Application of sulfabenzopyrazole, 7-hydroxycoumarin and vitamin E acetate in preparation of product for inhibiting combination or cutting of SpCas9 to substrate

Abstract

The invention belongs to the technical field of CRISPR / Cas9 gene editing, and particularly relates to application of sulfanilamide pyrazole, 7-hydroxycoumarin and vitamin E acetate to preparation of products for inhibiting SpCas9 from being combined with a substrate or cutting the substrate, one or more of sulfanilamide pyrazole, 7-hydroxycoumarin and vitamin E acetate are used in a combined mode, and by destroying combination or cutting of SpCas9 and DNA, the yield of the substrate is increased, and the yield of the substrate is increased. Therefore, the effect of inhibiting the SpCas9 DNA endonuclease is achieved.

Description

Technical Field

[0001] The present invention relates to the field of CRISPR / Cas9 gene editing technology, and in particular to the use of sulfaphenazole, 7-hydroxycoumarin and vitamin E acetate in the preparation of products for inhibiting SpCas9 from binding to or cutting a substrate. Background Art

[0002] In 1987, Ishino et al. first discovered a large number of repetitive sequences containing regular intervals when studying the alkaline phosphatase gene of Escherichia coli in Nucleotide sequence of the iap gene, responsible for alkaline phosphatase isozyme conversion in Escherichia coli, and identification of the gene product. Journal of Bacteriology 169, 5429-5433. However, due to the limitations of technology and knowledge at the time, no further research was conducted. Until the beginning of this century, after a large number of subsequent studies by researchers, it was found that this sequence was widely present in bacteria and archaea, and the tandem repeats arranged at intervals were named Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR).

[0003] The CRISPR / Cas system is a complex phage defense mechanism composed of a CRISPR array and a series of related Cas proteins. The CRISPR array itself consists of three main parts: a leader sequence located at the front end of the array, a series of highly conserved repeat sequences, and multiple spacers. The leader sequence, as the promoter of the CRISPR array, regulates the expression of the CRISPR gene and is generally located at the start of the CRISPR array; the repeat sequence is 21 to 48 bp long, contains a palindromic sequence, and can form a hairpin structure (R-loop); the spacer sequence is integrated from exogenous DNA fragments, and they are the basis for the CRISPR system to recognize foreign genetic material. In order to better distinguish different CRISPR systems, researchers divided CRISPR / Cas into two categories and six types (Ⅰ-VI) according to the types and sequences of CRISPR associate (Cas) proteins and their roles in the bacterial immune defense process: Class 1 includes Type Ⅰ, Type Ⅲ and Type Ⅳ, which require multiple Cas effector proteins to form a complex to play the role of endonuclease; Class 2 includes Type Ⅱ, Type Ⅴ and Type Ⅵ, which only require a single Cas effector protein to perform functions. For example, the Type Ⅱ CRISPR / Cas system only requires one protein, Cas9, to effectively cut double-stranded DNA. It is this simple and efficient advantage that gives the Type Ⅱ CRISPR / Cas9 system a broad space for development, and its related research is also the most extensive and in-depth. According to the authoritative clinical trial website (ClinicalTrials), there are currently 70 clinical trials on CRISPR / Cas9 (as of May 2024), and the types of diseases treated cover single gene genetic diseases, ophthalmic diseases, AIDS and many other aspects. It is particularly worth mentioning that in December 2023, Casgevy (based on the CRISPR / Cas9 system), a gene editing therapy for the treatment of sickle cell disease jointly developed by the US biotechnology company Vertex Pharmaceuticals (VRTX.US) and the Swiss pharmaceutical company CRISPR Therapeutics (CRSPR.US), has been officially launched with the approval of the European Medicines Agency (EMA) and the US Food and Drug Administration (FDA).

[0004] The CRISPR / Cas9-mediated genome editing process can be roughly divided into three key stages: first, the Cas9 protein binds to the single-stranded guide RNA (sgRNA) to form a complex; second, the complex recognizes and binds to the specific PAM (Protospacer Adjacent Motif) sequence on the target DNA under the guidance of the sgRNA; finally, the Cas9 protein cuts the target DNA to produce double-strand breaks (DSB). Different types of Cas proteins in the CRISPR system use their own specific PAM sequences to confirm the target site. Taking the CRISPR / Cas9 system as an example, its PAM sequence is usually NGG, where N can be any base. After Cas9 protein-mediated DNA cutting, cells will respond to DSBs through two main DNA repair mechanisms: one is the non-homologous end joining repair mechanism (NHEJ), which may cause small insertions or deletions (indels); the other is homology directed repair (HDR), which can accurately repair DSBs with the addition of exogenous repair templates.

[0005] Compared with previous gene editing technologies, the CRISPR / Cas9 system has several significant advantages: first, it can edit the genome accurately and efficiently; second, the CRISPR / Cas system is not restricted by species and is applicable to genome editing of a variety of organisms such as plants, bacteria, and animals; finally, the CRISPR / Cas system has the ability to edit multiple target sites on the genome at the same time. However, the CRISPR / Cas9 system also has many shortcomings. One of them is that DNA repair after DSB mainly depends on NHEJ. This repair mechanism may produce errors during the repair process, resulting in the loss of gene function or the acquisition of new unknown functions; another major problem is the off-target effect, that is, the gene editing tool may cut the wrong target DNA site, which is an unavoidable side effect of gene editing technology based on the principle of nucleic acid complementarity. With the application of the CRISPR / Cas system, the accumulation of off-target effects may lead to chromosome translocation and even induce genotoxic mutations.

[0006] In order to provide a good, effective, and safer medication window for clinical applications, and to provide an efficient CRISPR system switch for basic research, it is necessary to accurately control the CRISPR / Cas9 system, so the development of CRISPR / Cas9 system inhibitors becomes particularly important. Scientists have discovered a variety of protein molecules (Anti-CRISPR, ACR) that antagonize the CRISPR / Cas9 system, but these molecules have low affinity for the most commonly used Cas9 protein, SpCas9 (Cas9 from Streptococcus pyogenes). In addition, because ACR is essentially a protein molecule, it has strong immunogenicity and poor drugability, making it difficult to promote in clinical practice. Small molecule compounds can largely overcome these two deficiencies and are recognized as the most promising means to solve this problem. Amit Choudhary's research group at Harvard Medical School published two articles on small molecule inhibitors of CRISPR / Cas9 in Cell and Nature Cell Biology in 2019 and 2022, respectively: A High-Throughput Platform to Identify Small-Molecule Inhibitors of CRISPR-Cas9. Cell. 2019 May. and A general approach to identify cell-permeable and synthetic anti-CRISPR small molecules. Nat Cell Biol. 2022 Dec. They have successively developed two small molecule drugs, BRD0539 and BRD7586, but the in vivo safety of these two drugs has not been verified, and the synthesis process is complicated and the cost is high, which undoubtedly limits their further promotion. We hope to screen out small molecule inhibitors that can effectively control the CRISPR / (Sp)Cas9 system from the FDA-approved small molecule drug library, thereby avoiding the drawbacks of previous candidate drugs. In the existing scientific literature, there are no reports that sulfaphenazole, 7-hydroxycoumarin, and vitamin E acetate can bind to SpCas9 or inhibit its endonuclease activity. In addition, there are no studies reporting that these three compounds can bind to SpCas9 or affect its endonuclease activity when used in combination. Summary of the invention

[0007] In order to solve the above technical problems, the present invention provides the use of sulfaphenazole, 7-hydroxycoumarin, and vitamin E acetate in the preparation of products that inhibit SpCas9 from binding or cutting substrates.

[0008] Use of sulfaphenazole, 7-hydroxycoumarin, and vitamin E acetate in the preparation of products that inhibit SpCas9 from binding or cleaving a substrate, wherein one or more of sulfaphenazole, 7-hydroxycoumarin, and vitamin E acetate are used in combination;

[0009] The concentration of sulfaphenazole was 1.56-500 μM;

[0010] The concentration of 7-hydroxycoumarin was 1.56-500 μM;

[0011] The concentration of vitamin E acetate was 6.25-500 μM;

[0012] Preferably, the product includes any one of sulfaphenazole, 7-hydroxycoumarin, and vitamin E acetate.

[0013] Preferably, the product also includes SpCas9 protein.

[0014] Preferably, the dosage ratio of sulfaphenazole, 7-hydroxycoumarin, vitamin E acetate and SpCas9 is 0.25-1mmol:5U.

[0015] Preferably, the product includes sulfaphenazole, 7-hydroxycoumarin, and vitamin E acetate.

[0016] Preferably, the product also includes SpCas9 protein.

[0017] Preferably, the total dosage ratio of sulfaphenazole, 7-hydroxycoumarin, and vitamin E acetate to SpCas9 is 0.25-1 mmol:5U.

[0018] Preferably, the PC-1400 kit of Innovent Biologics is used for inhibiting binding or cleavage.

[0019] Preferably, the reaction system for inhibiting binding or cleavage is 5 μL of Cas9 protein, 5 μL of PC sgRNA, 10 μL of PC DNA, 1.2 μL of small molecule compound or solvent, and 2.4 μL of 10×Cas9 Buffer.

[0020] Preferably, when inhibiting binding or cleavage, the reaction is carried out at 37°C for 30 minutes, and the enzyme cleavage reaction is carried out at 85°C for 10 minutes.

[0021] Compared with the prior art, the present invention has the following beneficial effects:

[0022] 1. The present invention provides the use of sulfaphenazole, 7-hydroxycoumarin, and vitamin E acetate in inhibiting the binding or cutting of SpCas9 to a substrate, so that the "anti-CRISPR-Cas9" gene editing system can be more effectively controlled, and the binding or cutting of SpCas9 to DNA can be destroyed, thereby inhibiting the endonuclease activity of SpCas9.

[0023] 2. The antibacterial spectrum of sulfaphenazole is similar to that of SD (sulfadiazine), but its antibacterial effect is stronger. This product is a broad-spectrum antibacterial drug with strong antibacterial effect and can be used to treat respiratory system, urinary system, intestinal and skin soft tissue infections. It is currently mainly used in combination with the synergist trimethoprim (TMP) in clinical practice. The antibacterial effect can be increased several to dozens of times. It is mainly used to treat acute bronchitis, lung infection, urinary tract infection, bacillary dysentery and typhoid fever. This product competes with para-aminobenzoic acid (PABA) for the active site of bacterial dihydrofolate synthase, making it impossible for bacteria to use PABA to synthesize folic acid and inhibiting bacterial growth and reproduction; there are no reports on sulfaphenazole inhibiting SpCas9 binding or cutting of substrates.

[0024] 7-Hydroxycoumarin is a potent α2-adrenergic receptor agonist with an affinity for α2-adrenergic receptors 8 times higher than that of clonidine. It is clinically suitable for sedation of patients who are intubated and on ventilators during intensive care treatment. There are no reports that 7-hydroxycoumarin inhibits SpCas9 binding or cleavage of substrates.

[0025] Vitamin E acetate (tocopherol acetate) is a stable form of vitamin E and is most commonly used in cosmetic formulations. It has skin care benefits and, as an antioxidant in the body, can protect cells from free radical damage and prevent fat peroxidation in the body. There are no reports that vitamin E acetate inhibits SpCas9 binding to or cleavage of substrates.

[0026] Existing inhibitory molecules (such as BRD0539) have a low affinity for SpCas9, suggesting that their regulatory efficacy is not high and may not be able to perform high-level regulation in vivo. The drug provided in this application has been proven to enter experimental animals under safe conditions and exert a regulatory effect, and biochemical analysis has also found that it has a high affinity for SpCas9.

[0027] 3. In the previous literature review, it was found that the combination of sulfaphenazole, 7-hydroxycoumarin, and vitamin E acetate with SpCas9 had no significant effect on its ability to bind or cut substrates. The application of sulfaphenazole, 7-hydroxycoumarin, vitamin E acetate and their combination in inhibiting SpCas9 from binding or cutting substrates provided in this application can effectively expand the clinical application of SpCas9, expand the clinical use window of SpCas9-related therapies, improve the efficiency of doctors' application of SpCas9-related therapies, and enrich clinical medication plans. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 The electrophoretic diagrams show that sulfaphenazole (3673), 7-hydroxycoumarin (3675), and vitamin E acetate (3681) inhibit CRISPR / Cas9 from cutting target DNA, respectively. BRD0539 is the positive control.

[0029] Figure 2 The electrophoresis diagram shows the dose-dependent inhibition of CRISPR / Cas9 cleavage of target DNA by sulfaphenazole, and BRD0539 is the positive control.

[0030] Figure 3 This is a surface plasmon resonance (SPR) experimental result diagram of the binding of sulfaphenazole to the SpCas9 complex. The lines in the figure are cycle 14 (500 μM), cycle 13 (100 μM), cycle 12 (50 μM), cycle 11 (25 μM), cycle 10 (12.5 μM), and cycle 9 (6.25 μM) from top to bottom.

[0031] Figure 4 The electrophoresis diagram shows the dose-dependent inhibition of CRISPR / Cas9 cleavage of target DNA by 7-hydroxycoumarin.

[0032] Figure 5 This is a surface plasmon resonance (SPR) experimental result of 7-hydroxycoumarin binding to the SpCas9 complex. The lines in the figure are cycle 11 (500 μM), cycle 10 (100 μM), cycle 9 (50 μM), cycle 8 (25 μM), and cycle 7 (12.5 μM) from top to bottom.

[0033] Figure 6 The electropherogram shows the dose-dependent inhibition of CRISPR / Cas9 cleavage of target DNA by vitamin E acetate.

[0034] Figure 7This is a surface plasmon resonance (SPR) experimental result of the binding of vitamin E acetate to the SpCas9 complex. The lines in the figure are cycle 7 (12.5 μM), cycle 6 (6.25 μM), cycle 5 (0 μM), cycle 10 (100 μM), cycle 9 (50 μM), and cycle 8 (25 μM) from top to bottom.

[0035] Figure 8 The electrophoresis diagrams show that positive compounds BRD0539 and BRD7586 inhibit CRISPR / Cas9 from cutting target DNA.

[0036] Fig. 9 This is the electrophoresis diagram of the positive compound BRD7586 dose-dependently inhibiting CRISPR / Cas9 from cutting the target DNA.

[0037] Fig.10 This is a surface plasmon resonance (SPR) experimental result of BRD0539 binding to SpCas9 complex; the lines in the figure are cycle 13 (500μM), cycle 12 (100μM), cycle 11 (50μM), cycle 10 (25μM), cycle 9 (12.5μM), cycle 8 (6.25μM), and cycle 7 (3.125μM) from top to bottom.

[0038] Fig.11 This is a surface plasmon resonance (SPR) experimental result diagram of the binding of BRD7586 to the SpCas9 complex; the lines in the figure are cycle 9 (12.5μM), cycle 8 (6.25μM), cycle 7 (3.125μM), cycle 6 (1.56μM), cycle 5 (0.78μM), and cycle 4 (0.36μM) from top to bottom.

[0039] Fig.12 This is the electrophoresis diagram of the combined use of sulfaphenazole, 7-hydroxycoumarin, and vitamin E acetate (ALL) to inhibit CRISPR / Cas9 from cutting target DNA.

[0040] Fig.13The flow cytometry images of sulfaphenazole, 7-hydroxycoumarin, and vitamin E acetate inhibiting CRISPR / Cas9 from cutting target DNA (B2M gene) and inhibiting its protein expression in the cell system. Among them, (A) is the blank group, (B) is the treatment group in which the control sgRNA is transfected and DMSO solvent is added under the premise of DOX (doxycycline)-induced expression of SpCas9, (C) is the treatment group in which the sgRNA targeting the B2M gene is transfected and DMSO solvent is added under the premise of DOX-induced expression of SpCas9, (D) is the treatment group in which the sgRNA targeting the B2M gene is transfected and the positive control compound 1 (BRD0539) is added under the premise of DOX-induced expression of SpCas9, (E) is the treatment group in which the sgRNA targeting the B2M gene is transfected and the positive control compound 1 (BRD0539) is added under the premise of DOX-induced expression of SpCas9, (F) is the treatment group in which sgRNA targeting B2M gene was transfected under the premise of DOX-induced expression of SpCas9, and sulfaphenazole (3673) was added. (G) is the treatment group in which sgRNA targeting B2M gene was transfected under the premise of DOX-induced expression of SpCas9, and 7-hydroxycoumarin (3675) was added. (H) is the treatment group in which sgRNA targeting B2M gene was transfected under the premise of DOX-induced expression of SpCas9, and vitamin E acetate (3681) was added.

[0041] Fig.14 The flow cytometry images of sulfaphenazole, 7-hydroxycoumarin, and vitamin E acetate inhibiting CRISPR / Cas9 from cutting target DNA (GFP encoding gene) and inhibiting GFP protein expression in the mouse system. + Hepatocytes of transgenic mice, i.e., untreated group (B), GFP + / Cas9 + Mouse hepatocytes injected with control sgRNA and solvent, (C) GFP + / Cas9 + Mouse hepatocytes were injected with sgRNA targeting the GFP encoding gene and solvent. (D) is GFP + / Cas9 + Mouse hepatocytes were injected with sgRNA targeting the GFP encoding gene and sulfaphenazole (3673). (E) is GFP + / Cas9 + Mouse hepatocytes were injected with sgRNA targeting the GFP encoding gene and 7-hydroxycoumarin (3675). (F) is GFP + / Cas9 +Mouse hepatocytes were injected with sgRNA targeting the GFP encoding gene and vitamin E acetate (3681).

[0042] Note: Figure 3 , Figure 5 , Figure 7 , Fig.10 and Fig.11 The cycle numbers in the figure show the detection curve of the coupling affinity between Cas9 protein and small molecule compounds under different drug concentration conditions. 3673 is sulfaphenazole, 3675 is 7-hydroxycoumarin, and 3681 is vitamin E acetate.

[0043] The DNA is the target DNA cut by CRISPR / Cas9 in the kit (Yinmao Shengye PC-1400). DETAILED DESCRIPTION

[0044] The specific embodiments of the present invention are described in detail below, but it should be understood that the protection scope of the present invention is not limited by the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work belong to the protection scope of the present invention. The experimental methods described in the embodiments of the present invention are conventional methods unless otherwise specified.

[0045] Example 1

[0046] 1. Verification experiment of the inhibitory effect of compounds on CRISPR / Cas9 DNA cleavage

[0047] In order to verify the inhibitory effect of the drug on the DNA cutting of Cas9, we first carried out an enzyme cleavage reaction in a cell-free system, using the PC-1400 kit from Innovent Biologics and the method provided in the kit manual to perform an in vitro enzyme cleavage experiment. The enzyme cleavage efficiency was then verified by agarose gel electrophoresis, using the PCDNA and PC sgRNA in the kit.

[0048] First, use enzyme-free PCR tubes and enzyme-free pipette tips to conduct the experiment: add 5μL (1U / μL) of Cas9 protein, 5μL (1μg / μL) of PC sgRNA, 10μL (1μg / μL) of PC DNA, 1.2μL of small molecule compounds or solvents, and 2.4μL of 10×Cas9 Buffer to each sterile enzyme-free test tube, and then blow and mix. This process is carried out on ice. The specific groups are as follows:

[0049] A negative control group (solvent group) was set up: containing 1.2 μL of DMSO solvent, 5 μL of Cas9 protein (1 U / μL), 5 μL of PCsgRNA (1 μg / μL), 10 μL of PC DNA (1 μg / μL), and 2.4 μL of 10×Cas9Buffer. The mixture was then blown and mixed. The whole process was carried out on ice.

[0050] Positive control group 1 (BRD0539): contains 1.2 μL of 1 mM BRD0539, 5 μL of Cas9 protein (1 U / μL), 5 μL of PC sgRNA (1 μg / μL), 10 μL of PC DNA (1 μg / μL), and 2.4 μL of 10×Cas9 Buffer. Then blow and mix well. The whole process was carried out on ice.

[0051] Positive control group 2 (BRD7586): contains 1.2 μL of 1 mM BRD7586, 5 μL (1 U / μL) of Cas9 protein, 5 μL (1 μg / μL) of PC sgRNA, 10 μL (1 μg / μL) of PC DNA, and 2.4 μL of 10×Cas9 Buffer. Then blow and mix well. The whole process is carried out on ice.

[0052] Target drug group: Add 1.2μL of the corresponding small molecule drug with a concentration of 1mM, 5μL of Cas9 protein (1U / μL), 5μL of PCsgRNA, 10μL of PC DNA, and 2.4μL of 10×Cas9 Buffer. Then blow and mix evenly. The whole process is carried out on ice. The small molecule drug is one of sulfaphenazole, 7-hydroxycoumarin, and vitamin E acetate.

[0053] Combined drug group (ALL): Three small molecule drugs with a concentration of 1mM were added, 0.4μL of each, Cas9 protein 5μL (1U / μL), PC sgRNA 5μL, PC DNA 10μL, 10×Cas9Buffer 2.4μL. Then blow and mix well, and the whole process was carried out on ice. The small molecule combined drugs were sulfaphenazole, 7-hydroxycoumarin, and vitamin E acetate mixed in equal volumes.

[0054] Use a metal bath at 37°C for 30 minutes, then treat at 85°C for 10 minutes to complete the in vitro enzyme digestion reaction. After the enzyme digestion reaction, the product was detected and 5 μL of TIANGEN was added to each group. TMProtein K (20 mg / mL), this step was mixed on ice, and incubated in a metal bath at 56°C overnight. Prepare 2% agarose gel (add 4 μL YeaRed Nucleic Acid Gel Stain CAT: 10202ES76 (Yeasen Yisheng Biology) to every 40 mL of agarose gel solution).

[0055] Take 10 μL of the reaction product for electrophoresis detection, and take 3 μL of Takara DL2000 marker. When performing agarose gel electrophoresis, the condition is a constant voltage of 150V for 30 minutes. After the electrophoresis is completed, color development is performed, and the position of the gel block is adjusted by white light. Then, when the white light is turned off, ultraviolet color development is performed with an exposure time of 500ms, and photos are taken for analysis. Lane 1D software is used for gel analysis, the photos are inverted, and the width is adaptively adjusted according to the lane width, and the lanes of all experimental groups, solvent groups, and PC groups are selected.

[0056] After the lanes are adjusted, the bands are selected, the position of the residual DNA bands is selected, the selection box is controlled to be of the same size, the grayscale of the bands is read, and the results are output to an Excel table. The grayscale values ​​of the bands are statistically analyzed in the Excel table, and the remaining amount of uncut bands and the remaining proportion of uncut bands are calculated respectively.

[0057] Calculation of cleavage efficiency and inhibition efficiency

[0058] (1) Cutting efficiency calculation formula: E = A1 / B1 × 100%;

[0059] Among them, E represents the cutting efficiency; A1 represents the gray value of the cutting product; B1 represents the gray value of the original DNA cutting product.

[0060] (2) The relative ratio of inhibition efficiency was calculated as follows: C = (F1-D1) / (G1-D1) × 100%;

[0061] Wherein, C represents the inhibition efficiency, F1 represents the gray value of the cleavage product of the experimental group, D1 represents the gray value of the cleavage product of the solvent group (DMSO), and G1 represents the gray value of the cleavage product of the positive control BRD0539 (BRD0539) group.

[0062] The results are shown in Table 1.

[0063] Table 1 Comparison results of cutting efficiency and inhibition efficiency

[0064]

[0065]

[0066] The cleavage inhibition effects of positive drug BRD0539 and positive drug BRD7586 are shown in Figure 8 After treatment with the positive compounds BRD0539 and BRD7586, the gray value of the uncut DNA band was larger than that of the solvent group, indicating that the two positive control compounds did have the effect of inhibiting Cas9 from binding to or cutting target DNA.

[0067] The inhibitory cleavage effect of the target drug group can be found in Figure 1 .right Figure 1 The grayscale values ​​of the uncut DNA bands in each group were analyzed. The results showed that compared with the positive control drug BRD0539, the grayscale values ​​of the uncut DNA were larger after treatment with the candidate compounds sulfaphenazole (3673), 7-hydroxycoumarin (3675), and vitamin E acetate (3681), indicating that sulfaphenazole, 7-hydroxycoumarin, and vitamin E acetate have stronger inhibitory effects on Cas9 binding or cutting target DNA than the positive compounds.

[0068] The effect of combined use of candidate compounds is as follows Fig.12 As shown, the ALL group shows the electrophoresis results of uncut DNA after the combined use of sulfaphenazole (3673), 7-hydroxycoumarin (3675) and vitamin E acetate (3681). It can be seen that the combined use of the three candidate compounds has more uncut DNA residues than any positive control compound, indicating that the combined use of sulfaphenazole, 7-hydroxycoumarin and vitamin E acetate has a stronger inhibitory effect on Cas9 binding or cutting target DNA than the positive compounds.

[0069] Example 2

[0070] Drug concentration gradient experiment

[0071] In order to verify that the candidate compounds have a dose-dependent effect on the inhibition of SpCas9, we performed an enzymatic cleavage reaction after gradient drug treatment in a cell-free system, using the PC-1400 kit from Innovent Biologics and the method provided in the kit manual to perform in vitro enzymatic cleavage experiments. The enzymatic cleavage efficiency was then verified by agarose gel electrophoresis. PC DNA and PC sgRNA in the kit were used here.

[0072] First, use enzyme-free PCR tubes and enzyme-free pipette tips to conduct the experiment: add 5μL (1U / μL) of Cas9 protein, 5μL (1μg / μL) of PC sgRNA, 10μL (1μg / μL) of PC DNA, 1.2μL of small molecule compounds or solvents, and 2.4μL of 10×Cas9 Buffer to each sterile enzyme-free test tube, then blow and mix well. The sample addition process is carried out on ice. The specific groups are as follows:

[0073] A negative control group was set up: containing 1.2 μL of DMSO solvent, 5 μL of Cas9 protein (1 U / μL), 5 μL of PC sgRNA (1 μg / μL), 10 μL of PC DNA (1 μg / μL), and 2.4 μL of 10×Cas9 Buffer. Then, the mixture was mixed by blowing. The whole process was carried out on ice.

[0074] Positive control group 1 (BRD0539): contains 1.2 μL of 1 mM BRD0539, 5 μL of Cas9 protein (1 U / μL), 5 μL of PC sgRNA (1 μg / μL), 10 μL of PC DNA (1 μg / μL), and 2.4 μL of 10×Cas9 Buffer. Then blow and mix well. The whole process is carried out on ice.

[0075] Positive control group 2 (BRD7586): contains 1.2 μL of 1 mM BRD7586, 5 μL of Cas9 protein (1 U / μL), 5 μL of PC sgRNA (1 μg / μL), 10 μL of PC DNA (1 μg / μL), and 2.4 μL of 10×Cas9 Buffer. Then blow and mix well. The whole process is carried out on ice.

[0076] The target drug group is a reaction system that contains 1.2 μL of corresponding small molecule drugs at concentrations of 1 mM, 750 μM, 500 μM, 250 μM, and 0 μM, 5 μL of Cas9 protein (1 U / μL), 5 μL of PC sgRNA (1 μg / μL), 10 μL of PC DNA (1 μg / μL), and 2.4 μL of 10×Cas9 Buffer. Then blow and mix evenly, and the whole process is carried out on ice. Among them, the small molecule drugs are sulfaphenazole, 7-hydroxycoumarin, and vitamin E acetate; the corresponding concentrations of sulfaphenazole, 7-hydroxycoumarin, and vitamin E acetate in the reaction system are 50 μM, 37.5 μM, 25 μM, 12.5 μM, and 0 μM, respectively.

[0077] Use a metal bath at 37°C for 30 minutes, then treat at 85°C for 10 minutes to complete the in vitro enzyme digestion reaction. After the enzyme digestion reaction, the product was detected and 5 μL of TIANGEN was added to each group. TM Protein K (20 mg / mL), this step was mixed on ice, and incubated in a metal bath at 56°C overnight. Prepare 2% agarose gel (add 4 μL YeaRed Nucleic Acid Gel Stain CAT: 10202ES76 (Yeasen Yisheng Biology) to every 40 mL of agarose gel solution).

[0078] Take 10 μL of the reaction product for electrophoresis detection, and take 3 μL of Takara DL2000 marker. When performing agarose gel electrophoresis, the condition is a constant voltage of 150V for 30 minutes. After the electrophoresis is completed, color development is performed, and the position of the gel block is adjusted by white light. Then, when the white light is turned off, ultraviolet color development is performed with an exposure time of 500ms, and photos are taken for analysis. Use Lane 1D software for gel analysis, invert the photos, and then adjust the width of the lanes adaptively according to the lane width, and select the lanes of all experimental groups, solvent groups, and positive control groups.

[0079] After the lanes are adjusted, the bands are selected, the position of the residual DNA bands is selected, the selection box is controlled to be of the same size, the grayscale of the bands is read, and the results are output to an Excel table. The grayscale values ​​of the bands are statistically analyzed in the Excel table, and the remaining amount of uncut bands and the remaining proportion of uncut bands are calculated respectively.

[0080] The results of the concentration gradient experiment of the positive drug BRD7586 are as follows Fig. 9 As shown in the figure, the drug concentration in BRD0539 and BRD7586 is 50 μM, and the concentration gradient at the back shows that the inhibitory efficiency continues to increase with the increase of BRD7586 concentration, that is, the inhibitory effect is positively correlated with the concentration of BRD7586, showing dose dependence.

[0081] The results of the target drug group concentration gradient experiment can be found in Figure 2 , Figure 4 and Figure 6 .

[0082] Specifically, Figure 2 It is shown that as the concentration of sulfaphenazole (3673) increases, the amount of uncut DNA shows an upward trend and remains stable after 25 μM, indicating that the inhibitory effect of sulfaphenazole on SpCas9 has a dose-dependent effect and reaches saturation at a lower concentration; Figure 4 It is shown that as the concentration of 7-hydroxycoumarin (3675) increases, the amount of uncut DNA shows an upward trend, suggesting that the inhibitory effect of 7-hydroxycoumarin on SpCas9 has a dose-dependent effect; Figure 6 It was shown that with the increase of the concentration of vitamin E acetate (3681), the amount of uncut DNA showed an upward trend and reached a peak at 37.5 μM, but showed a slight decrease at 50 μM, suggesting that the inhibitory effect of vitamin E acetate on SpCas9 has a dose-dependent effect and may have the opposite effect after excessive use.

[0083] Example 3

[0084] Surface Plasmon Resonance (SPR) assay to detect affinity of Cas9 protein and candidate small molecule inhibitors

[0085] The instrument used for the SPR experiment was Biacore T200.

[0086] The binding test results of positive compound 1 (BRD0539) and positive compound 2 (BRD7586) with Cas9 protein are shown in Fig.10 and Fig.11 It is not difficult to find that at most concentrations, the SPR results of BRD0539 and BRD7586 are a straight line close to the X-axis, indicating that their binding force with SpCas9 is very weak.

[0087] The test results of the binding affinity between the target drug group and the Cas9 protein are as follows Figure 3 , Figure 5 and Figure 7 As shown in the figure, the gradient represents that as the concentration of small molecules increases, their inhibitory ability to the CRISPR / Cas9 system continues to increase. Figure 3 It can be seen that the affinity of the drug sulfaphenazole (3673) shows an obvious binding gradient trend as the drug concentration changes; Figure 5 It can be seen that the affinity of the drug 7-hydroxycoumarin (3675) shows an obvious binding gradient trend as the drug concentration changes; Figure 7 It can be seen that the binding ability of the drug vitamin E acetate (3681) is the highest at 712.5μM. Below is the binding curve of 66.25μM. Although it does not show a good gradient form of binding force with multiple concentration gradients, it is still better than the binding force of BRD0539 and BRD7586; the positive control 1BRD0539 and the positive control 2BRD7586 have an affinity that does not change with drug concentration, presenting a straight line and in the range of about 0, while sulfaphenazole, 7-hydroxycoumarin, and vitamin E acetate present a gradient form. This shows that the binding of drugs sulfaphenazole, 7-hydroxycoumarin, vitamin E acetate and Cas9 protein is better than that of positive drugs 1BRD0539 and positive drugs 2BRD7586 (compared with Fig.10 and Fig.11 compared to).

[0088] Figure 3 , Figure 5 and Figure 7The results of SPR are the results of drug binding to SpCas9 protein. From the figure, we can see the binding of drugs to SpCas9. The binding of sulfaphenazole, 7-hydroxycoumarin and vitamin E acetate to Cas9 is better than that of the previously reported Cas9 inhibitor BRD0539 ( Fig.10 ) and BRD7586( Fig.11 ) expresses a stronger binding.

[0089] Example 4

[0090] Cell-level verification experiment of the inhibitory effect of compounds on CRISPR / Cas9 DNA cleavage

[0091] The experiment verified that the drug has an inhibitory effect on the DNA cutting effect of Cas9. A cell system experiment was conducted. HEK-293T cells induced by doxycycline to express Cas9 were used as working cells, transfected with sgRNA, and then the inhibitory efficiency of the drug was verified by flow cytometry.

[0092] There were blank group, solvent group (sgControl+solvent), negative control group (sgB2M+solvent), positive control group 1 (sgB2M+BRD0539), positive control group 2 (sgB2M+BRD7586) and drug group (sgB2M+candidate drug).

[0093] Preparation of lentivirus

[0094] (1) HEK-293T cell culture

[0095] HEK-293T cells were cultured in a 6 cm dish. When the cell density reached 70% to 80%, they could be used for transfection. New complete culture medium was replaced 2 hours before transfection.

[0096] Complete culture medium: DMEM (containing sodium pyruvate and glutamine), 10% fetal bovine serum (FBS), 1% antibiotics;

[0097] (2) Cell transfection

[0098] ①Use 1.5mL EP tube to prepare the following solutions:

[0099] Solution A: Add the following reagents in sequence and vortex to mix.

[0100] Opti-DMEM 250μL / dish

[0101] Lipo2000 10μL / dish

[0102] Solution B: Add the following reagents in sequence and vortex to mix.

[0103] Opti-DMEM 250μL / dish

[0104] Extracted pCW-Cas9 plasmid 4 μg / dish

[0105] psPAX2 plasmid 3 μg / dish

[0106] pMD2G plasmid 1 μg / dish

[0107] ② Add liquid A to liquid B drop by drop, mix well, and let stand at room temperature for 20 minutes;

[0108] ③ Add the suspension of solution A and solution B dropwise into the HEK-293T cell culture dish in step (1) for transfection, and culture at 5% CO2 and 37°C for 48 hours;

[0109] ④ Collect the virus supernatant and centrifuge at 2000rpm for 10 minutes, filter with a 0.45μm filter membrane, add the filtrate to a 50mL centrifuge tube (brand: ABC), centrifuge at 1000rpm for 10 minutes to obtain the lentivirus, and aliquot 1mL / tube for standby use or store at -80℃;

[0110] (3) Cell system construction:

[0111] HEK-293T cells were cultured in a 10 cm dish. When the cell density reached 50% to 60%, they could be used for infection. New complete culture medium was replaced 2 hours before transfection.

[0112] Using the lentivirus obtained in the previous step, the medium was changed (5 mL lentivirus + 5 mL DMEM complete medium) and cultured for 48 hours.

[0113] Infected HEK-293T cells were cultured in a culture dish. When the cells were close to 100% confluence, they were digested with trypsin for 2 minutes, mixed by pipetting, centrifuged at 800 rpm for 10 minutes, the supernatant was discarded, and the infected HEK-293T cells were suspended with complete culture medium, counted, and passaged to 6-well plates (1.0×10 6 cells / well), cultured for 24 hours, and when the cell density reached 60% to 70%, it could be used for drug screening (containing 2 μg / mL puromycin), and working cells HEK-293T-Cas cells were obtained after 48 hours of screening.

[0114] (4) Application of Cells at Work

[0115] Taking the solvent group (sgControl+solvent) as an example, the operation steps of other groups are the same except for the different sgRNA and drugs. (The sgRNA in positive control group 1, positive control group 2 and drug group is B2M-sgRNA (CCTCCATGATGCTTACATGT, recorded as SEQ ID NO.1))

[0116] Induce SpCas9 expression: The working cells were cultured at a rate of 1×10 6 Cells / well were plated in a 6-well plate, and the culture medium contained 2 mL of DMEM complete medium (containing 4 μg / mL doxycycline (DOX)). After the cells adhered, the culture medium was replaced with 2 mL of DMEM complete medium (containing 4 μg / mL doxycycline (DOX) and 20 μL / well of 10 mM compound / solvent).

[0117] sgRNA transfection: sgRNA transfection was performed 12 hours later. 5 μg / well of Control-sgRNA (TTCAAGTCCGCCATGCCCGA, recorded as SEQ ID NO. 2) was dissolved in 125 μL of serum-free and antibiotic-free DMEM culture medium in solution A. 5 μL / well of solution B transfection reagent (InCellGene liponanofect) was dissolved in 125 μL of serum-free and antibiotic-free DMEM culture medium. After gently pipetting and mixing with a pipette, solution A was added dropwise to solution B, mixed, and allowed to stand at room temperature for 20 minutes. The suspension of solution A and solution B was added dropwise to one well of a 6-well plate and cultured for 72 hours.

[0118] Collect cell samples: digest the cells with trypsin and resuspend them in 1× PBS. Count the cells and take 1×10 6 cells, washed three times with 1 mL of flow cytometry eluent, resuspended with 100 μL of flow cytometry eluent after each wash, and stained with 3 μL of B2M flow cytometry antibody (BiolegendAPC anti-humanβ2-microglobulin Antibody Clone: ​​A17082A) in a 4°C refrigerator away from light for 30 minutes. After staining, washed the cells again three times with flow cytometry eluent.

[0119] (5) Flow cytometry analysis:

[0120] After washing, the cells were resuspended in 1XPBS and flow cytometry was performed using Beckman Coulter Cytoflex CytExpert software. The blank group cells were used to select live cells for APC (B2M) channel "gating" to determine the live cells. Subsequently, the CytExpert software was used to perform automated data analysis based on the distribution range of the blank group cells.

[0121] Fig.13 The results of flow cytometry are shown. HEK-293T-Cas9 cells were used to set the gate for the APC cell channel. The numbers obtained after setting the gate represent the positive rate of B2M in the cells within the gate. The positive rate of B2M in the solvent group was 97.03% ( Fig.13B), the positive rate of B2M in the negative control group was 22.16% ( Fig.13 C), the positive control group 1 (BRD0539) obtained a positive rate of B2M of 66.02% ( Fig.13 D), positive control group 2 (BRD7586) was 58.81% ( Fig.13 E), the positive rate of B2M in the sulfaphenazole group was 70.19% ( Fig.13 F), the positive rate of B2M in the 7-hydroxycoumarin group was 70.57% ( Fig.13 G), the positive rate of B2M in the vitamin E acetate group was 64.59% ( Fig.13 H). 3673 is sulfaphenazole, 3675 is 7-hydroxycoumarin, and 3681 is vitamin E acetate.

[0122] The above results show that sulfaphenazole, 7-hydroxycoumarin, and vitamin E acetate all exhibited SpCas9 cleavage inhibition activity at the cellular level that was significantly superior to that of the positive compound BRD0539 and the positive compound BRD7586.

[0123] Example 5

[0124] In vivo validation experiment of the inhibitory effect of compounds on CRISPR / Cas9 DNA cleavage

[0125] This part is an in vivo mouse validation experiment of the inhibitory effect of the compounds on CRISPR / Cas9 DNA cleavage. In this experiment, C57BL / 6 mice co-expressing Cas9 and GFP were used as tool mice, and the solvent or candidate compound was injected intraperitoneally, and sgRNA was injected by high-pressure hydrodynamic method. Finally, the proportion of GFP-positive cells in mouse liver parenchymal cells was detected by flow cytometry to evaluate the efficiency of the compounds in inhibiting SpCas9 cleavage of target DNA in vivo.

[0126] There were blank group (blank), solvent group (sgControl+solvent), negative control group (sgGFP+solvent) and compound group (sgGPF+compound).

[0127] A. Dosing of mice: Intraperitoneal injection of compound or solvent, injection dose is 50 mg / kg, the compound is first dissolved in DMSO, and then further dissolved according to the following system: 5% DMSO + 30% PEG 300 + 5% TWEEN 20 + 50% ddH2O, and the injection is continued for ten days.

[0128] B. High-pressure hydrodynamic tail vein injection of sgRNA: According to step A, on the third day of intraperitoneal administration, an equal amount of GFP-sgRNA (TTCAAGTCCGCCATGCCCGA, SEQ ID NO.2; GAAGTTCGAGGGCGACACCC, recorded as SEQ ID NO.3; GGGCACGGGCAGCTTGCCGG, recorded as SEQ ID NO.4; GATGCCGTTCTTCTGCTTGT, recorded as SEQ ID NO.5; GGTGGTGCAGATGAACTTCA, recorded as SEQ ID NO.6) was dissolved in 1×PBS and injected into mice through the tail vein at a dose of 15 μg / mouse. The volume of the solvent (mL) was one-tenth of the mouse body weight (g).

[0129] C. Extraction of hepatic parenchymal cells: After seven days of intravenous injection of sgRNA by high-pressure water injection (completed a total of 10 days of administration), hepatic parenchymal cells were isolated.

[0130] Digestive solution (1L, pH 7.4) formula:

[0131] Hanks' buffer with calcium 1L

[0132] Collagenase I (type I collagenase) 0.1g

[0133] DNaseI 2000u / 50mL buffer

[0134] Insulin 0.01g

[0135] Hydrocortisone-succinate (hydrocortisone succinate) 0.01g

[0136] Inosine 0.01g

[0137] Mice were anesthetized with chloral hydrate, fixed in the supine position, and the entire abdomen was disinfected with iodine.

[0138] A midline incision was made along the abdomen to the thorax, the intestines were removed, and the portal vein was exposed.

[0139] The needle tip was inserted into the inferior vena cava, the portal vein was cut, and 50 mL of calcium-free HBS buffer (containing 0.5 mM EGTA) was perfused within 10 minutes, and the tissue turned completely white.

[0140] 30 mL of calcium-containing HBS buffer (digestion solution) containing hormones, puromycin, collagenase, and DNase I was perfused over 10 minutes.

[0141] Place the perfused liver in a 6 cm dish, remove other tissues, add 5 mL of digestive solution, and tear the liver into pieces using forceps.

[0142] Repeatedly pipette 12 times with a rubber-tipped pipette and pass through a 200-mesh (or 70 μm) cell sieve.

[0143] Centrifuge at 50 g / min for 3 minutes. Pour off the supernatant and resuspend the cells in 10 mL 1X PBS (gently). Wash the cells twice.

[0144] Pour off the upper layer of liquid. At this point, the lower layer of cell clumps should be white, which are the separated hepatic parenchymal cells.

[0145] D. Flow cytometry analysis: Resuspend the cells in 5 mL 1X PBS, take 1 mL of the cell suspension for flow cytometry detection, use Beckman Coulter Cytoflex flow cytometer, and use CytExpert software for data processing. First, use the blank group cell detection to select live cells and "set gate" on the FITC (GFP) channel to determine the live cells. Subsequently, according to the distribution range of the blank group cells, use CytExpert software for automated data analysis.

[0146] Fig.14 The results of flow cytometry are shown. The FITC (GFP) channel is gated using the hepatic parenchymal cells of the blank group of mice. The numbers obtained after "gating" represent the GFP positive rate of cells within the gate. The GFP positive rate of the solvent group (sgControl + solvent) is 97.03% ( Fig.14 B), the positive rate of GFP in the negative control group (sgGFP+solvent group) was 22.16% ( Fig.14 C),; the positive rate of GFP in the sulfaphenazole group was 81.09% ( Fig.14 D), the GFP positive rate of 7-hydroxycoumarin group was 70.31% ( Fig.14 E), and the GFP positive rate in the vitamin E acetate group was 69.57% ( Fig.14 F). 3673 is sulfaphenazole, 3675 is 7-hydroxycoumarin, and 3681 is vitamin E acetate.

[0147] The above results show that sulfaphenazole, 7-hydroxycoumarin, and vitamin E acetate all show the ability to inhibit SpCas9 cleavage in mice. It should be noted that when the claims of the present invention involve a numerical range, it should be understood that the two endpoints of each numerical range and any value between the two endpoints can be selected. In order to avoid redundancy, the present invention describes a preferred embodiment.

[0148] Although the preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0149] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. The use of sulfaphenazole, 7-hydroxycoumarin, and vitamin E acetate in the preparation of products that inhibit SpCas9 from binding or cutting substrates, characterized in that: Sulfadiazole, 7-hydroxycoumarin, vitamin E acetate or a combination thereof; The concentration of sulfaphenazole was 1.56-500 μM; The concentration of 7-hydroxycoumarin was 1.56-500 μM; The concentration of vitamin E acetate is 6.25-500 μM.

2. The use according to claim 1, characterized in that: The product includes any one of sulfaphenazole, 7-hydroxycoumarin, and vitamin E acetate.

3. The use according to claim 2, characterized in that: The product also includes SpCas9 protein.

4. The use according to claim 3, characterized in that: The dosage ratio of sulfaphenazole, 7-hydroxycoumarin or vitamin E acetate to SpCas9 is 0.25-1mmol:5U.

5. The use according to claim 1, characterized in that: The products include sulfaphenazole, 7-hydroxycoumarin and vitamin E acetate.

6. The use according to claim 5, characterized in that: The product also includes SpCas9 protein.

7. The use according to claim 6, characterized in that: The total dosage of sulfaphenazole, 7-hydroxycoumarin and vitamin E acetate and the dosage ratio of SpCas9 are 0.25-1mmol:5U.

8. The use according to claim 7, characterized in that: When inhibiting binding or cleavage, use the PC-1400 kit from ImmunoSynthetics.

9. The use according to claim 1, characterized in that: The reaction system for inhibiting binding or cleavage is 5 μL of Cas9 protein, 5 μL of PC sgRNA, 10 μL of PC DNA, 1.2 μL of drug or solvent, and 2.4 μL of 10×Cas9 Buffer.

10. The use according to claim 1, characterized in that: When inhibiting binding or cleavage, incubate at 37°C for 30 minutes and at 85°C for 10 minutes for enzyme cleavage.

Images