Srp54k target gene for preventing and treating tetranychus crataegus and tetranychus urticae and dsRNA fragment application of Srp54k target gene

Abstract

The invention discloses an Srp54k target gene for preventing and treating tetranychus crataegus and tetranychus urticae and application of the Srp54k target gene, dsRNA synthesized by the Srp54k target gene and application of the dsRNA. The nucleotide sequences of the Srp54k target gene are shown as SEQ ID NO.1 and SEQ ID NO.2, and the nucleotide sequences of the dsRNA are shown as SEQ ID NO.3 and SEQ ID NO.4; after SRP54K is interfered, eggs of tetranychus crataegi and tetranychus urticae are caused, the survival rate is obviously influenced, and the prevention and treatment aim is achieved; the method is convenient to operate, good in effectiveness and sensitivity and high in insecticidal efficiency, has the advantages of being environmentally friendly and the like, and has a good application prospect.

Description

Technical Field

[0001] The present invention belongs to the field of agricultural biotechnology, and relates to the prevention and control of agricultural pest mites based on RNAi technology, and specifically to a target gene for preventing and controlling hawthorn spider mites and two-spotted spider mites. Srp54k and its applications. Background Art

[0002] Hawthorn spider mite and two-spotted spider mite belong to the genus Tetranychus of the family Tetranychidae. They are a kind of pest mite worldwide, mainly harming fruit trees, greenhouse vegetables and other crops and cash crops. The two kinds of pest mites are small in size, have strong reproductive capacity and spread quickly. Long-term use of chemical pesticides for prevention and control has led to their strong resistance.

[0003] RNA interference (RNAi), also known as RNA silencing, is a biological phenomenon in eukaryotic organisms that is induced by double-stranded RNA (dsRNA) or siRNA (small interfering RNA) or miRNA (microRNA), which efficiently and specifically degrades or inhibits the expression of homologous mRNA, thereby preventing the translation of target gene protein. RNAi can be used to interfere with the normal growth of target pests, reduce damage to host plants, and ultimately achieve the purpose of controlling pests and protecting plants.

[0004] RNAi technology has great potential in agricultural pest control. RNAi technology has great potential for controlling spider mites, but there are few studies on the gene functions of hawthorn spider mites and two-spotted spider mites and reports on their target genes for insecticidal activity at home and abroad.

[0005] Preliminary tests have shown that the toxicity to hawthorn spider mites and two-spotted spider mites can be achieved by soaking eggs with a suitable exogenous dsRNA solution. Therefore, it is easy to use and low-cost to develop exogenous dsRNA products suitable for the prevention and control of hawthorn spider mites and two-spotted spider mites from a genetic level. Moreover, due to the specificity of the gene, it can achieve precise and excellent control effects, is environmentally friendly, and has great application prospects in the prevention and control of hawthorn spider mites and two-spotted spider mites. However, the screening of related target genes and the design of dsRNA with good control effects, specificity, and stability are the biggest challenges and key issues. Summary of the invention

[0006] The present invention overcomes the defects and shortcomings of the existing hawthorn spider mite and two-spotted spider mite control technology, and provides a method for controlling hawthorn spider mites and two-spotted spider mites. Srp54K Target gene and its application, dsRNA synthesized therefrom and application of dsRNA.

[0007] In order to achieve the above object, the present invention is achieved through the following technical solutions: A method for preventing and controlling hawthorn spider mites and two-spotted spider mites Srp54k The target gene is interfered with, resulting in abnormal growth and development and death of the mite, and a significant decrease in the amount of eggs laid by adult mites. Srp54k The nucleotide sequences of the target genes are shown in SEQ ID NO.1 and SEQ ID NO:2.

[0008] A method for preventing and controlling hawthorn spider mites and two-spotted spider mites Srp54k The target gene is interfered with, resulting in abnormal growth and development and death of the mite, and a significant decrease in the amount of eggs laid by adult mites. Srp54K The target gene is used as a template to synthesize dsRNA, and the nucleotide sequence of the dsRNA is shown in SEQ ID NO: 3 and SEQ ID NO: 4.

[0009] The preparation of the dsRNA comprises the following steps: S1, using the cDNA sequences of two spider mites as templates, synthesized Srp54K Gene fragments; S2, Srp54K The gene fragment was used as a template to design a primer sequence pair containing the T7 promoter sequence; S3, obtaining a dsRNA synthesis template by PCR amplification; S4. Synthesize dsRNA in vitro.

[0010] The S1 is specifically: Srp54k The primer pairs were designed based on the DNA sequence of the gene, and the cDNA sequences of the two spider mites were used as templates for PCR amplification to obtain SRP54K Gene fragment.

[0011] A kind of Srp54k The application of the target gene or the dsRNA includes any of the following: 1) Srp54k Use of the target gene or the dsRNA in controlling hawthorn spider mites and two-spotted spider mites; 2) Srp54k Use of the target gene or the dsRNA in preventing hawthorn spider mites and two-spotted spider mites and / or preparing products for preventing and controlling hawthorn spider mites and two-spotted spider mites; 3) Srp54k The target gene or the dsRNA is used to promote the death of hawthorn spider mites and two-spotted spider mites and / or to prepare products that promote the death of hawthorn spider mites and two-spotted spider mites. The experimental results show that after soaking in dsSrp54k solution, it can cause a strong RNAi effect in hawthorn spider mites and two-spotted spider mites, resulting in Srp54kThe expression level of the gene is significantly reduced, which leads to the death or inhibition of reproduction of hawthorn spider mites and two-spotted spider mites, thereby achieving the purpose of preventing and controlling hawthorn spider mites and two-spotted spider mites.

[0012] The present invention mainly solves the problems of environmental pollution, enhanced pest resistance and impact on non-target organisms in the process of traditional chemical pesticides in the control of hawthorn spider mites and two-spotted spider mites. By using gene silencing technology, especially targeting the Srp54k The present invention provides a more environmentally friendly, efficient and specific pest control method, focusing on the effect of dsRNA (double-stranded RNA) in the prevention and control of two-spotted spider mites. The phenotypic response and survival and reproductive ability of the pests after silencing the gene by dsRNA targeting are changed. The main difficulty lies in the effect of dsRNA fragments on the two-spotted spider mites. Srp54k Highly efficient and specific targeted gene silencing.

[0013] The invention discloses a method for preventing and controlling hawthorn spider mites and two-spotted spider mites Srp54k The beneficial effects of the target gene and its application compared with the prior art are: The present invention utilizes Srp54k Genetic control of hawthorn spider mites and two-spotted spider mites, through Srp54k Gene synthesis of dsRNA for the control of hawthorn spider mite and two-spotted spider mite, which can target and silence the above Srp54k Gene. Soaking eggs in dsRNA solution dsSrp54k Entering the bodies of hawthorn spider mites and two-spotted spider mites, the dsRNA can silence / inhibit the proliferation of hawthorn spider mites and two-spotted spider mites. Srp54k Gene expression promotes the death of hawthorn spider mites and two-spotted spider mites, thereby achieving the purpose of preventing and controlling hawthorn spider mites and two-spotted spider mites.

[0014] The present invention screened out a lethal gene for hawthorn spider mite and two-spotted spider mite ( Srp54k ), and developed its highly effective silencing dsRNA, which can achieve efficient control of hawthorn spider mites and two-spotted spider mites, and use the lethal effect of dsRNA on hawthorn spider mites and two-spotted spider mites to achieve the purpose of control. This method is easy to operate, has good effectiveness and sensitivity, high insecticidal efficiency, and is environmentally friendly, and has many advantages, and has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 The effect of immersing eggs in dsSrp54k solution on the phenotypes of hawthorn spider mite and two-spotted spider mite in Example 2; H2O is a blank control, dsGUS is a negative control, dsAvSrp54k is a hawthorn spider mite treatment group, and dsTuSrp54k is a two-spotted spider mite treatment group; Figure 2The effect of soaking eggs in dsSrp54k solution on the mortality of hawthorn spider mite and two-spotted spider mite in Example 2, and lowercase letters represent significant differences; Figure 3 After the eggs were soaked in dsSrp54k and dsGUS solutions in Example 2, the Srp54k The changes in gene expression levels, lowercase letters represent significant differences. DETAILED DESCRIPTION

[0016] In order to make the technical problems, technical solutions and beneficial effects to be solved by the present invention clearer, the present invention is further described in detail in conjunction with the embodiments and the accompanying drawings. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention. The technical solutions of the present invention are described in detail below in conjunction with the embodiments and the accompanying drawings, but the scope of protection is not limited thereto.

[0017] Unless otherwise specified, the reagents, methods and equipment used in the following examples are conventional reagents, methods and equipment in the art. Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0018] The hawthorn spider mites and two-spotted spider mites used in the following examples were raised by the College of Plant Protection of Shanxi Agricultural University. The hawthorn spider mites and two-spotted spider mites were inoculated on peach seedlings and placed in an artificial climate box (temperature 25±1°C, humidity 50%-60%, photoperiod L:D=16:8) for reproduction (can be provided free of charge for external scientific experiments).

[0019] RNA was extracted using the TRIzol extraction method (Invitrogen, USA). The reverse transcription reagent (PrimeScriptTM RTreagent Kit with gDNA Eraser) was purchased from TAKARA Biotechnology Co., Ltd., the dsRNA synthesis kit (T7RiboMAX™ Express RNAi System) was purchased from Promega, USA, the kit used for the PCR reaction system (GoTaq® Green Master Mix) was purchased from Promega, USA, and the DNA purification and recovery kit (Universal DNA Purification Kit) was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.

[0020] The data processing method of the following examples: The results of the bioassay of hawthorn spider mites and two-spotted spider mites were analyzed by the egg immersion method, and the mortality of hawthorn spider mites and two-spotted spider mites was counted on the 12th day (the second day of adult mites) starting from the egg day 0, and the data were subjected to T test using SPSS 19.0 software. The expression of the target gene was analyzed on the 8th day (molting from the anterior nymph to the posterior nymph), and the qPCR data were calculated using the 2-△△Ct method (Ct represents the number of cycles), and the data were subjected to T test using SPSS 19.0 software. Example

[0021] Genes related to growth and development of hawthorn spider mite and two-spotted spider mite Srp54K acquisition and utilization Srp54K Gene synthesized dsRNA (dsSrp54k) Based on the transcriptome library of hawthorn spider mite and two-spotted spider mite, we screened Srp54K Gene fragments, as shown in SEQ ID NO.1 and SEQ ID NO.2; SEQ ID NO.1 SEQ ID NO.2 1. Extraction of total RNA from hawthorn spider mite and two-spotted spider mite and synthesis of the first-strand cDNA.

[0022] 100 adult mites of spider mites and two-spotted spider mites were placed in a 1 mL centrifuge tube, and the total RNA of spider mites and two-spotted spider mites was extracted using the TRIzol method. The concentration and quality of RNA were determined using NanoDrop OneC, and reverse transcription was performed using a reverse transcription kit (PrimeScript™ RT reagent Kit with gDNA Eraser, TAKARA) according to the instructions to synthesize the first chain of cDNA.

[0023] 2. Primer design The transcriptome data of hawthorn spider mite and two-spotted spider mite obtained by our research group were used to screen the hawthorn spider mite and two-spotted spider mite. Srp54k The primers were designed using the NCBI primer design software Primer-BLAST (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ). Srp54k Gene dsRNA primers P1-2 (Table 1), β-glucuronidase gene ( GUS ) from laboratory-preserved GUS The dsRNA primer P3 of GUS gene (Table 1) was amplified on the plasmid of Srp54k , internal reference gene AvGAPD H and TuCycA qPCR primers P4-7 (Table 1).

[0024] Table 1

[0025] 3. Kit synthesis Srp54K dsRNAs of β-actin and GUS PCR amplification was performed using primers P1 and P2 in Table 1. The reaction system for PCR amplification was RNase Free water 9.5 μL, Go Taq® Green Master Mix 12.5 μL, 10 μM forward primer 1 μL, 10 μM reverse primer 1 μL, and cDNA / GUS plasmid 1 μL. The reaction program for PCR amplification was 94°C pre-denaturation for 3 min; 94°C denaturation for 30 s, 55°C annealing for 30 s, 72°C extension for 1 min, for a total of 30 cycles; 72°C extension for 5 min. The amplified product was stored at 4°C. After the program reaction was completed, the amplification results were detected by agarose gel electrophoresis.

[0026] The two PCR products obtained above were purified using a DNA purification recovery kit (Universal DNA Purification Kit, TIANGEN) and used as templates for in vitro transcription of dsRNA. The in vitro transcription system of dsRNA was TemplateDNA 1000 ng, Enzyme Mix, T7 Express 2 μL, RiboMAX™ Express T7 2× Buffer 10 μL, and Nuclease free water was added to make up to 20 μL. After flicking and spinning, the following reaction was carried out in a water bath: incubation at 37 °C for 4 hours, 70 °C for 10 min, and 25 °C for 20 min. After the reaction, 1 μL DNAase and 1 μL RNAase were added, and after incubation at 37°C for 30 min, 2.2 μL sodium acetate solution and 24.2 μL isopropanol were added, and the mixture was placed at -20 °C overnight to fully precipitate the dsRNA. The next day, the supernatant was removed after centrifugation at 14,000 g for 10 min, and the precipitate was washed twice with 75% ethanol and centrifuged to obtain dsRNA. The alcohol in the tube was removed by blowing in the clean bench and dissolved in Nuclease free water. The integrity was detected by 1.5% agarose gel electrophoresis, and the quantification was performed using NanoDrop 2000. The final concentration was diluted to 250 ng / μL, and dsSRP54K and dsGUS were obtained respectively. The dsRNA bands were verified by 1.5% agarose gel electrophoresis, and the mixture was stored in a -80°C refrigerator.

[0027] SEQ ID NO: 3 GTTTGTTGGTCTACAAGGGGCTGGTAAGACAACAACAGTAACAAAAATGGCATATTATTATCAGAGAAAGGGCTGGAAATGTTGTTTGGTTTGTGCTGATACTTTTCGTGCTGGAGCATTTGATCAATTGAAACAAAATGCCACAAAAGCTAGGATACCCTTTTATGGTTCATACACAGAAGCTGACCCAGTTGTGGTGGCCGCTGAAGGAGTAAACAAATTTGTGAAAGAAGGTTTCGAAATAATCATCGTGGATACTAGTGGTCGACATAAGCAAGAGAGTGCCTTATTTGAAGAAATGTTGTCAATTAGTAATGCCACTCAGCCTAATTTGGTTATTTTTGTAATGGATGCATCCATTGGACATGCATGTGAAGCTCAAGCTCGTGCTTTCAAGGATAAAGTAGACGTTGGAGCAGTTATTGTAACTAAATTAGATGGTCATGCTAAAGGTGGTGG and SEQ ID NO: 4 GTTTGTCGGTCTTCAAGGTGCTGGTAAAACAACTACATGTACTAAAATGGCCTATTATTATCAGAGAAAAGGTTGGAAATGTTGTCTTGTGTGTGCAGATACTTTTCGAGCTGGTGCTTTCGATCAATTGAAACAAAATGCTACAAAAGCAAGAATACCATTCTATGGATCATATACAGAAGCAGATCCAGTTGTTGTAGCTGCAGAAGGAGTAGACAAATTTATAAAGGAAGGCTTCGAAATAATTATTGTTGATACAAGTGGAAGGCATAAACAAGAAAGTGCCTTATTCGAGGAAATGTTATCAATTAGTAATGCAGTTCAACCTAATTTGGTTATTTTTGTTATGGATGCTTCTATTGGTCATGCTTGTGAAGCTCAAGCTCGTGCTTTTAAAAGTAAAGTAGACGTTGGAGCTGTAATTGTTACAAAATTAGATGGACACGCTAAAGGTGGTGG Example 2 The lethal effect of dsRNA (dsSrp54k) on Tetranychus villosa and Tetranychus urticae 1. Test methods Peach leaves were cut into leaf discs with a diameter of 17 mm using a hole puncher and washed 5 times with nuclease-free water. 30-50 female adult mites were moved to the leaf discs. After the female adult mites laid 30-50 eggs, they were removed and 20 μL dsRNA (250 ng / μL) Tween solution (dsRNA was evenly mixed in the Tween solution to make the final concentration of the Tween solution 0.005%) was evenly applied to all spider mite eggs using a pipette to completely immerse the spider mite eggs in the dsRNA Tween solution. After the spider mite eggs hatched, they continued to be raised on the peach leaf disc, and GUS was used as a negative control. The leaf discs were placed on 0.25% agar gel to keep them moist and prevent the hawthorn spider mite and two-spotted spider mite from escaping. The spider mites on the 4th day after hatching (at this time, they were in the molting stage from the front nymph to the back nymph) were collected for detecting the expression of the target gene. Spider mites on the 8th day after hatching (at this time, they were on the second day of adulthood) were used to count the biological changes of spider mites. Three replicates were set up for each group. After dsRNA treatment, they were placed in an artificial climate box (temperature 25±1℃, humidity 50%-60%, photoperiod L:D=16:8). The number of deaths of hawthorn spider mites and two-spotted spider mites in each replicate of each group was counted, and the mortality rates of hawthorn spider mites and two-spotted spider mites under dsRNA and control group treatments were calculated. On the second day of female adulthood, 10 female adult mites were randomly selected from each replicate of each treatment group and raised individually on a 17mm leaf tray to lay eggs. The final number of eggs was recorded, and the average egg laying amount per female adult mite was counted.

[0028] 2. Test results According to the statistical results, after the hawthorn spider mite and the two-spotted spider mite were treated with dsSrp54k, they showed a melanization phenotype compared with the control group ( Figure 1 ), the mortality rates of hawthorn spider mite and two-spotted spider mite increased significantly, reaching 85.70% and 67.87%, respectively ( Figure 2 The reproductive capacity was significantly reduced. The average number of eggs laid by each female two-spotted spider mite in the dsSrp54k treatment group was 23.4, and the average number of eggs laid by each female hawthorn spider mite was 0. The dsGUS control group was 39.30, indicating that dsSrp54k can induce a strong RNAi effect in the bodies of hawthorn spider mites and two-spotted spider mites, leading to the death of hawthorn spider mites and two-spotted spider mites and the decline of reproductive capacity.

[0029] Example 3 dsRNA (dsSrp54k) inhibits the growth of hawthorn spider mites and two-spotted spider mites Srp54K Gene expression 1. Experimental methods 200 spider mites on the 4th day after hatching (at this time, they were in the molting stage from prenymph to postnymph) were collected to detect the expression of target genes, and 3 biological replicates were collected for each treatment. RNA of hawthorn spider mites and two-spotted spider mites was extracted and collected, and then 1 μg of total RNA was reverse transcribed into cDNA and diluted 10 times as a template for qPCR. Relative quantitative qPCR analysis was performed using P3 and P4 as primers. The qPCR system contained RNase Free water 7.76 μL, 2×SYBR Green 10 μL (SYBR® Green Realtime PCR Master Mix), 10 μM forward primer 0.32 μL, 10 μM reverse primer 0.32 μL, and cDNA template 1.6 μL. The qPCR reaction instrument was Bio-Rad C1000 Real-Time PCR system (BIO-RAD, USA). The reaction conditions were 95°C for 30 s; 40 cycles of 95°C for 5 s, 60°C for 30 s, and three technical replicates were analyzed for each biological replicate.

[0030] 2. Experimental results After the eggs were treated with dsSrp54k solution, the relative expression levels of Srp54k gene in hawthorn spider mite and two-spotted spider mite decreased by 56.06% and 70.70%, respectively ( Figure 3 ), indicating that dsSrp54k solution immersion treatment can cause a strong RNAi effect in hawthorn spider mites and two-spotted spider mites, resulting in a significant decrease in the expression of Srp54k gene in the body, and then leading to the death of hawthorn spider mites and two-spotted spider mites or inhibiting reproduction.

[0031] The above example is based on the transcriptome library of hawthorn spider mite and two-spotted spider mite, and screened out a gene with high lethality and reproduction-affecting gene - Srp54k genes, and developed the use of Srp54k The technology of controlling hawthorn spider mites and two-spotted spider mites by soaking eggs with dsRNA of the gene (dsSrp54k). In this example, the eggs of hawthorn spider mites and two-spotted spider mites were soaked in 20 μL of dsSrp54k and dsGUS solution synthesized by the kit until the solution was absorbed and dried, and the eggs were left on peach leaves until they hatched, and the mortality of hawthorn spider mites and two-spotted spider mites was observed and recorded. Finally, the fluorescence quantitative PCR (qPCR) method was used to detect and analyze Srp54k The expression level of the gene in hawthorn spider mite and two-spotted spider mite after dsSrp54k and dsGUS treatment changed. The results showed that the eggs soaked in exogenous dsSrp54k solution had a very obvious lethal effect on hawthorn spider mite and two-spotted spider mite.

[0032] The above content is a further detailed description of the present invention in combination with a specific preferred embodiment. It cannot be determined that the specific embodiments of the present invention are limited to this. For ordinary technicians in the technical field to which the present invention belongs, several simple deductions or substitutions can be made without departing from the present invention, which should be regarded as belonging to the present invention and the scope of patent protection determined by the submitted claims.

Claims

1. A method for preventing and controlling hawthorn spider mites and two-spotted spider mites Srp54k Target gene, the Srp54k The nucleotide sequences of the target genes are shown in SEQ ID NO.1 and SEQ ID NO:

2.

2. A dsRNA for controlling hawthorn spider mite and two-spotted spider mite, using the SRP54K The target gene synthesizes dsRNA, wherein the nucleotide sequence of the dsRNA is shown in SEQ ID NO: 3 and SEQ ID NO: 4; The preparation of the dsRNA comprises the following steps: S1. Using the cDNA sequences of the two spider mites as templates, primer pairs were designed for PCR amplification and synthesis Srp54K Gene fragments; S2, Srp54K The gene fragment was used as a template to design a primer sequence pair containing the T7 promoter sequence; S3, obtaining a dsRNA synthesis template by PCR amplification; S4. Synthesize dsRNA in vitro.

3. The method according to claim 1 or 2 Srp54k Application of target gene or dsRNA, including any of the following: 1) Srp54k Use of the target gene or the dsRNA in controlling hawthorn spider mites and two-spotted spider mites; 2) Srp54k Use of the target gene or the dsRNA in preventing hawthorn spider mites and two-spotted spider mites and / or preparing products for preventing and controlling hawthorn spider mites and two-spotted spider mites; 3) Srp54k Application of the target gene or the dsRNA in promoting the death of hawthorn spider mites and two-spotted spider mites and / or in preparing products that promote the death of hawthorn spider mites and two-spotted spider mites.

4. A method for controlling hawthorn spider mites and two-spotted spider mites, characterized in that: The method is to introduce the dsRNA of claim 2 into the bodies of the hawthorn spider mite and the two-spotted spider mite.

Images