of SEQ ID NO:3, or expression of a nucleic acid having 80% sequence identity thereto, encodes a GAA polypeptide having at least 80% sequence identity to SEQ ID NO:1, and wherein R is present at position 199, H is present at position 223, and I is present at position 780.

58. A recombinant AAV comprising a nucleic acid construct according to any one of claims 53-57.

59. The recombinant AAV vector according to claim 1, wherein The AAV lacks at least one amino acid at the N-terminus of GAA.

60. The recombinant AAV vector according to claim 1, wherein The AAV lacks at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, or more amino acids from the N-terminus of GAA.

61. The recombinant AAV vector according to claim 1, wherein The heterologous signal peptide is inserted directly after the endogenous GAA signal peptide or a portion thereof.

Images