Application of stearoyl-CoA desaturase as target for preventing and treating aortic aneurysm and dissection

Abstract

The invention discloses application of stearoyl-CoA desaturase as a target spot for preventing and treating aortic aneurysm and dissection. By detecting the expression condition of the SCD1 gene in aortic tissues of an AAD patient and an AAD model mouse, the SCD1 is closely related to the occurrence and development of the AAD; meanwhile, an AAD model is constructed by applying SCD1 gene whole body knockout (Scd1- / -) and SCD1 vascular smooth muscle specific overexpression mice (Scd1-VSMC-KI), the prevention and treatment effect of SCD1 on AAD is detected through indexes such as survival rate, aortic dilatation degree, aortic dissection and aortic aneurysm formation proportion and the like, and the result shows that the occurrence and progress of AAD can be effectively relieved through targeted excitation of SCD1, and the AAD can be used for preventing and treating AAD. The research and development of the medicine aiming at the SCD1 are expected to become a new strategy for preventing and treating the AAD, and the medicine has important application value.

Description

Technical Field

[0001] The invention relates to application of stearoyl-CoA desaturase (SCD1) as a target for prevention and treatment of aortic aneurysm and dissection, and belongs to the technical field of biomedicine. Background Art

[0002] Aortic aneurysm / dissection (AAD) is a common life-threatening aortic disease. Current treatment is limited to regular imaging monitoring of aortic diameter and surgical repair. There is no effective drug therapy that can limit the progression of AAD or prevent its rupture. Therefore, it is crucial to explore potential therapeutic targets for AAD.

[0003] Stearoyl-CoA desaturase (SCD) is a transmembrane protein located in the endoplasmic reticulum (ER) that is responsible for introducing double bonds into saturated fatty acids to form unsaturated fatty acids. Polyunsaturated fatty acids usually regulate the mitochondrial metabolic health of cells and confer cardiovascular protection. The abnormal accumulation of saturated fatty acids causes endoplasmic reticulum stress and inflammatory response, aggravating the progression of AAD. SCD1 has been widely reported to participate in the progression of diseases such as heart failure and tumors by regulating metabolic reprogramming. However, it is unclear whether SCD1 is involved in the disease progression of AAD. There are currently no reports on the role of SCD1 as a preventive and therapeutic target in AAD and its diagnostic and therapeutic value. Summary of the invention

[0004] The purpose of the present invention is to address the technical problem of insufficient existing drugs for preventing and treating AAD; the present invention provides the application of stearoyl-CoA desaturase (SCD1) as a target for the prevention and treatment of aortic aneurysm / dissection. The present invention shows that SCD1 is closely related to the occurrence and development of AAD through detection in clinical samples and animal samples, and proves through animal experiments that targeted inhibition of SCD1 can effectively aggravate the progression of AAD, while targeted stimulation of SCD1 can effectively alleviate the occurrence and progression of AAD, indicating that drug development targeting SCD1 is expected to become a new strategy for the prevention and treatment of AAD and has important application value.

[0005] In order to achieve the above object, the present invention provides the use of SCD1 as a target in the preparation or screening of drugs for treating aortic aneurysms and dissections.

[0006] The present invention also provides the use of SCD1 gene or protein, expression vector of SCD1 gene or protein, reagent for promoting or activating SCD1 gene expression or transcription, and reagent for promoting SCD1 protein expression or activity in preparing drugs for treating aortic aneurysm and dissection.

[0007] Preferably, the reagent for promoting or activating SCD1 gene expression or transcription comprises at least one of an SCD1 gene overexpression vector, an SCD1 gene overexpression cell, and an SCD1 mRNA liposome.

[0008] Preferably, the synthetic primer sequence of the sgRNA is shown in SEQ ID NO: 2.

[0009] Preferably, the agent that promotes the expression or activity of SCD1 protein comprises SCD1 recombinant protein.

[0010] Compared with the prior art, the present invention has the following beneficial effects:

[0011] The present invention detected the expression of SCD1 gene in aortic tissue of AAD patients and AAD model mice and found that SCD1 was closely related to the occurrence and development of AAD. - / - ) and SCD1 vascular smooth muscle specific overexpression mice (Scd1-VSMC-KI) were used to construct an AAD model, and the preventive and therapeutic effects of SCD1 on AAD were detected by measuring indicators such as survival rate, degree of aortic dilatation, and degree of aortic lesions. The present invention provides a theoretical basis for the application of SCD1 in the clinical prevention and treatment of AAD. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 .The expression level of SCD1 in the aorta of AAA patients and model mice was significantly increased: (A) Comparison of the expression level of SCD1 in the aorta of AAD mice and normal control mice; (B) Comparison of the expression level of SCD1 in the aorta of AAA patients and normal people; p<0.05 was considered statistically significant; ** indicates p<0.01, *** indicates p<0.001.

[0013] Figure 2 . Aortic dilatation and pathological changes in mice in each group: (A) Representative images of the whole aorta of AAD model mice in each group; (B) Statistical comparison of the maximum diameter of aortic dilatation between control group and AAD model mice; (C) Survival rate analysis of AAD model mice in each group; p<0.05 was considered statistically significant; *** indicates p<0.001 compared with WT group, ### indicates p<0.001 compared with Scd1 fl / fl P<0.001 compared with the other two groups. DETAILED DESCRIPTION

[0014] In order to make the present invention more clearly understood, preferred embodiments are described in detail below with reference to the accompanying drawings.

[0015] The experimental methods in the following examples without specifying specific conditions were performed according to conventional methods and conditions, or selected according to the product instructions; the materials and reagents used were conventional commercially available products unless otherwise specified; the quantitative tests involved were repeated three times and the results were averaged.

[0016] Example

[0017] (I) Experimental plan

[0018] In this example, adult male C57BL / 6 (purchased from Shanghai Jiesijie Experimental Animal Co., Ltd.) and SCD1 knockout and overexpression mice (8 weeks old, 20-25g) were used. The mice were subcutaneously injected with AngⅡ (2500ng / kg·min) using a subcutaneously implanted micro-osmotic sustained-release pump for 28 days to construct an aortic aneurysm and dissection (AAD) model. The control group (control group) was subcutaneously injected with 0.9% saline with an osmotic volume of 0.5μl / hr in the same way. The mice were divided into wild-type group (WT group), KO group (Scd1 group) according to their genotype. - / - , Scd1 knockout group), Scd1 fl / fl The survival curves of mice were recorded daily in the KI group (control group of KI group) and the KI group (Scd1-VSMC-KI, Scd1 gene knock-in group). fl / fl The mice in the KO group, KO group and KI group were provided by Saiye Biotechnology Co., Ltd.; the mice in the KI group were targeted with the Scd1 gene of the target mouse using CRISPR-Cas9 gene editing technology, and the NCB1 reference sequence of the mouse Scd1 gene was: NM 009127.4; the sgRNA targeting sequence for CRISPR-Cas9 gene editing was: 5'-CTCCAGTCTTTCTAGAAGATGGG-3' (SEQ ID NO: 1), and the synthetic primer sequence was: 5'-CUCCAGUCUUUCUAGAAGAUGUUUUAGAGCUAGAAAUAGCAAGUUA AAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGU GCUUUU-3' (SEQ ID NO: 2). The mice were euthanized 28 days later, and the aortic tissue was fixed and embedded to observe the aortic lesions. The experimental protocol was approved by the Animal Care and Ethics Committee of Fudan University. Aortic tissues were obtained from AAD patients who underwent aortic replacement and non-AAD organ donation patients to detect the expression of SCD1 in aortic tissues of different populations. All experimental protocols using human specimens were approved by the Institutional Ethics Committee of Zhongshan Hospital Affiliated to Fudan University. All patients signed informed consent.

[0019] (II) Experimental results

[0020] 1) The expression level of SCD1 in the aorta of AAD patients and model mice is significantly increased

[0021] By detecting the expression of SCD1 in aortic tissues of different mice and people, the results showed that the expression level of SCD1 in AAD-WT modeling mice was significantly increased compared with the control group (control-WT). Figure 1 As shown in A. Compared with healthy donors (control), the expression level of SCD1 in the aorta of AAD patients was significantly increased, as shown in Figure 1 As shown in B.

[0022] 2) The results of detecting the dilation and pathological changes of the aorta in each group of model mice showed that the maximum diameter of the dilated aorta in the KO group was significantly increased ( Figure 2 AB), the proportion of dissection and aneurysm formation increased ( Figure 2 AB), the survival curve statistics show that the mortality rate caused by aortic rupture is increased ( Figure 2 C); these lesions were significantly improved in the KI group, such as Figure 2 shown.

[0023] The above description is only a preferred embodiment of the present invention and is not any formal or substantial limitation of the present invention. It should be pointed out that a person skilled in the art can make several improvements and supplements without departing from the present invention, and these improvements and supplements should also be regarded as the protection scope of the present invention.

Claims

1. Application of SCD1 as a target in the preparation or screening of drugs for the treatment of aortic aneurysm and dissection.

2. Use of SCD1 gene or protein, expression vector of SCD1 gene or protein, reagents for promoting or activating SCD1 gene expression or transcription, and reagents for promoting SCD1 protein expression or activity in the preparation of drugs for treating aortic aneurysm and dissection.

3. The use according to claim 2, characterized in that The reagent for promoting or activating SCD1 gene expression or transcription includes at least one of an SCD1 gene overexpression vector, an SCD1 gene overexpression cell, an SCD1 mRNA liposome, and an sgRNA used for CRISPR-Cas9 gene knock-in.

4. The use according to claim 3, characterized in that The synthetic primer sequence of the sgRNA is shown in SEQ ID NO:

2.

5. The use according to claim 2, characterized in that The reagent for promoting the expression or activity of SCD1 protein includes SCD1 recombinant protein.

Images