A genetically engineered strain capable of solid-state fermentation and high yield of echinocandin B, and its construction method and application

Abstract

The invention discloses a genetic engineering strain capable of solid-state fermentation and high yield of echinocandin B, and a construction method and application thereof, belonging to the technical field of genetic engineering bacteria. The engineering strain uses Aspergillus thunbergii as the base strain and uses a strong promoter. gpdA As ecdJ The promoter of ecdJ The invention provides a highly expressed engineered strain, thereby increasing the fermentation yield of echinocandin B; the constructed engineered strain is further fermented by solid fermentation, which saves costs and further increases the yield of echinocandin B. The invention strengthens the echinocandin B synthesis pathway by constructing an engineered strain, and combines the solid fermentation method to significantly increase the echinocandin B yield in Aspergillus thunbergii and realize solid fermentation, which has potential industrial application value.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering bacteria, and specifically relates to a method for constructing a genetic engineering strain with high yield of echinocandin B and application thereof. Background Art

[0002] Echinocandin B (ECB) is a natural secondary metabolite produced by Aspergillus strains and is a semi-synthetic precursor of the widely used antifungal drug anidulafungin. However, at present, Echinocandin B can only be produced by microbial secondary metabolism and cannot be obtained by chemical synthesis, which leads to a long production cycle, complex process and low yield. Therefore, increasing the yield of Echinocandin B or reducing its production cost has become an urgent problem to be solved.

[0003] Aspergillus pachycrida Aspergillus pachycristatus NRRL 11440 is a strain currently used for industrial production of echinocandin B. At present, strategies for increasing the fermentation yield of echinocandin B include non-directed mutagenesis to obtain high-yield strains or optimization of fermentation conditions. Although mutagenesis breeding can obtain high-yield strains, the randomness and uncertainty of the process lead to huge screening workload and low efficiency. Therefore, genetic editing of production strains and construction of engineered strains through gene-directed modification have become a better synthetic biology technology. In addition, optimization of fermentation conditions is also a widely used strategy to increase the yield of echinocandin B. When echinocandin B is produced by liquid fermentation, there are problems such as high viscosity of the fermentation broth, insufficient oxygen supply and high cost, making it difficult to make breakthrough progress. In contrast, solid fermentation is a simpler and more efficient fermentation method. Since there is almost no free water in the fermentation matrix, the risk of contamination is reduced, and the natural growth state of microorganisms can be better maintained, which is conducive to the accumulation of fermentation metabolites. Compared with liquid fermentation, solid fermentation has less pollution, no wastewater treatment is required, and the production cost is relatively low. However, since the synthetic gene cluster of Echinocandin B has not been fully resolved, there are few reports on the construction of high-yield strains by high-expression of targeted genes in Aspergillus pachycruralis. At the same time, solid fermentation has not been reported to be used in the accumulation of Echinocandin metabolites. Therefore, it is of great scientific value and potential application to construct a production scheme of Echinocandin B by high-expression of target genes and combining solid fermentation to obtain high-yield strains. Summary of the invention

[0004] Purpose of the invention: In view of the problems existing in the prior art, the present invention provides a genetically engineered strain capable of solid-state fermentation and high yield of echinocandin B. ecdJ The high expression of echinocandin B was used to improve the fermentation yield of echinocandin B. The molecular biology method was used to use a constitutive strong promoter gpdA As ecdJ The promoter of ecdJHigh expression engineered strain; then the engineered strain is used for solid fermentation, so that the production of echinocandin B is further increased while saving costs. The engineered strain constructed by the present invention strengthens the synthesis pathway of echinocandin B, significantly increases the production of echinocandin B of strains with echinocandin gene clusters, and further increases the synthesis of echinocandin B by combining solid fermentation, and has potential industrial application value.

[0005] The invention also provides a construction method of the genetic engineering strain and application thereof in solid fermentation.

[0006] Technical solution: In order to achieve the above-mentioned purpose, the present invention provides a genetically engineered strain capable of solid-state fermentation and high production of echinocandin B. The genetically engineered strain uses a strain with an echinocandin gene cluster as a base strain, and highly expresses ecdJ Income, ecdJ The gene sequence is shown in SEQ ID NO.1.

[0007] Among them, the ecdJ The sequence of the gene is JX421684.1 (70014-72170). ecdJ Genes using strong promoters gpdA As a promoter. ecdJ The sequence of the gene is the 70014-72170 gene of the gene cluster with accession number JX421684.1 in NCBI.

[0008] Among them, the strain having the gene cluster for producing echinocandins preferably includes Aspergillus crassifolius.

[0009] Preferably, the Aspergillus thunbergii is Aspergillus pachycristatus NRRL 11440 ( A. pachycristatus NRRL 11440).

[0010] The method for constructing a genetically engineered strain capable of solid-state fermentation and high yield of echinocandin B of the present invention comprises the following steps:

[0011] (1) ecdJ The primers were designed from the gene sequence and the genomic DNA of the bottom plate bacteria was used as a template for PCR amplification. ecdJ gene sequence; subsequently gpdA Promoter and TrpC Linearization of the plasmid vector with the terminator;

[0012] (2) ecdJ The gene sequence was recombined with the linearized plasmid vector to obtain ecdJAfter the high expression plasmid is completed, the plasmid is introduced into the protoplasts of the chassis bacteria to obtain the strain JKL01, which is a genetically engineered strain with high production of echinocandin B that can be solid-state fermented.

[0013] Wherein, the primer sequence described in step (1) includes the one shown in SEQ ID NO.2 ecdJ -EcoRV-F and SEQ ID NO.3 ecdJ -EcoRV-R:

[0014] ecdJ -EcoRV-F:CTGCAGGAATTCGATTCATGCACTTCGCAGAGAGC;

[0015] ecdJ -EcoRV-R:ATCGATAAGCTTGATTCAAGCGTTAGAGTTCAGAT.

[0016] Wherein, the vector described in step (2) is pBARGPE1-Hygro plasmid.

[0017] Furthermore, the linearization of the pBARGPE1-Hygro plasmid in step (1) includes the following steps:

[0018] (1) Using EcoRV restriction enzyme, add reaction solution according to the following instructions;

[0019] (2) After preparation, mix gently and keep warm at 37°C for 3.5 h;

[0020] (3) The reaction solution is subjected to gel electrophoresis and the gel is cut and recovered. The recovered linearized plasmid can be used for subsequent recombination experiments.

[0021] The vector in step (2) is pBARGPE1-Hygro plasmid. The recombination experiment in step (2) uses ClonExpress II One Step Cloning Kit from Novagen and is performed according to the steps.

[0022] The invention discloses an application of the genetically engineered strain capable of solid-state fermentation and high-yield echinocandin B in solid-state fermentation and high-yield echinocandin B production.

[0023] Wherein, the solid-state fermentation comprises the following steps:

[0024] (1) Soak the rice overnight, drain and sterilize;

[0025] (2) After culturing the genetically engineered strain, pour it into sterilized rice and let it incubate.

[0026] Preferably, the solid-state fermentation comprises the following steps:

[0027] (1) Soak the rice overnight, drain and sterilize; the fermentation medium is also sterilized using a conical flask;

[0028] (2) Shake the spores of the engineered strain in the seed culture medium for 48 h, then mix with the fermentation medium, pour into sterilized rice, and culture at 25°C;

[0029] (3) After 4.5 days of fermentation, echinocandin B was extracted with methanol and quantified by HPLC.

[0030] The genetically engineered strain with high yield of echinocandin B combined with the solid fermentation method of the present invention is applicable to all species containing the echinocandin B biosynthetic gene cluster and capable of synthesizing echinocandin B.

[0031] The present invention ecdJ The use of the gene in promoting the production of echinocandin B in a strain having an echinocandin gene cluster, wherein the ecdJ The gene sequence is shown in SEQ ID NO.1.

[0032] Further, ecdJ Application of gene overexpression in promoting the production of echinocandin B in Aspergillus thunbergii, the ecdJ The gene sequence is shown in SEQ ID NO.1.

[0033] The present invention proposes for the first time a strain Aspergillus thunbergii that highly expresses an echinocandin gene cluster. Aspergillus pachycristatus ) can increase the production of echinocandin B (ECB), and further increase the ECB fermentation yield by combining with solid fermentation. The present invention uses Aspergillus thunbergii as the base strain, firstly identifies the ecdJ The importance of echinocandin B in the biosynthesis of Aspergillus pachycruralis was found ecdJ HPLC analysis showed that ECB was no longer produced, and the replenishment experiment showed that ECB production was restored. ecdJ Transcriptome analysis of knockout and wild-type strains revealed ecdJ After knockout, almost all genes in the ECB biosynthesis gene cluster were silenced, proving that ecdJ It is a transcriptional activator of ECB biosynthesis. Further experiments have found and proved that high expression ecdJThe gene expression level of the ECB synthesis gene cluster can be significantly increased, thereby increasing the ECB yield. Secondly, the present invention also uses solid fermentation for the first time in the fermentation production of echinocandin B, further increasing the ECB yield in ECB high-yield strains, while also reducing the fermentation cost. In summary, the present invention discovered that EcdJ is a transcriptional activator in the ECB biosynthesis process, and by high expression in Aspergillus thunbergii, ecdJ The gene can significantly increase the yield of echinocandin B (ECB). The present invention also finds that solid fermentation is more conducive to the fermentation production of ECB. The present invention also provides a reference for the molecular mechanism and fermentation process of increasing the production of ECB.

[0034] Specifically, the present invention first proves that ecdJ The biological functions of echinocandin B in the biosynthesis process include:

[0035] 1. Knockout of the genome of the chassis strain ecdJ Gene, get ecdJ Knockout strain JKL02.

[0036] 2. Introduction of chassis strain into knockout strain JKL02 ecdJ Gene, get ecdJ Complement strain JKL03.

[0037] 3. The fermentation extracts obtained from liquid fermentation culture of strains JKL02, JKL03 and chassis strains were analyzed by HPLC. It was found that ECB was not produced in strain JKL02, but ECB was produced in JKL03.

[0038] 4. Comparative analysis of gene expression in JKL02 and wild-type strains using transcriptome sequencing to explore ecdJ Biological function in the biosynthesis of echinocandin B.

[0039] The construction of the knockout and complementation strains can be obtained by genetic engineering means, and the strain JKL02 is obtained by homologous recombination replacement, and the strain JKL03 is obtained by random integration of fragments.

[0040] Then, the present invention constructs a genetically engineered strain capable of solid-state fermentation and high yield of echinocandin B. The genetically engineered strain capable of high yield of echinocandin B is Aspergillus pachycristatus NRRL 11440 is a base strain; solid fermentation is then used to ferment the high-yield strain to produce echinocandin B. The specific method includes the following steps:

[0041] 1. Highly expressed in the genome of the chassis bacteria ecdJ gene, and obtained the genetically engineered strain JKL01.

[0042] 2. Using the genetically engineered strain JKL01 as the initial bacteria and rice as a carrier, solid fermentation was carried out to produce echinocandin B.

[0043] In the present invention, the biosynthesis of echinocandin B requires the participation of a gene cluster composed of multiple genes. These genes play different functions in various stages of the synthesis of echinocandin B, but there is still no report on the existence of transcription factors that regulate this entire gene cluster. The present invention first discovered the transcription activator EcdJ that regulates the echinocandin B biosynthesis gene cluster through gene knockout, complementation and transcriptome comparative analysis, and then A. pachycristatus NRRL 11440 is a chassis strain that highly expresses ecdJ The gene significantly increased the expression of almost all genes in the echinocandin B biosynthesis gene cluster, achieving the purpose of strengthening the metabolic flow of the echinocandin B biosynthesis process, so that the genetically engineered strain obtained by the transformation can efficiently produce echinocandin B. Subsequently, solid fermentation was used to ecdJ Fermentation with high-expression strains can further increase the production of echinocandin B.

[0044] In fact, no reports have been found in the production of echinocandin B. ecdJ As a transcriptional activator, no high expression has been reported. ecdJ The production of echinocandin B can be increased; at the same time, solid fermentation has not been used in the fermentation process of echinocandin B.

[0045] Beneficial effects: Compared with the prior art, the present invention has the following advantages:

[0046] The present invention Aspergillus pachycristatus NRRL 11440 is a chassis strain. By modifying the metabolic pathway in the chassis strain, the metabolic flow of the biosynthesis of echinocandin B is enhanced. First, the ecdJGene, overall promotion of the biosynthesis process of echinocandin B, strengthening the synthesis and accumulation of echinocandin B, and obtaining a genetically engineered strain with high yield of echinocandin B. In the liquid fermentation process, after 48 h of seed culture and 108 h of fermentation culture, the yield of echinocandin B was 322 mg / L. The genetically engineered strain JKL01 provided by the present invention has an echinocandin B fermentation yield of 841 mg / L under the same culture conditions, and further extends the liquid fermentation time to 216 h, and the ECB yield can reach 1.0 g / L. When the engineered strain JKL01 obtained by the present invention is used for solid fermentation, after 48 h of seed culture and 108 h of solid fermentation culture, the yield of echinocandin B can reach 861 mg / L, and the solid fermentation time is further extended to 216 h, and its yield can reach 1.5 g / L, which is 1.5 times that of the genetically engineered strain JKL01 in 216 h of liquid fermentation, and has potential industrial application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] Figure 1 Schematic diagram and electrophoresis of PCR verification using different primers when constructing strain JKL02.

[0048] Figure 2 These are the analysis results of the fermentation extracts of the echinocandin B standard, chassis bacteria, strain JKL02, and strain JKL03.

[0049] Figure 3 This is a heat map of the changes in expression levels of genes in the echinocandin B biosynthesis gene cluster in the chassis bacteria and strain JKL02.

[0050] Figure 4 The expression level changes of genes in the echinocandin B biosynthesis gene cluster in the genetically engineered strain JKL01.

[0051] Figure 5 The yield of echinocandin B in the liquid fermentation of genetically engineered strain JKL01 and bottom plate bacteria at different times ( represent p <0.0001).

[0052] Figure 6 The status of the chassis bacteria and genetically engineered strain JKL01 during solid fermentation and extraction.

[0053] Figure 7 is the yield of echinocandin B of the chassis bacteria and the genetically engineered strain JKL01 at different times of solid fermentation ( represent p <0.001).

[0054] Figure 8 The flowchart of the present invention and the comparison of the production of echinocandin B are shown. DETAILED DESCRIPTION

[0055] The present invention is further described below in conjunction with the accompanying drawings and embodiments.

[0056] Unless otherwise specified, the materials and reagents used in the examples of the present invention can be obtained from commercial sources. Experimental methods without specific conditions in the examples are usually carried out under conventional conditions or under conditions recommended by the manufacturer.

[0057] 1. The chassis strain used in the present invention is a wild type Aspergillus pachycristatus NRRL11440 is a general industrial strain used for producing echinocandin B reported at home and abroad, and has been reported in relevant literature. The strain used in the present invention Aspergillus pachycristatus NRRL 11440 is ATCC 58397, or the one provided by the National Microbial Resources Platform, China Pharmaceutical Microbial Culture Collection Management Center Aspergillus pachycristatus NRRL 11440, strain number CPCC400818, this strain is the internationally used wild type Aspergillus pachycristatus NRRL 11440 strain. The wild type strain obtained from any channel is used in the present invention. Aspergillus pachycristatus NRRL 11440 strains are acceptable.

[0058] Genes involved in the construction of genetically engineered strains of the present invention ecdJ Its gene ID is an identifier used to uniquely identify genes in the National Center for Biotechnology Information (NCBI) database of the United States, JX421684.1 (70014-72170). Tables 1 and 2 are the names of the strains of the present invention and the primers designed and used, respectively.

[0059] Table 1 Summary of strain information

[0060] Strain Name Genotype NRRL 11440 WT JKL01 ::-- JKL02 D JKL03 D::::

[0061] Table 2 Primer information summary

[0062] Primer Name Sequence Information (5‘-3’) -up-F GACCACAAGAATCAACTGCA -up--R CGTCTCTCCGCATGCTGTCCGTGTAAGGCGATAAT -down--F TCTTCTTTACTCTGAGATAAACAGCAGGTGACATG -down-R CATCAATCATGGGTTCTCGA -F GCATGCGGAGAGACGGACG -R TCAGAGTAAAGAAGAGGAGCA Yan--F ATACGCATCATGACCCTACG Yan--R TTCCACTCAGGCTCTGAAGT D--F AGAGAGAACCACCACTCAAA D--R ATCAGCACTTGTTCGAGCCA -in-F GCAAGGAATCGGTCAATACA -in-R TGTATTGACCGATTCCTTGC EcoRVF CTGCAGGAATTCGATTCATGCACTTCGCAGAGAGC EcoRVR ATCGATAAGCTTGATTCAAGCGTTAGAGTTCAGAT -P-F GACCACAAGAATCAACTGCA -T-R AATTGCCCGTCTGTCAGCGAATATACATGTATCGCT -F TGACAGACGGGCAATTGATTA -R AGGAGGGCGTGAATGTAAGC OE-F CCGAAGTAGGTAGAGCGAGT RT--F CATATACGCGATTTGTGCGC RT--R CATCAGGGAGCAGGATATTG RT--F CTATCTCATACGATGGGCTG RT--R AGGACATCTTCGCGCAATTG RT--F GGATTATCGATCAGCCTGAG RT--R CCGCAATCTCCTCATTCATC RT--F CAGTATCGGATTCAGCGACT RT--R AGGATAGGATCGAACGTACC RT--F GAGAGACTCATGTGTACACC RT--R TCAGAACAGCCTGGAGGAAG RT--F TACATTCGTCGGGTTATGCC RT--R CCTATCTTGAATCTCGAGCC RT--F ACTCAGCGATAGCTAGTATC RT--R AAGCTCCGGTTGAGTATACC RT--F CCTATCAAGTCGAGAAACGG RT--R GTAACAAGATCCAGATTGCC RT--F ACAGGTGATGTGAAGGTTGG RT--R TCGTTCTCTTTCCGAACTCC RT--F ACACGACGGAACCCTAAATG RT--R ACATGCCGCAAGCAAATTCG RT--F AAGTGTCCAGCCTACAGCAT RT--R TCAAGCCAGGCTTCAATGAG RT--F GACAGCTACAATGAGTTCCG RT--R CGGTGTTTGGAGGGTAATAG RT--F GAGATGGTAGAGGAACGGATT RT--R TCCTCGTGGATGATGTTATG

[0063] 2. The process of analyzing the fermentation extract of each strain in the present invention includes seed culture, fermentation culture (liquid and solid) and obtaining the fermentation extract, and the specific steps are as follows:

[0064] Seed culture medium and seed culture process:

[0065] S1: The composition of the seed culture medium is as follows: 10 g glucose, 10 g glycerol, 25 g cottonseed cake powder, and 1 g calcium carbonate per 1 L of culture medium.

[0066] S2: Seed culture process is as follows: 5 x 10 5 The spores of the strain constructed in the present invention were inoculated into the seed culture medium and cultured at 25° C. and 220 rpm for 48 h.

[0067] Liquid fermentation medium and fermentation culture process:

[0068] S1: The composition of the fermentation medium is as follows: per 1 L of medium, 20 g peanut oil, 30.8 g cottonseed cake powder, 12.5 g soybean cake powder, 2.44 g dipotassium hydrogen phosphate, 0.5 g calcium chloride, 0.46 g magnesium sulfate heptahydrate, 0.5 g ferrous sulfate heptahydrate, 0.48 g manganese sulfate monohydrate, 0.48 g copper sulfate pentahydrate, 3 g ornithine, and sodium hydroxide is used to adjust the pH to 6.68.

[0069] S2: The fermentation culture process is as follows: the bacterial liquid after seed culture is inoculated into 45 mL fermentation medium at a ratio of 1:10 (v:v) and cultured at 25°C and 220 rpm for 108 h.

[0070] Solid fermentation medium and fermentation culture process:

[0071] S1: The composition of the solid fermentation medium is the same as that of the liquid fermentation medium. First, weigh 100 g of rice, soak it in distilled water overnight, then drain the water and sterilize it in a sterilization bag.

[0072] S2: The inoculation and culture process is as follows: first, the bacterial solution after seed culture is inoculated into 45 mL of liquid fermentation medium at a ratio of 1:10 (v:v), mixed and poured into sterilized rice, sealed with filter paper and placed at 25°C for static culture for 108 h to 216 h.

[0073] Obtaining the fermentation extract: For the mycelium of liquid fermentation, the cultured fermentation culture was washed and filtered with single distilled water to remove the remaining culture medium components, the mycelium was collected, and extracted with 50 mL of methanol; for the mycelium of solid fermentation, all the fermented materials including rice in the sterilization bag were extracted with 250 mL of methanol; all were mixed and dispersed, and then placed in a constant temperature shaker at 16°C, 180 rpm for 6 h, and the extracted mixture was filtered to obtain the fermentation extract.

[0074] 3. The yield of echinocandin B in the embodiment of the present invention was detected and analyzed by HPLC, and the detection method was as follows:

[0075] Chromatographic conditions: AQ-C18 column (4.6 x 250 mm, Yuexu), mobile phase flow rate 1.0 mL / min, column temperature 40 °C, detection wavelength 222 nm.

[0076] Sample treatment: The obtained fermentation extract was filtered through a 0.22 μm organic nylon filter membrane.

[0077] Mobile phase: The mobile phase ratio used was methanol: acetonitrile: water = 7:1:2 (v / v), and each mobile phase was filtered using a 0.22 μm microporous filter membrane (organic phase and aqueous phase).

[0078] Data collection time: 25 min.

[0079] 4. The changes in gene expression in the chassis bacteria and strain JKL02 in the present invention were compared and analyzed using transcriptome sequencing, and the specific method is as follows:

[0080] Mycelium culture: After 48 h of seed culture, the bottom plate bacteria and strain JKL02 were subjected to liquid fermentation.

[0081] The mycelium fermented for 2.5 days was washed with single distilled water, the water was dried, and then quick-frozen with liquid nitrogen.

[0082] Sequencing processing: Subsequent experiments were completed by Shanghai Meiji Biotechnology.

[0083] 5. High expression in the embodiments of the present invention ecdJ The changes in gene expression levels of the echinocandin B biosynthesis gene cluster in the strain were obtained by qRT-PCR. The specific operation steps are as follows:

[0084] Mycelium culture: Collect and quickly freeze the mycelium of the bottom plate bacteria and high expression strains according to the mycelium collection method in step 4 above.

[0085] RNA extraction: RNA extraction was performed using the Bio-Tech UNIQ-10 column total RNA extraction kit (B511361). Specific extraction steps were performed according to the instructions.

[0086] RNA reverse transcription to cDNA: The kit used for reverse transcription was Novozymes' HiScript Ш RT SuperMix for qPCR (+ gDNA wiper) (R323-01), and the specific steps were carried out according to the instructions.

[0087] qRT-PCR experiment: qRT-PCR uses β -tubulin was used as an internal reference gene to perform relative quantification of the expression level of the target gene. The SYBR fluorescent dye method was used in the experiment, and the fluorescent dye premix used was ChamQ SYBR qPCR Master Mix (Low ROX Premixed) (Q331-02) from Novozymes. The specific reaction system and process were carried out according to the instructions.

[0088] 6. The present invention provesecdJ The invention discloses a method for constructing a genetically engineered strain with high yield of echinocandin B, and the specific process is as follows:

[0089] ecdJ Knockout strains A. pachycristatus (D ecdJ :: hph ), recorded as strain JKL02; JKL02 was fermented and tested, and the base bacteria and D ecdJ The changes in gene expression levels within the strains were compared and analyzed.

[0090] Using A. pachycristatus NRRL 11440 is a chassis cell, using a random insertion method to insert gpdA Strong promoter ecdA The gene expression sequence was poured into the genome of chassis cells and was named JKL01.

[0091] Perform qRT-PCR analysis on the gene expression in the high-expression strain according to the method in step 5 (using each RT-gene-F / R in Table 2, respectively).

[0092] 7. The present invention provides a method for producing echinocandin B by solid fermentation, and applies it to a high-expression strain. The specific process is as follows:

[0093] The genetically engineered strain JKL01 spores provided by the present invention were inoculated into a seed culture medium and cultured at 25° C. and 220 rpm for 48 h.

[0094] Weigh 100 g of rice, soak it in distilled water overnight, then drain the water and sterilize it in a sterilization bag.

[0095] First, the cultured bacterial liquid of the seed culture was inoculated into 45 mL of liquid fermentation medium at a ratio of 1:10 (v:v), mixed well and poured into sterilized rice. The mixture was sealed with filter paper and placed at 25°C for static culture for 108 to 216 hours.

[0096] 8. The genetically engineered strain obtained by the present invention uses the protoplast transformation method, and the preparation of the strain protoplasts is based on the existing conventional method, which is as follows:

[0097] Bacterial extraction: Transfer the culture medium containing logarithmic phase bacteria in the conical flask to a new 50 mL centrifuge tube and centrifuge at 8000 rpm for 8 min; after centrifugation, discard the liquid culture medium and retain the bacteria at the bottom.

[0098] Preparation of enzymatic solution (prepared and used immediately): Weigh 1 g of lytic enzyme (Novozymes DK-2880) and dissolve it completely in 10 mL of OM solution (10 mM phosphate buffer, 144.48 g / L magnesium sulfate, adjust the pH to 5.8 with disodium hydrogen phosphate) (2 M phosphate buffer: 163.4 g / L sodium dihydrogen phosphate, 90.9 g / L disodium hydrogen phosphate, adjust the pH to 7.0); filter the prepared enzymatic solution through a 0.22 μm sterile filter and place it in a 50 mL conical flask.

[0099] Enzymatic hydrolysis: Add the isolated bacteria into a 50 mL conical flask containing the prepared enzymatic hydrolysis solution, blow thoroughly to disperse the bacteria, place the conical flask in a constant temperature shaker at 28°C and 80 rpm for enzymatic hydrolysis, take out the conical flask every hour for blowing and mixing, and take samples for microscopic examination of the state of the protoplasts; when the microscopic examination results show that only a small amount of hyphae exists in the field of view, and a large number of protoplasts are uniform in size and in a vacuolar state, remove the enzymatic hydrolysis conical flask from the shaker.

[0100] Protoplast separation: Transfer the enzymatic solution containing protoplasts from the conical flask to a new 50 mL centrifuge tube and place it on ice. Slowly add an equal volume of pre-cooled Trapping buffer solution (109.3 g / L sorbitol, 12.11 g / L tris(hydroxymethyl)aminomethane, pH adjusted to 7.0 using hydrochloric acid) along the wall of the centrifuge tube. Centrifuge at 4°C, 5000 rpm for 15 min. At this time, the solution in the centrifuge tube is divided into three layers, and protoplasts are present in the middle layer. Carefully transfer the protoplasts in the middle layer to a new 50 mL centrifuge tube. Add 10 mL of pre-cooled STC solution (218.6 g / L sorbitol, 1.11 g / L calcium chloride, 1.211 g / L tris(hydroxymethyl)aminomethane, pH adjusted to 7.5 using hydrochloric acid) to the centrifuge tube. Centrifuge at 4°C, 6000 rpm for 10 min. At this time, the protoplasts are attached to the wall. Discard the liquid in the centrifuge tube and add about 2 mL Resuspend the protoplasts at the bottom with left and right STC solution, and examine the state and quantity of the prepared protoplasts under a microscope.

[0101] Example 1

[0102] ecdJ Functional identification in the biosynthesis of echinocandin B

[0103] The chassis strain A. pachycristatus NRRL 11440 and successfully constructed ecdJKnockout and complement strains JKL02 and JKL03, and use steps 2-3 of the above specific embodiment to carry out liquid fermentation culture for 36 hours to obtain fermentation extracts, and the results of HPLC analysis show that ecdJ It is a key gene for the synthesis of echinocandin B.

[0104] During the construction of each strain: the amplification PCR reaction system, the diagnostic PCR reaction system, the fusion PCR reaction program, and the PCR reaction program are shown in Tables 3-6 respectively.

[0105] Table 3 Amplification PCR reaction system

[0106] Component Volume (μL) 2×Taq Plus Master Mix 25 Forward primer 2 Reverse primer 2 Template (genomic or plasmid) 2 <![CDATA[ddH2O]]> 19 Total 50

[0107] Table 4 Fusion PCR reaction system

[0108] Component Volume (μL) 2×Taq Plus Master Mix 25 Forward primer 2 Reverse primer 2 Fragment to be fused Calculated according to molar amount <![CDATA[ddH2O]]> Make up the volume to 50 Total 50

[0109] Table 5 Diagnostic PCR reaction system

[0110] Component Volume (μL) 2×Taq Plus Master Mix 10 Forward primer 1 Reverse primer 1 Template (genomic or plasmid) 1 <![CDATA[ddH2O]]> 7 Total 20

[0111] Table 6 PCR reaction program

[0112] Temperature (℃) time Number of cycles Pre-denaturation 95 3 min 1 transsexual 95 15 s 32 annealing 55 15 s 32 extend 72 30 s / kb 32 save 12

[0113] Construction of JKL02 strain: design and use of primers JbXj -up-F / JbXj -up- hph -R and JbXj -down- hph -F / JbXj -down-R, using the genomic DNA of chassis strain NRRL 11440 as a template, using the amplification PCR system and reaction program (according to Tables 3 and 6) to amplify the left and right homologous arms of the gene, respectively. The obtained left and right homologous arms are the gene sequences of 1000 bp upstream of the start site ATG and downstream of the end site TAG / TAA of the gene, respectively. JbXj -up- hph -R and JbXj -down- hph -F with a section capable and filter flags respectively hph The complementary sequence at the start and end of the gene fragment enables it to be connected to the selection marker gene sequence; resistance selection marker hph Primers hph -F / hph-R, using commercial plasmid pAN7-1 (P0302 Miaoling Biotechnology) as a template, obtained by PCR amplification (according to Table 3 and Table 6). The left and right homologous arms of the amplified gene and the screening resistance gene fragment were recovered and the concentrations were determined respectively, using primers JbXj -up-F / JbXj -down-R, the left homology arm, hph The screening marker and the right homology arm were mixed in a molar ratio of 1:2:1 and used as templates for fusion PCR amplification. The three fragments were fused, and the fragment sizes were analyzed by fusion PCR amplification (Table 4 and Table 6) and agarose gel electrophoresis to obtain the linear donor knockout framework used for gene knockout. The constructed linear donor knockout framework was mixed with the protoplasts of the chassis strain and incubated on ice for 50 min. 10 µg of the linear donor knockout framework was added to every 100 µL of protoplasts, followed by 1.25 mL of PEG and placed at room temperature for 25 min (PEG: PEG 4000 60%, CaCl2 2.35 g / L, Tris-HCl 50 mM, pH adjusted to 7.5 with hydrochloric acid (HCl), sterilized at 115°C for 20 min). The protoplast mixture was mixed with the regeneration medium containing hygromycin B resistance and poured onto the plate. The plate was then cultured at 37°C for 2 days. The correct colonies were selected by the Aspergillus protoplast regeneration plate containing hygromycin B. The resistant strains were cultured in rich medium (YG medium) and then the genomic DNA was extracted. The diagnostic PCR (using diagnostic primers yan- JbXj -F / hph -in-R, hph -in-F / yan- JbXj -R, D- JbXj -F / D- JbXj -R) (Tables 2, 5 and 6) were used to perform PCR diagnosis and verification on the left arm, right arm and gene ORF region (partial sequence of open reading frame) of the knockout transformed strain genome, respectively, to obtain strain JKL02. Using this genome as a template, target size bands were obtained when verifying the left and right arms, but no bands appeared when verifying the gene ORF region, indicating that strain JKL02 JbXj The gene was successfully knocked out. The primers are shown in Table 2.

[0114] Construction of JKL03 strain: using primers JbXj -PF and JbXj -TR, obtained by PCR amplification (Tables 3 and 6) using genomic DNA of NRRL 11440WT strain as template JbXj The ORF region of the gene and its upstream and downstream 1000 bp gene sequences, the obtained sequence contains the gene and its original promoter and terminator, which can make the gene express normally after being transferred into the host; the primers used are JbXj -TR carries a selectable marker gene bleo A complementary pairing sequence at the starting position, enabling it to be connected to the selection resistance gene sequence; resistance selection marker bleo Primers bleo -F / bleo -R, to include bleo The screening marker plasmid was used as a template and amplified using PCR. bleo The screening marker gene fragment, such as SEQ ID NO. 4, can be synthesized by a biological company. The target gene sequence containing the original promoter and terminator obtained by amplification and the screening resistance gene fragment are recovered and the concentrations are determined respectively. JbXj -PF / bleo -R, the target gene sequence, bleo The screening markers were mixed in a molar ratio of 1:1 and used as templates for fusion PCR amplification. The two fragments were fused to obtain a linear complementation gene framework used for gene complementation. The constructed linear complementation gene framework was mixed with the protoplasts of the JKL02 strain and placed on ice for 50 min. 10 µg of the linear complementation gene framework was added to every 100 µL of protoplasts, followed by 1.25 mL of PEG and placed at room temperature for 25 min. The correct colonies were screened on an Aspergillus protoplast regeneration plate containing bleomycin. The resistant strains were cultured in rich culture medium and genomic DNA was extracted. The diagnostic PCR (diagnostic primers were JbXj -PF / bleo -R) to verify the genome of the complemented transformed strain ( Figure 1 ), strain JKL03 was obtained, and the primers are shown in Table 3.

[0115] The fermentation extracts of strains JKL02 and JKL03 and the original strain WT were analyzed by HPLC to investigate the production of echinocandin B. Figure 2 As shown, strain JKL02 (D JbXj ) fermentation extract HPLC peak diagram did not have the peak of echinocandin B, while strain JKL03 ( JbXj C ) The peak of echinocandin B reappeared in the peak diagram of the fermentation extract. The above results show that JbXj It is a key gene for the biosynthesis of echinocandin B.

[0116] To explore JbXj To study how the synthesis of echinocandin B is regulated, transcriptome sequencing was performed on the mycelium of the chassis bacteria and JKL02 strain under fermentation conditions, and the expression changes of genes in the echinocandin B biosynthesis gene cluster were compared and analyzed. Figure 3As shown, all genes in the echinocandin B synthesis gene cluster were silenced in the JKL02 strain. The above results indicate that JbXj It globally regulates the expression of genes in the echinocandin B biosynthesis gene cluster and is a transcriptional activator of the gene cluster.

[0117] Example 2

[0118] Construction of an engineered strain JKL01 that produces high levels of echinocandin B

[0119] The present invention uses a strong promoter gpd Come to JbXj High expression. The specific steps are as follows:

[0120] The chassis strain A. pachycristatus NRRL 11440 was inoculated into rich medium (YG medium: 5 g / L yeast extract, 20 g / L glucose, 1 mL / L 1000x trace elements, including: 1000x trace elements: 22 g / L zinc sulfate heptahydrate, 11 g / L boric acid, 5 g / L manganese chloride tetrahydrate, 5 g / L ferrous sulfate heptahydrate, 1.6 g / L cobalt dichloride pentahydrate, 1.6 g / L copper sulfate, 1.1 g / L ammonium heptamolybdate tetrahydrate, 50 g / L EDTA, and potassium hydroxide to adjust pH to 6.5) and cultured at 37°C, 220 rpm for 24 h. Whole genomic DNA was extracted using the Shengong Fungal Genome Extraction Kit (B518229 Fungal Genomic DNA Rapid Extraction Kit). Escherichia coli containing the pBARGPE1-Hygro plasmid (P0381 Miaoling Biotechnology) was inoculated into liquid LB medium and cultured at 37°C and 220 rpm for 12 h. The pBARGPE1-Hygro plasmid was extracted using the Novezan plasmid extraction kit (DC201-01 FastPure Plasmid Mini Kit).

[0121] Linearization of pBARGPE1-Hygro plasmid: Prepare EcoRV restriction enzyme system of pBARGPE1-Hygro plasmid, with a total system of 10 μL. The specific preparation system is shown in Table 7 below. After mixing, the prepared restriction enzyme system is placed in a 37°C water bath for incubation for 3.5 hours. After the restriction enzyme digestion is completed, gel electrophoresis is performed for verification and the linearized pBARGPE1-Hygro plasmid is purified and recovered by gel tapping and its concentration is determined.

[0122] Table 7 Enzyme digestion reaction system

[0123] Element Volume (μL) pBARGPE1-Hygro Plasmid Volume is calculated based on 20 mg EcoRV enzyme 1 10×H Buffer 2 BSA 2 Trion (Triton X-100) 2 Sterile water Make up the volume to 10 Total 10

[0124] Design and use of primers JbXj-EcoRV-F / R, chassis strain A. pachycristatus NRRL 11440 genomic DNA was used as a template to obtain PCR amplification with EcoRV restriction endonuclease adapters. JbXj ORF region.

[0125] Plasmid recombination construction: The target gene and the linearized pBARGPE1-Hygro plasmid were enzymatically connected using recombinase (NoviZan), with a total system of 10 μL. The specific preparation system is shown in Table 8 below. (The molar amount of target gene fragment and linearized pBARGPE1-Hygro plasmid added (μg) = fragment length (bp) × 2%). After mixing the recombinase ligation system, place the prepared system in a PCR instrument and incubate at 37°C for 30 min.

[0126] Table 8 Recombinase ligation reaction system

[0127] Element Volume (μL) Target gene fragment Convert volume to mole Linearized pBARGPE1-Hygro plasmid Convert volume to mole Exanase Ⅱ 1 5×CE Buffer 2 Sterile water Make up the volume to 10 Total 10

[0128] The ligated product was transformed into E. coli DH5α competent cells and screened and verified by colony PCR. The primers were yan-OE-F / JbXj -EcoRV-R, primers are shown in Table 2) After the verified E. coli is expanded, the plasmid is extracted and sequenced to obtain the sequenced correct JbXj High-profile plasmids.

[0129] The completed JbXj High expression vectors were introduced into the base strains through protoplast transformation A. pachycristatus NRRL 11440 protoplasts, specifically: JbXj The high-profile plasmid was mixed with the protoplasts of the chassis strain and incubated on ice for 50 min. 10 µg of JbXj High-key plasmid, then add 1.25 mL PEG and place at room temperature for 25 min) (PEG: PEG 4000 60%, calcium chloride 2.35 g / L, Tris-HCl 50 mM, hydrochloric acid adjusted to pH 7.5, sterilized at 115℃ for 20 min), screen the correct colonies through Aspergillus protoplast regeneration plates containing hygromycin, culture the resistant strains in rich medium and extract genomic DNA, and use diagnostic PCR with diagnostic primers yan-OE-F / JbXj -EcoRV-R primers, see Table 2 for details, were used for verification to obtain strain JKL01.

[0130] The strain JKL01 verified by diagnostic PCR was fermented and cultured for 108 h using the liquid fermentation method in step 2 described above in the present invention. The bacteria after fermentation were collected and RNA was extracted using a Sangon total RNA extraction kit (catalog number B511361 column total RNA extraction kit). The RNA was then extracted by qRT-PCR in step 5 (primers RT-gene-F / R were used, and the primers are shown in Table 2, such as RT- ikB -F / R, RT- oeLh -F / R, etc.) for JKL01 strain under fermentation culture conditions JbXj The expression levels of other genes were measured.

[0131] like Figure 4 As shown, the JKL01 strain successfully constructed under the fermentation culture conditions of the present invention has JbXj The expression level of the strain was significantly higher than that of the chassis strain under the same conditions. A. pachycristatus NRRL 11440, and the expression levels of other genes in the echinocandin B gene cluster were also significantly increased.

[0132] Example 3

[0133] JbXj Solid-state fermentation of high-expression strains to produce echinocandin B

[0134] The genetically engineered strain JKL01 constructed in Example 2 of the present invention is subjected to seed culture and liquid and solid fermentation culture using the culture method described in the above step 2 of the present invention to obtain a fermentation extract; A. pachycristatus NRRL 11440 was fermented as a comparison. After 48 h of seed culture and 108 h of liquid fermentation, the fermentation yield of echinocandin B in the genetically engineered strain JKL01 reached 841 mg / L, which was 2.6 times that of the echinocandin B in the chassis strain; extending the fermentation time to 216 h could increase the echinocandin B yield in the JKL01 strain to 1.0 g / L ( Figure 5 ).

[0135] When rice is used as a carrier for solid fermentation, there is no water in the fermentation process ( Figure 6 ), and can be cultured statically, with high space utilization, reducing fermentation costs. After 48 h of seed culture, the fermentation yield of echinocandin B of the genetically engineered strain JKL01 reached 861 mg / L after 108 h of fermentation using the same amount of fermentation medium. If the solid fermentation time is extended to 216 h, the echinocandin B yield can reach 1.5 g / L, which is 1.5 times that of the genetically engineered strain JKL01 after 216 hours of liquid fermentation ( Figure 7 ).

[0136] The present invention uses the strain producing echinocandin B A. pachycristatus NRRL 11440 is a chassis strain. JbXj The function of echinocandin B in the synthesis process was explored, and it was found that it can regulate the biosynthesis gene cluster of echinocandin B as a whole, and is a transcriptional activator of echinocandin B biosynthesis; the present invention transforms the transcriptional regulator that regulates the biosynthesis of echinocandin B proved in this study into JbXj Use a strong promoter gpd The engineered strain JKL01 was obtained by making it highly expressed, and the expression of almost all genes in the echinocandin B biosynthesis gene cluster was increased, thereby promoting the synthesis of echinocandin B. Then JKL01 was subjected to liquid fermentation and solid fermentation respectively. Among them, when the chassis strain was cultured in a liquid shake flask, after 48 hours of seed culture and 108 hours of liquid fermentation culture, the fermentation yield of echinocandin B was only 322 mg / L; when the genetically engineered strain JKL01 provided by the present invention was cultured in a liquid shake flask, the fermentation yield of echinocandin B was 841 mg / L through the same fermentation method, such as Figure 5 As shown, the production of echinocandin B in the genetically engineered strain JKL01 is significantly increased compared to that in the chassis bacteria. When the genetically engineered strain JKL01 provided by the present invention is used for solid fermentation, the production of echinocandin B can be increased to 861 mg / L after the same fermentation time and the same amount of fermentation medium. If the solid fermentation time is further extended to 216 h, the production of echinocandin B can reach 1.5 g / L, which is 1.5 times that of the genetically engineered strain JKL01 in liquid fermentation for 216 h ( Figure 8 ), which has potential industrial application value.

[0137] In summary, the transcriptional activator for high expression of echinocandin B biosynthesis provided by the present invention JbXj It is an effective way to obtain a high-yield strain of echinocandin B. At the same time, solid fermentation is more conducive to the fermentation production of echinocandin B, which can save costs and increase the yield of echinocandin B. The above inventions all have high application value in the industrial production of echinocandin B.

Claims

1. A genetically engineered strain capable of solid-state fermentation and high yield of echinocandin B, wherein the genetically engineered strain is Aspergillus pachycristatus NRRL 11440 is a chassis bacteria, and is highly expressed in chassis bacteria JbXj Income, JbXj The gene sequence is shown in SEQ ID NO.1; The solid-state fermentation comprises the following steps: (1) Soak the rice overnight, drain and sterilize; (2) Inoculate the culture solution of the genetically engineered strain seed into the liquid fermentation medium, mix well and pour into the sterilized rice, and culture statically for 108 h to 216 h; The fermentation medium comprises the following components: per liter of medium, 20 g of peanut oil, 30.8 g of cottonseed meal, 12.5 g of soybean meal, 2.44 g of dipotassium hydrogen phosphate, 0.5 g of calcium chloride, 0.46 g of magnesium sulfate heptahydrate, 0.5 g of ferrous sulfate heptahydrate, 0.48 g of manganese sulfate monohydrate, 0.48 g of copper sulfate pentahydrate, 3 g of ornithine, and sodium hydroxide is used to adjust the pH to 6.

68.

2. The use according to claim 1, characterized in that: Said JbXj Genes using strong promoters gpd As a promoter.

3. The use according to claim 1, characterized in that: The method for constructing a genetically engineered strain capable of solid-state fermentation and high yield of echinocandin B comprises the following steps: (1) JbXj The primers were designed from the gene sequence and the genomic DNA of the bottom plate bacteria was used as a template for PCR amplification. JbXj gene sequence; subsequently gpd Promoter and TcP Linearization of the plasmid vector with the terminator; (2) JbXj The gene sequence was recombined with the linearized plasmid vector to obtain JbXj After the high expression plasmid is completed, the plasmid is introduced into the protoplasts of the chassis bacteria to obtain the strain JKL01, which is a genetically engineered strain with high production of echinocandin B that can be solid-state fermented.

4. The use according to claim 3, characterized in that The primer sequence in step (1) includes the primer sequence shown in SEQ ID NO.2 JbXj -EcoRV-F and SEQ ID NO.3 JbXj -EcoRV-R: JbXj -EcoRV-F:CTGCAGGAATTCGATTCATGCACTTCGCAGAGAGC; JbXj -EcoRV-R:ATCGATAAGCTTGATTCAAGCGTTAGAGTTCAGAT。 5. The use according to claim 3, characterized in that The vector described in step (2) is the pBARGPE1-Hygro plasmid.

Images