A mutant of reduced coenzyme NADH oxidase and its application

Abstract

The present invention discloses a mutant of reduced coenzyme NADH oxidase and its application. In the mutant, at least one amino acid at positions 156, 158, and 294 in the amino acid sequence shown in SEQ ID No. 1 is replaced; glycine Gly at position 156 is mutated to alanine Ala, isoleucine Ile at position 158 is mutated to histidine His, and isoleucine Ile at position 294 is mutated to phenylalanine Phe. By mutating the active site of NADH oxidase, the mutant finally obtained by the present invention improves the regeneration efficiency of reducing coenzyme NADH to oxidized coenzyme NAD+.

Description

Technical Field

[0001] The present invention relates to the technical fields of enzyme engineering and chemical engineering, and particularly relates to a mutant of reduced coenzyme NADH oxidase and its application. Background Art

[0002] NADH oxidases (NOX) are FAD-dependent redox enzymes belonging to the flavoprotein disulfide reductase family. Most of them are homodimers, and the relative molecular mass of a single subunit is generally 46 - 56 kDa. In the presence of oxygen, this enzyme can catalyze the oxidation of reduced coenzyme NADH to oxidized coenzyme NAD + , while oxygen is reduced to H2O2 through a two-electron transfer or to H2O through a four-electron transfer. NOX is widely present in lactic acid bacteria. For example, NOX activity can be found in 22 lactic acid strains such as Lactobacillus, Micrococcus, Leuconostoc, and Streptococcus. The physiological functions of NOX mainly focus on scavenging the oxygen toxicity in cells, maintaining the basic conditions for normal cell growth and metabolism, and regulating cell physiology and metabolism.

[0003] In addition, redox enzymes are a class of enzymes widely present in nature. With the development of industry, redox enzymes have been increasingly applied, such as the oxidation of alcohols and amines, the stereoselective reduction of aldehydes and ketones, and the production of chiral alcohols through deracemization. At the same time, the vast majority of redox enzymes use nicotinamide adenine dinucleotide (NAD + ) as an electron shuttle. However, for industrial applications, the cost of NAD + is high, making it difficult to use it in equimolar-driven redox reactions. Therefore, the development of an efficient and economical cofactor regeneration system is crucial. Since NADH oxidase can regenerate oxidized coenzyme NAD + , it can be used in conjunction with various enzymes to achieve coenzyme regeneration. However, the activity of natural NADH oxidase is currently low and difficult to meet the actual production requirements. Therefore, it is of great significance to develop NADH oxidase with high enzyme activity. Summary of the Invention

[0004] Object of the Invention: The first object of the present invention is to solve the problem of the low activity of natural NADH oxidase. Key amino acid residues are selected for saturation or semi-saturation mutagenesis, and a mutant library is constructed for effective screening to obtain a class of NADH oxidase mutants with high enzyme activity. The second object of the present invention is to provide the application of the NADH oxidase mutant in oxidizing reduced coenzyme NADH to oxidized coenzyme.

[0005] Technical solution: The reduced coenzyme NADH oxidase mutant of the present invention is a mutant in which at least one amino acid at positions 156, 158, and 294 of the amino acid sequence shown in SEQ ID No. 1 is replaced; glycine Gly at position 156 is mutated to alanine Ala, isoleucine Ile at position 158 is mutated to histidine His, and isoleucine Ile at position 294 is mutated to phenylalanine Phe.

[0006] Preferably, the mutant includes G156A, I158H, I294F, G156A / I158H, G156A / I294F, I158H / I294F or G156A / I158H / I294F.

[0007] The wild-type NADH oxidase is derived from Lactiplantibacillus pentosus, with the amino acid sequence of SEQ ID NO. 1 and the gene sequence of: SEQ ID NO. 2.

[0008] The mutant G156A means that glycine Gly at position 156 is mutated to alanine Ala.

[0009] The mutant I158H means that isoleucine Ile at position 158 is mutated to histidine His.

[0010] The mutant I294F means that isoleucine Ile at position 294 is mutated to phenylalanine Phe.

[0011] The mutant G156A / I158H means that glycine Gly at position 156 is mutated to alanine Ala and isoleucine Ile at position 158 is mutated to histidine His.

[0012] The mutant G156A / I294F means that glycine Gly at position 156 is mutated to alanine Ala and isoleucine Ile at position 294 is mutated to phenylalanine Phe.

[0013] The mutant I158H / I294F means that isoleucine Ile at position 158 is mutated to histidine His and isoleucine Ile at position 294 is mutated to phenylalanine Phe.

[0014] The mutant G156A / I158H / I294F means that glycine Gly at position 156 is mutated to alanine Ala, isoleucine Ile at position 158 is mutated to histidine His, and isoleucine Ile at position 294 is mutated to phenylalanine Phe.

[0015] The gene of the present invention is: the gene encoding the NADH oxidase mutant protein described in the claims.

[0016] The recombinant plasmid described in the present invention is: a recombinant plasmid containing the said gene.

[0017] Preferably, the expression vector of the recombinant plasmid is a PET series expression vector.

[0018] The recombinant bacterium described in the present invention is a recombinant bacterium carrying the gene of the said mutant or the said recombinant plasmid.

[0019] The construction method of the said recombinant bacterium includes the following steps:

[0020] (1) Construct the recombinant plasmid pET22b-LpNOX: ligate the NADH oxidase gene with the digested plasmid pET22b to obtain the recombinant expression vector pET22b-LpNOX;

[0021] (2) Construct the recombinant bacterium E.coli BL21(DE3) / pET22b-LpNOX: thermally transfer the constructed recombinant expression vector pET22b-LpNOX into the competent cells of Escherichia coli BL21(DE3), and culture and screen to obtain the recombinant E.coli BL21(DE3) / pET22b-LpNOX.

[0022] Preferably, the host is Escherichia coli.

[0023] The application of the NADH oxidase mutant or the said recombinant plasmid or the said recombinant bacterium described in the present invention in oxidizing reduced coenzyme NADH to oxidized coenzyme NAD + in.

[0024] The said application includes the following steps: using reduced coenzyme NADH as a substrate to efficiently catalyze the formation of oxidized coenzyme NAD + , realizing the efficient recycling of coenzymes. The catalytic process is as follows:

[0025]

[0026] Preferably, the reaction temperature of the said catalysis is 30-45 °C, and the pH is 7.5-8.5.

[0027] Invention mechanism:

[0028] In the present invention, based on the reported sequence and structural information of NADH oxidase, through non-redundant retrieval in databases such as NCBI, and according to principles such as protein structure similarity, conserved site analysis, and host source diversity, some potential enzyme genes were screened out. These genes were functionally expressed in the Escherichia coli expression system and then purified to obtain pure enzymes. The preferred NADH oxidase is derived from Lactiplantibacillus pentosus and has certain catalytic activity, capable of catalyzing the regeneration of the oxidized coenzyme NAD + .

[0029] In the present invention, by amplifying the NADH oxidase gene derived from Lactiplantibacillus pentosus and performing directed evolution modification on it using rational design, a mutant of NADH oxidase with significantly improved catalytic efficiency was finally obtained, thus realizing the efficient regeneration cycle of the oxidized coenzyme NAD + .

[0030] Beneficial effects: Compared with the prior art, the present invention has the following remarkable advantages: (1) By mutating the active site of NADH oxidase, the finally obtained mutant improves the regeneration efficiency of the reduced coenzyme NADH to the oxidized coenzyme NAD + ; (2) The catalytic efficiency of the mutant G156A / I158H / I294F is 1.6 times that of the wild-type NADH oxidase. Description of the Drawings

[0031] Figure 1 It is a comparative diagram of the relative activities of the NADH oxidase mutants in Examples 1 to 7 for catalyzing the oxidation of the reduced coenzyme NADH to the oxidized coenzyme NAD + ;

[0032] Figure 2 It is a comparative diagram of the relative activities of the NADH oxidase mutant (G156A / I158H / I294F) for catalyzing the oxidation of the reduced coenzyme NADH to the oxidized coenzyme NAD at different temperatures + ;

[0033] Figure 3 It is a comparative diagram of the relative activities of the NADH oxidase mutant (G156A / I158H / I294F) for catalyzing the oxidation of the reduced coenzyme NADH to the oxidized coenzyme NAD at different pH values + . Detailed Embodiments

[0034] The technical solutions of the present invention will be further described below in conjunction with the embodiments.

[0035] Example 1

[0036] 1. Construction of NADH oxidase mutant plasmid

[0037] (1) Obtaining pET22b-LpNOX

[0038] The wild-type gene of NADH oxidase was synthesized by Genewiz (Suzhou) Company and constructed on the pET22b vector (the pET22b vector was provided by Genewiz Company), and the vector was transformed into E. coli DH5α strain (purchased from Sangon Biotech (Shanghai) Co., Ltd.). The recombinant bacterium E. coli DH5α / pET22b-LpNOX was inoculated into a 5 mL test tube with a medium loading volume and cultured at 37 °C and 220 rpm for 12 h. After the culture was completed, the cells were centrifuged at 12,000 rpm for 1 min and the cells were collected. Using a high-purity plasmid miniprep kit, the plasmid was extracted from E. coli DH5α / pET22b-LpNOX as a template for iterative mutation to construct the mutant of plasmid pET22b-LpNOX.

[0039] (2) Construction of recombinant Escherichia coli E. coli BL21(DE3) / pET22b-LpNOX mutant

[0040] The gene mutation was carried out by the method of whole plasmid PCR to obtain the target mutant gene. Taking I294F as an example, the required primers were specifically designed, and other mutants were designed according to this principle and single-point iterative mutation was carried out.

[0041] Upstream primer of I294F: GACGCGTACTTTCCACTAGCGAC

[0042] Downstream primer of I294F: GTCGCTAGTGGAAAGTACGCGTC The system is shown in Table 1.

[0043] Table 1 PCR reaction system

[0044]

[0045] The PCR reaction conditions are shown in Table 2.

[0046] Table 2 PCR reaction conditions

[0047]

[0048] After the PCR amplification was completed, the amplification products were detected by 0.9% agarose gel electrophoresis. The results showed that the amplification products were single bands, and the sizes were about 6000 bp. The amplification products were purified and recovered using a DNA recovery and purification kit.

[0049] The purified gene fragment was digested with DpnI to remove the template and then recombined with recombinase. The recombinant product was transformed into competent E. coli DH5α cells and spread on the surface of LB solid medium containing 100 μg / mL ampicillin. After culturing at 37 °C for 12 h, single colonies were picked and cultured in LB liquid medium. Positive transformants with successful construction were identified by PCR method, and the correctness of the mutation sites was verified by sequencing. After verification, a part was added with sterile glycerol at a final concentration of 25%, numbered, and stored at -80 °C for standby. Another part of the bacteria was used to extract plasmids with a plasmid extraction kit, and the recombinant plasmids were stored in a -20 °C refrigerator.

[0050] The successfully sequenced recombinant expression plasmid pET22b was transferred into E. coli BL21(DE3) (E. coli, purchased from Sangon Biotech (Shanghai) Co., Ltd.) as the expression host to construct the recombinant mutant expression strain E. coli BL21(DE3) / pET22b-LpNOX.

[0051] 2. Cultivation of NADH oxidase mutant and preparation of crude enzyme solution

[0052] The successfully constructed recombinant mutant expression strain E. coli BL21(DE3) / pET22b-LpNOX was spread on a plate containing ampicillin at a final concentration of 100 μg / mL. Single colonies were picked and inoculated into 5 mL of resistant LB medium and cultured overnight at 37 °C with 200 rpm / min. Then, it was transferred to 500 mL of resistant LB medium with an inoculation amount of 1%, and when the OD 600 reached about 0.6, IPTG with a final concentration of 0.5 mM was added, and induction was carried out at 18 °C for about 14 h.

[0053] After centrifuging to obtain the bacterial cells, they were resuspended with buffer, and the cells were ultrasonically disrupted in an ice bath (working for 2 s, interval of 5 s, total working time of 30 min), and then centrifuged at 12,000 rpm / min at 4 °C for 20 min. After collecting the supernatant, it was filtered through a 0.22 μm aqueous filter head to obtain the crude enzyme solution for the reaction.

[0054] Example 2

[0055] Based on Example 1, in step (2) of the G156A mutant, the primers were changed and the other conditions remained unchanged. The primers are as follows:

[0056] G156A upstream primer: GTTATTGGCGGTGCCTACATTGGTACCG

[0057] G156A downstream primer: CGGTACCAATGTAGGCACCGCCAATAAC.

[0058] Example 3

[0059] Based on Example 1, in step (2) of the I158H mutant, the primers were changed while the other conditions remained unchanged. The primers are as follows:

[0060] I158H upstream primer: GCGGTGGCTACCATGGTACCGAACTGG

[0061] I158H downstream primer: CCAGTTCGGTACCATGGTAGCCACCGC.

[0062] Example 4

[0063] Based on Example 1, in step (2) of the G156A / I158H mutant, the primers were changed while the other conditions remained unchanged. The primers are as follows:

[0064] G156A / I158H upstream primer: GTTATTGGCGGTGCCTACCATGGTACCGAACTGG

[0065] G156A / I158H downstream primer: CCAGTTCGGTACCATGGTAGGCACCGCCAATAAC.

[0066] Example 5

[0067] Based on Example 1, for the G156A / I294F mutant, the plasmid obtained in Example 2 was used as the DNA template in step (2), the primers were changed while the other conditions remained unchanged. The primers are as follows:

[0068] G156A / I294F upstream primer: GACGCGTACTTTCCACTAGCGAC

[0069] G156A / I294F downstream primer: GTCGCTAGTGGAAAGTACGCGTC.

[0070] Example 6

[0071] Based on Example 1, for the I158H / I294F mutant, the plasmid obtained in Example 3 was used as the DNA template in step (2), the primers were changed while the other conditions remained unchanged. The primers are as follows:

[0072] I158H / I294F upstream primer: GACGCGTACTTTCCACTAGCGAC

[0073] I158H / I294F downstream primer: GTCGCTAGTGGAAAGTACGCGTC.

[0074] Example 7

[0075] Based on Example 1, for the G156A / I158H / I294F mutant, the plasmid obtained in Example 4 was used as the DNA template in step (2), the primers were changed, and the other conditions remained unchanged. The primers are as follows:

[0076] G156A / I158H / I294F upstream primer: GACGCGTACTTTCCACTAGCGAC

[0077] G156A / I158H / I294F downstream primer: GTCGCTAGTGGAAAGTACGCGTC.

[0078] Performance test

[0079] 1. NADH oxidase and its mutants catalyze the oxidation of reduced coenzyme NADH to oxidized coenzyme NAD +

[0080] According to Examples 1 to 7, the corresponding engineered bacteria expressing NADH oxidase and its mutants were constructed and cultured, and the obtained crude enzyme solution was used as a catalyst.

[0081] The reaction system was: crude enzyme solution with OD 600 = 20, 1 mM reduced coenzyme NADH, and the reaction buffer solution was 200 mM potassium phosphate buffer (pH = 7.5). The absorbance change at 340 nm within 5 min was measured in a 1 mL quartz cuvette to compare the relative activities.

[0082] The test results are shown in Table 3 and Figure 1 .

[0083] Table 3 NADH oxidase reduces to generate reduced coenzyme NADH

[0084]

[0085]

[0086] It can be seen from Figure 1 that the catalytic conversion rates of all mutants are higher than that of wild-type NADH oxidase. In particular, the catalytic efficiency of mutant G156A / I158H / I294F is 1.6 times that of wild-type NADH oxidase.

[0087] 2. Optimum temperature for the oxidation of reduced coenzyme NADH to oxidized coenzyme NAD by NADH oxidase mutant (G156A / I158H / I294F) + of

[0088] According to the construction in Example 7, the corresponding engineered bacteria expressing NADH oxidase and its mutants were cultured, and the obtained crude enzyme solution was used as a catalyst.

[0089] The reaction system is: crude enzyme solution with OD 600 = 20, 1 mM reduced coenzyme NADH, and the reaction buffer solution is 200 mM potassium phosphate buffer (pH = 7.5). The reaction temperature is controlled at 20 °C, 25 °C, 30 °C, 35 °C, 40 °C, 45 °C, 50 °C through a water bath. The reaction lasts for 5 min, and the change in the absorbance value of the reaction system within 5 min at a wavelength of 340 nm is recorded in a 1 mL quartz cuvette to compare the relative activities. The test results are shown in Figure 2 .

[0090] From Figure 2 it can be obtained that at 35 °C, the best catalytic effect is observed, and the enzyme activity is relatively good in the range of 30 - 45 °C.

[0091] 3. The NADH oxidase mutant (G156A / I158H / I294F) catalyzes the oxidation of the reduced coenzyme NADH to the oxidized coenzyme NAD + The optimal pH

[0092] The corresponding engineered bacteria expressing NADH oxidase and its mutant constructed and cultured according to Example 7 and the obtained crude enzyme solution are used as catalysts.

[0093] The reaction system is: crude enzyme solution with OD 600 = 20, 1 mM reduced coenzyme NADH. 50 mM sodium phosphate buffer with pH = 6.5, 50 mM potassium hydrogen phosphate - dipotassium hydrogen phosphate buffer with pH = 7.5, 50 mM potassium hydrogen phosphate - potassium dihydrogen phosphate buffer with pH = 8, 50 mM potassium hydrogen phosphate - potassium dihydrogen phosphate buffer with pH = 8.5, 50 mM Tris - HCl buffer with pH = 9, 50 mM Gly - NaOH buffer with pH = 10.28. The change in the absorbance value of the reaction system within 5 min at a wavelength of 340 nm is recorded in a 1 mL quartz cuvette to compare the relative activities. The test results are shown in Figure 3 .

[0094] From Figure 3 it can be obtained that different pH values have a significant impact on the catalytic effect of NADH oxidase. At pH = 8.0, the best catalytic effect is observed. In addition, the enzyme catalytic activity is relatively high in the range of pH 7.5 - 8.5.

[0095] 4. The kinetic parameters of the NADH oxidase and its mutant (G156A / I158H / I294F) catalyzing the oxidation of the reduced coenzyme NADH to the oxidized coenzyme NAD +

[0096] The kinetic parameters of NADH oxidase and its mutants were determined using hydrogen peroxide at different concentrations as the substrate. The experiment was carried out at pH = 7.5 and an enzyme concentration of 0.005 mM for 5 minutes. The first-order reaction rate was plotted on the vertical axis and the substrate concentration on the horizontal axis, and the values of V max and K m were obtained by non-linear fitting. Subsequently, K cat was calculated, and the obtained

[0097] results are shown in Table 4 below:

[0098] Table 4 Kinetic parameters of wild-type NADH oxidase and its mutants

[0099]

[0100] As can be seen from Table 4, the Michaelis kinetic parameters of the NADH oxidase mutant (G156A / I158H / I294F) were Km = 0.357 mM and Kcat = 1422 min -1 . Compared with wild-type NADH oxidase, its ability to oxidize the reduced coenzyme NADH was significantly improved.

Claims

1. A mutant of reduced coenzyme NADH oxidase, characterized in that, The mutant is obtained by substituting at least one amino acid at positions 156, 158, and 294 in the amino acid sequence shown in SEQ ID No. 1; glycine (Gly) at position 156 is mutated to alanine (Ala), isoleucine (Ile) at position 158 is mutated to histidine (His), and isoleucine (Ile) at position 294 is mutated to phenylalanine (Phe).

2. The NADH oxidase mutant according to claim 1, wherein The mutants are selected from G156A, I158H, I294F, G156A / I158H, G156A / I294F, I158H / I294F, or G156A / I158H / I294F.

3. A gene encoding the NADH oxidase mutant protein according to any one of claims 1 to 2.

4. A recombinant plasmid containing the gene according to claim 3.

5. The recombinant plasmid according to claim 4, wherein The expression vector of the recombinant plasmid is a PET series expression vector.

6. A recombinant bacterium carrying the gene according to claim 3 or the recombinant plasmid according to claim 4.

7. The recombinant bacterium according to claim 6, wherein The host of the gene or the recombinant plasmid is Escherichia coli.

8. Use of the NADH oxidase mutant according to claim 1 or 2, the recombinant plasmid according to claim 4, or the recombinant bacterium according to claim 6 for oxidizing reduced coenzyme NADH to oxidized coenzyme NAD + in it.

9. The application according to claim 8, wherein The application includes the following steps: using reduced coenzyme NADH as a substrate to efficiently catalyze the generation of oxidized coenzyme NAD + , to achieve efficient recycling of coenzymes.

10. The application according to claim 9, wherein The reaction temperature catalyzed is 30 to 45 °C, and the pH is 7.5 to 8.5.

Images