PLK2 as a new target for anti-immunodeficiency virus infection therapeutic drugs and its application

Abstract

The present invention discloses PLK2 as a new target for treating immunodeficiency virus infection and its application. The present invention finds for the first time that inhibiting PLK2 expression can significantly inhibit the proliferation of HIV and SIV, provides a new drug target for the treatment of immunodeficiency virus infection in the field, provides practical experimental evidence and scientific basis for the treatment of immunodeficiency virus infection and immunodeficiency virus infection-related diseases, and has good application prospects in the field of anti-immunodeficiency virus.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and in particular, the present invention relates to PLK2 as a new target of anti-immunodeficiency virus infection therapeutic drugs and its application. Background Art

[0002] Acquired immunodeficiency syndrome (AIDS), caused by human immunodeficiency virus (HIV), has been discovered for nearly 40 years. The birth and development of combined antiretroviral therapy (cART) has transformed AIDS from a fatal infection to a controllable chronic disease. By effectively inhibiting viral replication, reducing plasma viral load, and rebuilding the immune system, cART has significantly improved the prognosis of HIV-infected people. However, because HIV can integrate its own genome into host cells to form a viral reservoir, even lifelong cART drugs cannot fundamentally eliminate HIV. Clinical studies have shown that HIV-infected people can observe viral rebound within a few weeks of stopping taking drugs, forcing HIV patients to take drugs for life and face various complications caused by drugs. Therefore, finding a new treatment strategy and new drugs to effectively inhibit HIV infection is one of the current research focuses.

[0003] PLK2 is a member of the serine / threonine kinase family. It has been found that PLK2 plays an important role in maintaining normal cell differentiation, mitosis, meiosis and other physiological processes. In studies related to viral infection and immunity, Irena Zurnic et al. showed that PLK2 can promote the integration and replication of foamy virus (FV). The binding of FV capsid protein to host PLK2 promotes the effective integration of FV genome into host chromatin, ensuring the replication and spread of the virus in infected cells. Compared with other members of the family, there are fewer studies on PLK2 in viral proliferation, and it is not clear whether it can play a role in the proliferation of HIV. Summary of the invention

[0004] In order to make up for the deficiencies of the prior art, the purpose of the present invention is to provide PLK2 as a new target for anti-immunodeficiency virus infection therapeutic drugs and its application in the preparation of anti-immunodeficiency virus infection therapeutic drugs.

[0005] In order to achieve the above object, the present invention adopts the following technical solution:

[0006] The first aspect of the present invention provides the use of an agent for inhibiting the expression or activity of PLK2 in the preparation of a medicament for preventing and / or treating immunodeficiency virus infection or immunodeficiency virus-related diseases.

[0007] Furthermore, the immunodeficiency virus infection-related diseases include pneumonia caused by immunodeficiency virus infection, psoriasis caused by immunodeficiency virus infection, atopic dermatitis caused by immunodeficiency virus infection, and enteritis caused by immunodeficiency virus infection.

[0008] Furthermore, the agent for inhibiting PLK2 expression includes an agent for inhibiting PLK2 gene mRNA expression or inhibiting PLK2 protein expression.

[0009] Furthermore, the reagent for inhibiting the expression of PLK2 gene mRNA includes siRNA targeting PLK2, and its sequence is shown in SEQ.NO.1.

[0010] Furthermore, the agent for inhibiting the activity of PLK2 protein includes ON1231320.

[0011] Furthermore, the immunodeficiency virus includes HIV or SIV.

[0012] In some embodiments, PLK2 is a serine / threonine protein kinase, a member of the polo family, and plays a key role in normal cell division. The protein encoded by this gene plays an important role in the rapid division of cells and is involved in regulating the cell cycle. In a specific embodiment of the present invention, PLK2 is found to be an important target for regulating the proliferation of HIV and SIV, and the proliferation of HIV and SIV can be inhibited by inhibiting the expression of the PLK2 gene.

[0013] In some embodiments, the reagents for inhibiting PLK2 expression include, but are not limited to, reagents that inhibit the expression of the gene encoding the PLK2 protein or reduce the expression level of the gene, and reduce the activity of the PLK2 protein, for example, reagents that inhibit the expression of the PLK2 gene or reduce its expression level, including, but not limited to, reagents that inhibit the transcriptional activity of the PLK2 gene, reagents that inhibit the transcriptional level of PLK2 mRNA, reagents that promote the degradation of PLK2 mRNA, siRNA for the PLK2 gene, shRNA for the PLK2 gene, reagents that inhibit the translation of PLK2 mRNA, reagents that specifically recognize the guide nucleic acid of the PLK2 gene and cut it to reduce its expression level, dsRNA for the PLK2 gene, microRNA for the PLK2 gene, and antisense nucleic acid for the PLK2 gene. In other embodiments, the whole PLK2 gene can also be knocked out by administering a targeting vector, thereby achieving the inhibition or reduction of PLK2 gene expression. In addition, the reagents for inhibiting PLK2 expression can also be, for example, specific antibodies targeting PLK2 or small molecule compounds that inhibit the activity of the PLK2 protein. In a specific embodiment of the present invention, the agent for inhibiting PLK2 expression is siRNA targeting PLK2, and its sequence is shown in SEQ ID NO: 1; the agent for inhibiting PLK2 activity is ON1231320.

[0014] In some embodiments, the activity of the PLK2 protein can also be reduced by introducing mutations into the PLK2 protein. In other embodiments, a mutation is introduced into the functional domain of the PLK2 protein that causes the corresponding activity to be weakened or lost. The mutation can be the insertion, deletion or substitution of one or several or even more (e.g., more than 10, more than 20, more than 30) amino acids. By administering an agent that acts on the PLK2 gene, a mutation that causes the relevant biological activity to be weakened or lost can be present in the functional domain of the PLK2 protein encoded by it. Such agents can change the sequence of the PLK2 gene, resulting in the presence of corresponding mutations in the PLK2 protein encoded by it, thereby having weakened activity or loss of activity. For example, the wild-type PLK2 gene can be replaced by a mutant PLK2 gene by homologous recombination technology, resulting in the expression of a weakly active or inactive PLK2 protein.

[0015] In some embodiments, immunodeficiency viruses include human immunodeficiency virus (HIV), simian immunodeficiency virus (SIV), bovine immunodeficiency virus (BIV), equine infectious anemia virus (EIAV), caprine arthritis-encephalitis virus (CAEV), feline immunodeficiency virus (FIV), etc. Among them, HIV is the most well-known immunodeficiency virus, which mainly attacks the human immune system, especially CD4+T lymphocytes, leading to a gradual loss of immune function, and then causing various opportunistic infections and tumors.

[0016] Further, immunodeficiency virus infection described in the present invention refers to the process that immunodeficiency virus invades body through multiple pathways and proliferates in susceptible host cells. After body is infected with immunodeficiency virus, different clinical types can be shown. According to the presence or absence of symptoms, it can be divided into dominant infection and recessive infection. Because the immunodeficiency virus that invades body is less in number, virulence is weaker or body's resistance is stronger, immunodeficiency virus proliferates in host cell, but body does not show obvious clinical symptoms, which is called recessive infection. Though recessive infection does not show clinical symptoms, immunodeficiency virus still proliferates in vivo and spreads virus to the outside world, becoming an important source of infection, therefore for the host of recessive infection, antiviral infection is also necessary. Because the immunodeficiency virus that invades body is more in number, virulence is stronger or body's resistance is weaker, immunodeficiency virus proliferates in host cell in large quantities, and obvious clinical symptoms occur, which is called dominant infection.

[0017] The second aspect of the present invention provides a pharmaceutical composition for preventing and / or treating immunodeficiency virus infection or immunodeficiency virus infection-related diseases.

[0018] Furthermore, the pharmaceutical composition comprises an agent that inhibits the expression or activity of PLK2.

[0019] Furthermore, the agent for inhibiting PLK2 expression includes an agent for inhibiting PLK2 gene mRNA expression or inhibiting PLK2 protein expression.

[0020] Furthermore, the reagent for inhibiting the expression of PLK2 gene mRNA includes siRNA targeting PLK2, and its sequence is shown in SEQ.NO.1.

[0021] Furthermore, the agent for inhibiting the activity of PLK2 protein includes ON1231320.

[0022] Furthermore, the immunodeficiency virus includes HIV or SIV.

[0023] Preferably, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier and / or excipient.

[0024] In some embodiments, the pharmaceutically acceptable carriers and / or excipients include, but are not limited to, diluents, binders, surfactants, wetting agents, adsorption carriers, lubricants, fillers, and disintegrants.

[0025] In some embodiments, the diluent includes, but is not limited to, lactose, sodium chloride, glucose, urea, starch, water, and the like.

[0026] In some embodiments, the binder includes but is not limited to starch, pregelatinized starch, dextrin, maltodextrin, sucrose, gum arabic, gelatin, methyl cellulose, carboxymethyl cellulose, ethyl cellulose, polyvinyl alcohol, polyethylene glycol, polyvinyl pyrrolidone, alginic acid and alginate, xanthan gum, hydroxypropyl cellulose and hydroxypropyl methylcellulose, etc.

[0027] In some embodiments, the surfactant includes, but is not limited to, polyoxyethylene sorbitan fatty acid ester, sodium lauryl sulfate, stearic acid monoglyceride, cetyl alcohol, and the like.

[0028] In some embodiments, the humectant includes but is not limited to glycerol, starch, and the like.

[0029] In some embodiments, the adsorption carrier includes, but is not limited to, starch, lactose, bentonite, silica gel, kaolin, and bentonite.

[0030] In some embodiments, the lubricant includes but is not limited to: zinc stearate, glyceryl monostearate, polyethylene glycol, talc, calcium and magnesium stearate, polyethylene glycol, boric acid powder, hydrogenated vegetable oil, sodium stearyl fumarate, polyoxyethylene monostearate, monolauric sucrose ester, sodium lauryl sulfate, magnesium lauryl sulfate, magnesium dodecyl sulfate, etc.

[0031] In some embodiments, the filler includes but is not limited to: mannitol (granular or powdered), xylitol, sorbitol, maltose, erythrose, microcrystalline cellulose, polymeric sugars, coupling sugars, glucose, lactose, sucrose, dextrin, starch, sodium alginate, laminarin powder, agar powder, calcium carbonate, sodium bicarbonate, etc.

[0032] In some embodiments, the disintegrant includes but is not limited to: cross-linked vinyl pyrrolidone, sodium carboxymethyl starch, low-substituted hydroxypropyl methyl, cross-linked sodium carboxymethyl cellulose, soybean polysaccharide, etc.

[0033] In some embodiments, the pharmaceutically acceptable carrier and / or excipient may additionally contain a liquid such as water, saline, glycerol and ethanol. The dosage form of the pharmaceutical composition includes, but is not limited to, tablets, pills, powders, granules, capsules, lozenges, syrups, solutions, emulsions, suspensions, controlled release preparations, aerosols, films, injections, intravenous drips, transdermal absorption preparations, ointments, lotions, adhesive preparations, suppositories, nasal preparations, pulmonary preparations, eye drops, etc., for patient ingestion.

[0034] In some embodiments, the administration of suitable pharmaceutical compositions includes any of various methods and delivery systems known to those skilled in the art to physically introduce the pharmaceutical compositions of the present invention into the subject, including but not limited to oral administration, parenteral administration, administration by inhalation spray, topical administration, rectal administration, nasal administration, buccal administration, vaginal administration, or administration by implanted drug storage devices. In the case of a pharmaceutical composition for injection, it may be in the form of a suspension, solution, or emulsion in an oily or aqueous vehicle and it may contain formulation agents, such as suspending agents, preservatives, stabilizers, and / or dispersants.

[0035] In some embodiments, the pharmaceutical composition or active ingredient described in the present invention (the agent for inhibiting PLK2 expression described in the present invention) can also be used in combination with other drugs for treating diseases related to immunodeficiency virus infection and / or anti-immunodeficiency virus agents. The combined use includes simultaneous use or sequential use, so that a therapeutically effective amount of the pharmaceutical composition or active ingredient described in the present invention and one or more other drugs for treating diseases related to immunodeficiency virus infection and / or immunodeficiency virus agents are present in the patient's body.

[0036] In some embodiments, the combined use includes administering a unit dose of the pharmaceutical composition or active ingredient of the present invention (the agent for inhibiting PLK2 expression of the present invention) before, after or simultaneously with the administration of a unit dose of one or more other drugs for treating diseases related to immunodeficiency virus infection and / or anti-immunodeficiency virus agents. For example, the pharmaceutical composition or active ingredient of the present invention can be administered within seconds, minutes or hours of the administration of one or more other drugs for treating diseases related to immunodeficiency virus infection and / or anti-immunodeficiency virus agents; for example, a unit dose of one or more other drugs for treating diseases related to immunodeficiency virus infection and / or anti-immunodeficiency virus agents can also be administered within seconds, minutes or hours of first administering a unit dose of the pharmaceutical composition or active ingredient of the present invention; for example, a unit dose of one or more other drugs for treating diseases related to immunodeficiency virus infection and / or anti-immunodeficiency virus agents and the pharmaceutical composition or active ingredient of the present invention can also be administered simultaneously.

[0037] Furthermore, other drugs for treating diseases related to immunodeficiency virus infection and / or anti-immunodeficiency virus agents used in combination with the pharmaceutical composition or active ingredient provided by the present invention (the agent for inhibiting PLK2 expression described in the present invention) include but are not limited to: zidovudine, lamivudine, abacavir, tenofovir, nevirapine, efavirenz, etravirine, ritonavir, lopinavir-ritonavir, atazanavir, dolutegravir, raltegravir, ibovavir, and maraviroc.

[0038] The third aspect of the present invention provides the use of an agent for inhibiting the expression or activity of PLK2 in the preparation of an agent for inhibiting the proliferation of immunodeficiency virus in vitro.

[0039] Furthermore, the agent for inhibiting PLK2 expression includes an agent for inhibiting PLK2 gene mRNA expression or inhibiting PLK2 protein expression.

[0040] Furthermore, the reagent for inhibiting the expression of PLK2 gene mRNA includes siRNA targeting PLK2, and its sequence is shown in SEQ.NO.1.

[0041] Furthermore, the agent for inhibiting the activity of PLK2 protein includes ON1231320.

[0042] Furthermore, the immunodeficiency virus includes HIV or SIV.

[0043] A fourth aspect of the present invention provides an in vitro method for inhibiting the proliferation of immunodeficiency virus for non-therapeutic purposes.

[0044] Furthermore, the method comprises the following step: treating the immunodeficiency virus with an effective amount of an agent capable of inhibiting the expression or activity of PLK2 or a pharmaceutical composition comprising an effective amount of an agent capable of inhibiting the expression or activity of PLK2.

[0045] Furthermore, the agent for inhibiting PLK2 expression includes an agent for inhibiting PLK2 gene mRNA expression or inhibiting PLK2 protein expression.

[0046] Furthermore, the reagent for inhibiting the expression of PLK2 gene mRNA includes siRNA targeting PLK2, and its sequence is shown in SEQ.NO.1.

[0047] Furthermore, the agent for inhibiting the activity of PLK2 protein includes ON1231320.

[0048] Furthermore, the immunodeficiency virus includes HIV or SIV.

[0049] A fifth aspect of the present invention provides a system for inhibiting the proliferation of immunodeficiency viruses.

[0050] Furthermore, the system includes a treatment unit for treating immunodeficiency virus using a therapeutically effective amount of an agent that inhibits PLK2 expression or activity.

[0051] Furthermore, the agent for inhibiting PLK2 expression includes an agent for inhibiting PLK2 gene mRNA expression or inhibiting PLK2 protein expression.

[0052] Furthermore, the reagent for inhibiting the expression of PLK2 gene mRNA includes siRNA targeting PLK2, and its sequence is shown in SEQ.NO.1.

[0053] Furthermore, the agent for inhibiting the activity of PLK2 protein includes ON1231320.

[0054] Furthermore, the immunodeficiency virus includes HIV or SIV.

[0055] In the present invention, the term "effective amount" refers to the therapeutic amount required to alleviate at least one or more symptoms of a disease or condition, and relates to a sufficient amount of a drug that provides a desired effect. Therefore, the term "therapeutically effective amount" refers to a therapeutic amount sufficient to cause a specific effect when applied to a typical subject. In various contexts, the effective amount as used herein also includes an amount sufficient to delay the development of a disease condition, change the course of the disease (for example, but not limited to, slowing the progression of disease symptoms), or reverse the disease condition. It should be understood that there are many ways known in the art to determine the effective amount for a given application. For example, pharmacological methods for dose determination can be used in the treatment context. In the context of therapeutic or preventive applications, the amount of the composition applied to the subject will depend on the type and severity of the disease and the characteristics of the individual, such as overall health, age, sex, weight and tolerance to the drug. It also depends on the degree, severity and type of the disease. Those skilled in the art will be able to determine the appropriate dose based on these and other factors. For example, the therapeutically effective amount of Daidzin can be determined by referring to its current safe use amount for the treatment of arterial thrombotic disease patients for the treatment of arterial thrombotic disease, and by clinical investigation. The appropriate effective dosage also needs to take into account therapeutic factors such as the dosage form of the drug, the constitution, weight, age, disease progression, and administration site of the individual being administered.

[0056] In certain specific embodiments, the system provided by the present invention includes a computer-readable storage medium for storing computer-readable programs or instructions. When the programs or instructions are executed by the processor, the functions of the treatment unit or the judgment unit in the system of the present invention can be realized.

[0057] A sixth aspect of the present invention provides the use of PLK2 in screening candidate drugs for preventing and / or treating immunodeficiency virus infection or immunodeficiency virus infection-related diseases.

[0058] A seventh aspect of the present invention provides a method for screening candidate drugs for preventing and / or treating immunodeficiency virus infection or immunodeficiency virus infection-related diseases.

[0059] Further, the method comprises the following steps:

[0060] Treating a system expressing or containing PLK2 with a test substance;

[0061] Detecting the expression level or activity of PLK2 in the system;

[0062] If the substance to be tested can inhibit the expression level or activity of PLK2, it indicates that the substance is a candidate drug for preventing and / or treating immunodeficiency virus infection or immunodeficiency virus infection-related diseases.

[0063] In some embodiments, the system includes, but is not limited to, a cell system, a subcellular system, a solution system, a tissue system, an organ system, or an animal system (such as an animal model, preferably an animal model of a non-human mammal, such as a mouse, rabbit, sheep, or monkey).

[0064] In some embodiments, the substance to be tested includes, but is not limited to: nucleic acid inhibitors and small molecule compounds designed for PLK2.

[0065] Preferably, the nucleic acid inhibitor is selected from: dsRNA, antisense nucleic acid, small interfering RNA, micro RNA; or a construct capable of expressing or forming the dsRNA, antisense nucleic acid, small interfering RNA, micro RNA.

[0066] Preferably, the source of the small molecule compound is selected from: newly synthesized or existing databases; wherein the existing databases include but are not limited to universal natural product databases (COCONUT, SuperNatural II, NPASS), plant natural product databases (KNApSaCK, CMAUP, TriForC, Alkamid, NPACT DB, BioPhytMol), Chinese medicine natural product databases (TCM@CEMTDD, CHDD, ETCM, TM-MC, TCMID, YaTCM), microbial natural product databases (StreptomeDB, NPAltas, ProCarDB, PAMDB, Lichen Database), marine natural product databases (MNPD, SWMD), natural product databases of different countries and regions (IMPPAT, NeMedPlant, MedPServer, TlPdb, AfroDB, ANPDB, BIOFACQUIM, NUBBEDB), food natural product databases (FooDB, BitterDB, Phenol-Explorer, PhytoHub, SuperSweet database), toxic natural product databases (Exposome-Explorer, T3DB, SnakeNeurotoxin Database, TPPT), natural product industry catalogs (Greenpharma, AnalytiCon Discovery, InterBioScreen, Indofine Chemical Company, Pi Chemicals Systems\Specs, TargetMol), databases for deduplication using MS data (MoNA, MassBank, METLIN, HMDB, YMDB, ReSpect, GNPS), databases for deduplication using NMR data (NMRShiftDB, NAPROC-13), etc.

[0067] Furthermore, the method for detecting PLK2 expression includes, but is not limited to, reverse transcription polymerase chain reaction (RT-PCR), competitive RT-PCR, real-time RT-PCR, ribonuclease protection assay (RPA), Northern blotting, and DNA chip.

[0068] Preferably, the reagent for detecting the expression level of PLK2 comprises a primer, a probe or an antisense nucleotide that specifically binds to the mRNA encoding the PLK2 gene. Information about the PLK2 protein can be obtained through NCBI, and those skilled in the art can design primers, probes or antisense nucleotides that specifically bind to the mRNA of the gene encoding the protein based on the information.

[0069] Further, the method for detecting the expression level of PLK2 protein includes but is not limited to: protein chip assay, immunoassay, ligand binding test, MALDI-TOF (matrix-assisted laser desorption / ionization time-of-flight mass spectrometry), SELDI-TOF (surface-enhanced laser desorption / ionization time-of-flight mass spectrometry), radioimmunoassay, radial immunodiffusion, bidirectional immunodiffusion (Ouchterlony immunodiffusion), rocket immunoelectrophoresis, immunohistochemical staining, complement fixation test, 2-D electrophoresis, liquid chromatography-mass spectrometry (LC-MS), liquid chromatography-mass spectrometry / mass spectrometry (LC-MS / MS), immunoblotting, and ELISA (enzyme-linked immunosorbent assay).

[0070] Preferably, the reagent for detecting the expression level of PLK2 protein may comprise an antibody, an oligopeptide, a ligand, a PNA (peptide nucleic acid) or an aptamer that can specifically bind to the protein PLK2.

[0071] In some embodiments, the method further includes: further testing the candidate drug obtained in the above steps, wherein the test includes testing its anti-immunodeficiency virus effect. If the tested candidate drug has a significant inhibitory effect on immunodeficiency virus infection, a significant inhibitory effect on immunodeficiency virus replication, and / or a significant inhibitory effect on immunodeficiency virus transcription, then the candidate drug is a candidate drug for preventing and / or treating immunodeficiency virus.

[0072] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0073] The present invention discovers for the first time that inhibiting PLK2 expression can significantly inhibit the proliferation of HIV and SIV, and through a series of experiments clearly proves that PLK2 can serve as a new target for anti-HIV and SIV infection therapeutic drugs, providing a new idea for the treatment and / or prevention of immunodeficiency virus infection diseases, and providing practical experimental evidence and scientific basis for the clinical treatment of immunodeficiency virus infection diseases, and has good application prospects in anti-immunodeficiency virus. BRIEF DESCRIPTION OF THE DRAWINGS

[0074] Figure 1 This is a graph showing the effect of PLK2 overexpression on HIV-1NL4-3 infection;

[0075] Figure 2 This is a diagram of the knockdown effect of PLK2 siRNA detected by qPCR;

[0076] Figure 3 This is a graph showing the effect of knocking down PLK2 on SIV proliferation;

[0077] Figure 4The cytotoxicity of PLK2 inhibitor on TZM-bl cells was detected by CCK6;

[0078] Figure 5 This figure shows the effect of PLK2 inhibitors on HIV and SIV proliferation. DETAILED DESCRIPTION

[0079] The present invention will be further described in detail below in conjunction with the accompanying drawings and examples. The following examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. Simple improvements to the present invention made according to the essence of the present invention all fall within the scope of protection claimed in the present invention.

[0080] Reference to "embodiments" herein means that a particular feature, structure, or characteristic described in conjunction with the embodiments may be included in at least one embodiment of the present invention. The appearance of the phrase in various places in the specification does not necessarily refer to the same embodiment, nor is it an independent or alternative embodiment that is mutually exclusive with other embodiments. It is explicitly and implicitly understood by those skilled in the art that the embodiments described herein may be combined with other embodiments.

[0081] The experimental methods in the following examples are conventional methods unless otherwise specified, and are performed according to the techniques or conditions described in the literature in the art or according to the product instructions. The materials, reagents, etc. used in the following examples are all commercially available unless otherwise specified. The quantitative tests in the following examples were repeated three times, and the results were averaged.

[0082] The sources of cells, viruses and plasmids involved in the following examples are as follows:

[0083] HEK 293T cells and TZM-bl cells used in the experiment were from ATCC. HEK 293T and TZM-bl cells were cultured in DMEM medium and RPMI1640 medium supplemented with 10% fetal bovine serum and 2% penicillin-streptomycin antibiotic mixture, respectively. Plasmids pcDNA3.1-lenti3flag / PLK2, pCD4, and pCXCR4 were from the Biotherapy Research Laboratory of China Medical University. Virus strains HIV-1NL4-3, HIV-1JRFL, HIV-1JRCSF, HIV-1SF162, and SIVmac239 were from the Institute of Pathogenic Biology, Chinese Academy of Medical Sciences.

[0084] The sources of the biological reagents involved in the following examples are as follows:

[0085] PLK2 inhibitor ON1231320 (Cat.S8342) was purchased from Selleck; DEAE-dextran transfection reagent was purchased from Beyotime; LipoD293TM transfection reagent was purchased from SignaGen; Lipofectamine3000 transfection reagent was purchased from ThermoFisher; luciferase assay kit (Cat.E1500) was purchased from Promega; CCK8 detection reagent (Cat.C0037) was purchased from Beyotime; siRNA (sequence: UGACUAUCAUCCGAAUAGCAU, SEQ ID NO:1) was commissioned to be synthesized by GenScript; RNeasy Mini Kit (Cat.74104) was purchased from QIAGEN; PrimeScriptTMRTreagent Kit with gDNAEraser (Cat.RR047Q) was purchased from TaKaRa; TB Green Premix ExTaqTMⅡ (Cat.RR820A) was purchased from TaKaRa, GibcoTM fetal bovine serum (Cat.10091148) was purchased from ThermoFisher, HycloneTM penicillin-streptomycin antibiotic mixture (Cat.SV30010), HycloneTM RPMI1640 culture medium (Cat.SH30027.01), and HycloneTM DMEM culture medium (Cat.SH30243.01) were all purchased from Cytiva.

[0086] Example 1 PLK2 overexpression promotes HIV proliferation in cells

[0087] 1. Experimental methods

[0088] 18-24 hours before transfection, plate 6-well plates at 0.8×10 6HEK 293T cells were inoculated into cells / well, and 0.5 / 1.0 μg PLK2 / Lenti-3Flag / Lenti-3Flag empty vector + 0.5 μg pCD4 + 0.5 μg pCXCR4 DNA was diluted to 100 μL with serum-free DMEM and mixed. Add 4.5 μL LipoD293 to each tube; mix gently; incubate at room temperature for 10 minutes to form a DNA-LipoD293 transfection complex; drop 100 μL DNA-LipoD293 complex into each well of the culture medium, and gently rotate the plate to make the mixture uniform; 4 to 6 hours after transfection, remove the culture medium containing the DNA-LipoD293 complex and replace it with DMEM culture medium containing 10% fetal bovine serum and 2% penicillin-streptomycin antibiotic mixture; 24 hours after transfection, infect the cells with NL4-3.Luc (X4-Env) (100 ng p24); 24 hours after infection, determine the proliferation of HIV by analyzing the level of luciferase (Luc) in the cells.

[0089] 2. Experimental results

[0090] The results are as follows Figure 1 As shown, in cells transfected with 0.5 μg PLK2 plasmid, the Luc value increased from 6293.3±266.3 to 84173.3±2583.1, an increase of about 15 times; in cells transfected with 1.0 μg PLK2 plasmid, the Luc value increased from 5506.7±201.3 to 64013.3±1414.4, an increase of about 12 times. The results show that PLK2 overexpression has a strong promoting effect on HIV proliferation.

[0091] Example 2 Effect of siRNA silencing PLK2 expression on SIV proliferation

[0092] 1. Experimental methods

[0093] (1) PLK2 siRNA knockdown efficiency verification: One day before transfection, 1×10 5TZM-bl cells were inoculated with 500 μL / well RPMI1640 medium during inoculation; during transfection, the cell confluence was about 70%-80%. One hour before transfection, the medium was discarded and replaced with fresh RPMI1640 medium. siRNA was diluted with 50 μL Opti-MEM medium (the final concentration of transfected cells was 100 nM), and the mixture was gently pipetted and mixed 10-15 times. Gently mix the transfection reagent, dilute 1.5 μL Lipofectamine3000 with 50 μL Opti-MEM, and mix it 10-15 times, and let it stand at room temperature for 5 minutes. The diluted Lipofectamine3000 was added dropwise to the diluted siRNA solution, and the mixture was gently pipetted and mixed 15-20 times, and incubated at room temperature for 15 minutes. 100 μL of transfection complex was added dropwise to the 24-well cell plate, and the cell plate was gently shaken back and forth to mix evenly, and the cell plate was placed in a 37°C, 5% CO2 cell incubator for 36 hours. 36 hours after transfection, cells were collected and intracellular RNA was extracted according to the instructions of RNeasy mini kit. The brief operation is as follows: 1) Lyse cells with 350 μL RLT lysis buffer; 2) Add an equal volume of 70% ethanol, mix well and transfer to RNA adsorption column (RNeasy spin column), centrifuge at 12000rpm for 30s and discard the filtrate; 3) Add 700 μL RW1 to RNA adsorption column, centrifuge at 12000rpm for 30s, and discard the filtrate; 4) Add 500 μL RPE to RNA adsorption column, centrifuge at 12000rpm for 30s, discard the filtrate, and repeat once; 5) Centrifuge at 12000rpm for 5min to remove residual RPE; 6) Place RNA adsorption column in 1.5mL RNase-free EP tube and add 40 μL RNase-free water to RNA adsorption column; 7) Centrifuge at 12000rpm for 2min to obtain RNA solution, and use Nanodrop1000 to measure RNA concentration.

[0094] RT-PCR: Take 500 ng of the above RNA sample, add 2 μL gDNA eraserbufferⅡ, 1 μL gDNAeraser, incubate at 42℃ for 5 min, and cool on ice. Then perform reverse transcription according to the system in Table 1.

[0095] Table 1 Reverse transcription system

[0096]

[0097] The reverse transcription temperature program was 37°C, 15 min; 85°C, 5 s.

[0098] cDNA was reacted using TB Green Permix Ex TaqTMⅡ according to the system in Table 2.

[0099] Table 2 qPCR amplification system

[0100]

[0101] The amplification program was 95°C for 30 s; 95°C for 5 s, 60°C for 34 s, repeated for 40 cycles.

[0102] (2) Effect of PLK2 knockdown on SIV proliferation: TZM-bl cells were cultured at 1×10 5 The cells were plated in a 24-well plate at a concentration of 10 cells / mL and cultured in a cell culture incubator at 37°C and 5% CO2. PLK2 siRNA was transfected using Lipofectamine 3000 (the transfection method was consistent with the PLK2 siRNA silencing efficiency verification method in Example 2 (1). After 48 hours of transfection, 50 μL of SIV strains (SIVmac239 and SIVPBj) were added to the culture wells and cultured in a cell culture incubator at 37°C and 5% CO2 for 48 hours before the cells were collected; 30 μL of PLB cell lysis buffer was added to each well and lysed at room temperature for 15 minutes. 100 μL of luciferase substrate reagent LAR was added to each well and mixed well, and then the relative fluorescence unit (RLU) was measured to calculate the effect of knocking down PLK2 in cells on HIV proliferation.

[0103] 2. Experimental results

[0104] (1) qPCR results Figure 2 As shown, compared with Mock, the silencing efficiency of PLK2 at 100 nM of PLK2 siRNA was about 90%, so 100 nM was used as the concentration for knocking down PLK2 in subsequent experiments.

[0105] (2) The effects of PLK2 knockdown on SIV proliferation Figure 3 As shown, compared with the control group, after silencing PLK2 using siRNA, the proliferation of SIVmac239 and SIVPBj in cells was downregulated by 43.6±1.6% and 43.4±6.7%, respectively, indicating that PLK2 silencing can effectively inhibit SIV infection.

[0106] Example 3 Effects of PLK2 inhibitors on HIV and SIV infection

[0107] In order to further clarify the role of PLK2 in HIV and SIV proliferation, this study selected the PLK2-specific inhibitor ON1231320 (Selleck, S8342) to screen its role in inhibiting viral proliferation.

[0108] 1. Experimental methods

[0109] (1) Determination of cytotoxicity of PLK2 inhibitors on TZM-bl cells: TZM-bl cells were seeded at 5000 cells / well in a 96-well plate one day before the experiment (100 μL / well, RPMI1640 medium). After the cells adhered, the medium was discarded and replaced with fresh RPMI1640 medium. PLK2 inhibitor ON1231320 (drug 200 μM, 50 μM, 12.5 μM, 3.125 μM, 0.781 μM, 0.048 μM and 0.012 μM) was added. After culturing in a 37°C, 5% CO2 cell culture incubator for 48 hours, 10 μL of CCK-8 solution was added to each well, mixed and incubated in a 37°C, 5% CO2 cell culture incubator for 2 hours. The absorbance was measured at OD450 nm, and the cytotoxicity of the inhibitor at the corresponding concentration was calculated.

[0110] (2) Effects of PLK2 inhibitors on infection with different virus strains: The PLK2 inhibitor ON1231320 was diluted 3-fold in a 96-well cell culture plate (12.500 μM, 4.166 μM, 1.388 μM, 0.462 μM, 0.154 μM, 0.051 μM, 0.0171 μM, 0.0057 μM and 0.0019 μM), 50 μL / well, with 3 replicate wells and 9 concentration gradients. The virus strains were added to the wells containing different concentrations of the drug and incubated at 37°C for 30 min. The pre-cultured TZM-bl cells (1×10 4 cells / well), DEAE-dextran was added to a concentration of 15 μg / mL, and then added to a 96-well plate (100 μL / well), and cultured in a cell culture incubator at 37°C and 5% CO2. After 48 hours, the culture medium was discarded, and PLB cell lysis solution was added at 30 μL / well, and lysed at room temperature for 15 minutes, and then the luciferase substrate LAR was added, mixed and the relative fluorescence unit (RLU) was measured, and the inhibition rate of ON123132 on HIV proliferation in cells and the drug half-inhibitory concentration (IC50) were analyzed.

[0111] 2. Experimental results

[0112] (1) CCK8 results Figure 4 As shown, the PLK2 inhibitor ON1231320 had no detectable toxicity to TZM-bl cells at a concentration of 0 to 3.125 μM, but had a certain cytotoxicity at a concentration of 12.5 μM, at which the survival rate of TZM-bl cells was approximately 67%.

[0113] (2) IC50 values ​​of PLK2 inhibitors against different strains (HIV-1NL4-3, HIV-1JRFL, HIV-1JRCSF, HIV-1SF162 and SIVmac239) Figure 5As shown, the IC50 of ON1231320 against strain NL4-3 is 48.95±1.17 (nM), the IC50 against strain JRFL is 40.99±5.36 (nM), the IC50 against JRCSF is 52.45±5.63 (nM), the IC50 against SF162 is 44.81±0.33 (nM), and the IC50 against SIV239 is 43.98±1.11 (nM). The results show that the PLK2 inhibitor ON1231320 has a significant inhibitory level (<50nM) against both HIV strains and SIV strains, and has the potential to inhibit and treat HIV infection.

[0114] In summary, the present invention found that PLK2 overexpression can promote HIV proliferation in cells, while knocking down PLK2 will inhibit viral proliferation. These research results indicate that PLK2 plays an important role in HIV virus proliferation; subsequently, it was discovered that the PLK2 inhibitor ON1231320 can significantly inhibit the proliferation of different HIV and SIV strains in cells at extremely low concentrations (<50nM).

[0115] The description of the above embodiments is only used to understand the method and core idea of ​​the present invention. It should be pointed out that, for those skilled in the art, several improvements and modifications can be made to the present invention without departing from the principle of the present invention, and these improvements and modifications will also fall within the scope of protection of the claims of the present invention.

Claims

1. Use of an agent for inhibiting PLK2 expression in the preparation of a drug for preventing and / or treating SIV virus infection or SIV virus infection-related diseases; The reagent for inhibiting PLK2 expression is siRNA targeting PLK2, and its sequence is shown in SEQ ID NO:

1.

2. Use of an agent that inhibits PLK2 activity in the preparation of a drug for preventing and / or treating immunodeficiency virus infection or immunodeficiency virus infection-related diseases; The reagent for inhibiting PLK2 protein activity is ON1231320; The immunodeficiency virus is HIV or SIV.

3. The use according to claim 2, characterized in that: The immunodeficiency virus infection-related diseases include pneumonia caused by immunodeficiency virus infection, psoriasis caused by immunodeficiency virus infection, atopic dermatitis caused by immunodeficiency virus infection, and enteritis caused by immunodeficiency virus infection.

Images