KCNJ6 gene as a molecular marker for immune traits in yaks and its application

Abstract

The present invention belongs to the technical field of livestock molecular biology detection, and in particular, relates to the KCNJ6 gene as a molecular marker for yak immune traits and its application. The KCNJ6 gene is used as a molecular marker for yak immune traits, and the nucleotide sequence of the molecular marker is shown in SEQ ID NO: 1. The y at the 401st position of the sequence represents T or C, resulting in the T / C polymorphism of the yak KCNJ6 gene at this site. The present invention can determine the immunoglobulin A, immunoglobulin G, and immune content of individual yaks by detecting the base at the 163690745th nucleotide site on chromosome 1 of the yak. ​​The present invention provides a new SNP molecular marker resource for marker-assisted selection of yak immune traits for non-diagnostic purposes.

Description

Technical Field

[0001] The invention belongs to the technical field of livestock molecular biology detection, and in particular relates to a KCNJ6 gene as a molecular marker of yak immune traits and an application thereof. Background Art

[0002] Livestock diseases are not only harmful to the livestock themselves, but also have a great impact on the development of animal husbandry. Livestock diseases have always been prevented and controlled mainly by methods such as vaccination or drug treatment, but this has not fundamentally eliminated and controlled the occurrence and spread of diseases. In addition, the disease resistance of animals is also affected by genetic factors, environmental factors, nutritional status and age, and the disease resistance of different livestock is different. For example, genetic factors can affect the structure and function of the animal's immune system, while environmental conditions and nutritional status may affect the health and response ability of the immune system. Therefore, studying the relationship between disease resistance genes and diseases is of great significance for the prevention and control of livestock diseases.

[0003] Immune indicators can reflect the disease resistance of animals. The disease resistance of animals mainly depends on the health status and capacity of their immune system. The main function of the immune system is to identify and eliminate pathogens that invade the body, such as bacteria and viruses. When pathogens invade, the immune system will respond quickly and initiate a series of immune response processes to fight and eliminate pathogens. Immunoglobulin (Ig) is a class of globulins with antibody activity or chemical structures similar to antibodies, and is the main reactant of humoral immune response. It has antibacterial and antiviral effects, enhances the phagocytic function of cells, and kills or dissolves pathogenic microorganisms under synergistic effects. It is an important component of the body's fight against disease.

[0004] Yaks (Bosgrunniens), known as the "boat of the plateau", are important native mammals in the plateau area. They are mainly distributed in the Qinghai-Tibet Plateau and its adjacent high-altitude and low-oxygen areas. After a long period of natural selection, yaks can adapt to the high-altitude and low-oxygen environment and have very strong resistance to adversity. Oxidative stress in mammalian cells can cause cell macromolecule damage and organ dysfunction, reduce production performance, and even infect various diseases. At the same time, immune stress can also cause changes in livestock behavior, metabolism, and neurosecretion, and ultimately inhibit their growth. In the traditional grazing production and breeding model of raising livestock, the nutritional intake of yaks will be affected by the seasonal changes in forage yield and nutrients. When the forage supply is insufficient or the nutritional level is too low, it will cause long-term nutritional deficiencies in pregnant cows and newborn calves, resulting in delayed or even stagnant growth and development of yaks. The harsh environment in the plateau pastoral area leads to a high incidence of yak calves. Calves in a sub-healthy state are prone to growth and development stunting. Yaks are important livestock for local herders in terms of economy and agriculture. Several diseases pose a serious threat to the health of yaks and cause significant economic losses to local herders.

[0005] Therefore, immune indicators can be used as an important reference to evaluate the disease resistance and health status of yaks. By monitoring the changes in immune indicators, immune problems of yaks can be discovered in time, and corresponding measures can be taken to improve their disease resistance, prevent and treat diseases.

[0006] The combined effects of genes and the environment determine the phenotypic traits of an organism, and the diversity of genes determines the basic immune function of an organism. Understanding immune-related factors is very important for studying the immune response and pathological changes during infectious and non-infectious diseases in yaks. Summary of the invention

[0007] The purpose of the present invention is to provide KCNJ6 gene as a molecular marker of yak immune traits and its application.

[0008] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0009] The present invention provides a SNP molecular marker associated with yak immune traits, wherein the SNP molecular marker is located at the 163690745th base on chromosome 1 of the yak reference genome LU_Bosgru_v3.0 version, and the mutant base is C or T.

[0010] Preferably, the genotype of the yak with the mutant base C is CC or CT; the genotype of the yak with the mutant base T is TT; the immunoglobulins IgA, IgG, and IgM of yak individuals with the TT genotype are significantly higher than those of individuals with the CT and CT genotypes.

[0011] The present invention also provides the use of the SNP molecular marker in preparing products for detecting yak immunity or yak assisted breeding products.

[0012] The present invention also provides a primer pair for amplifying the SNP molecular marker, and the sequence of the primer pair is shown in SEQ ID NO: 2-3.

[0013] The present invention also provides the use of the primer pair in preparing a product for detecting yak immunity or a product for yak auxiliary breeding.

[0014] The present invention also provides a kit for detecting yak immunity, comprising a reagent for detecting the SNP molecular marker or the primer pair.

[0015] The present invention also provides a kit for yak assisted breeding, comprising a reagent for detecting the SNP molecular marker or the primer pair.

[0016] The present invention also provides a method for marker-assisted selection of yak immune traits for non-diagnostic purposes, comprising the following steps:

[0017] (1) Extracting yak genomic DNA;

[0018] (2) using the yak genomic DNA obtained in step (1) as a template, and performing amplification using the primer pair to obtain an amplified product;

[0019] (3) Performing genotyping analysis on the amplified products to obtain yaks with different genotypes; correlating the genotypes of the yaks with immune indicators; the immunoglobulins are one or more of immunoglobulin A, immunoglobulin G and immunoglobulin M.

[0020] Preferably, the amplification system in step (2) is 25 μL in total, including: 12.5 μL of 2×L-Exp Taq Master Mix, 8.5 μL of RNase free water, 1 μL of upstream primer, 1 μL of downstream primer, and 2 μL of template.

[0021] Preferably, the amplification program in step (2) is: 94°C for 1 min, 98°C for 10 s, 58°C for 30 s, 72°C for 1 min, for a total of 35 cycles; and extension at 72°C for 2 min.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] The SNP molecular marker described in the present invention is located at the 163690745th base on chromosome 1 of the yak genome LU_Bosgru_v3.0 version; the variation type is C / T, named g163690745T>C. The present invention can determine the immunoglobulin IgA, IgG, and IgM content of individual yaks by detecting the base at the 163690745th nucleotide site on chromosome 1 of the yak. ​​The present invention provides a new SNP molecular marker resource for marker-assisted selection of yak immune traits for non-diagnostic purposes. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0025] Figure 1 It is the PCR amplification product: M represents Marker; 1, 2, and 3 represent 3 groups of repetitions.

[0026] Figure 2 This is the sequence peak diagram of the PCR amplification product after sequencing. DETAILED DESCRIPTION

[0027] The present invention provides a SNP molecular marker associated with yak immune traits, wherein the SNP molecular marker is located at the 163690745th base on chromosome 1 of the yak reference genome LU_Bosgru_v3.0 version, and the mutant base is C or T.

[0028] In the present invention, the genotype of the yak with the mutant base C is CC or CT; the genotype of the yak with the mutant base T is TT; the immunoglobulins IgA, IgG, and IgM of the yak individuals with the TT genotype are significantly higher than those of the CT and CT genotype individuals.

[0029] The present invention also provides the use of the SNP molecular marker in preparing products for detecting yak immunity or yak assisted breeding products.

[0030] The present invention also provides a primer pair for amplifying the SNP molecular marker, and the sequence of the primer pair is shown in SEQ ID NO: 2-3.

[0031] The present invention also provides the use of the primer pair in preparing a product for detecting yak immunity or a product for yak auxiliary breeding.

[0032] The present invention also provides a kit for detecting yak immunity, comprising a reagent for detecting the SNP molecular marker or the primer pair.

[0033] The present invention also provides a kit for yak assisted breeding, comprising a reagent for detecting the SNP molecular marker or the primer pair.

[0034] The present invention also provides a method for marker-assisted selection of yak immune traits for non-diagnostic purposes, comprising the following steps:

[0035] (1) Extracting yak genomic DNA;

[0036] (2) using the yak genomic DNA obtained in step (1) as a template, and performing amplification using the primer pair to obtain an amplified product;

[0037] (3) Performing genotyping analysis on the amplified products to obtain yaks with different genotypes; correlating the genotypes of the yaks with immune indicators; the immunoglobulins are one or more of immunoglobulin A, immunoglobulin G and immunoglobulin M.

[0038] In the present invention, the amplification system described in step (2) is 25 μL in total, including: 2×L-Exp TaqMasterMix 12.5 μL, RNase free water 8.5 μL, upstream primer 1 μL, downstream primer 1 μL, and template 2 μL.

[0039] In the present invention, the amplification program described in step (2) is: 94°C for 1 min, 98°C for 10 s, 58°C for 30 s, 72°C for 1 min, for a total of 35 cycles; and extension at 72°C for 2 min.

[0040] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0041] Example 1

[0042] 1. Sample collection

[0043] The invention uses the Niangya yak breed as the detection object, collects 5 mL of blood samples from 190 fasting yaks from the Jiali County ranch in Nagqu City, Tibet Autonomous Region, and puts them in a clean pro-coagulant vacuum blood collection tube, lets them stand for 30 minutes, and then centrifuges them at 3500r / min for 10 minutes, aspirates the supernatant into a PE tube, seals it and stores it in a -20°C low-temperature refrigerator; another 5 mL of blood sample is collected and added to a blood collection tube containing EDTA-K2 anticoagulant. After the blood sample is collected, it is quickly mixed, temporarily stored in a sampling box containing an ice pack, and transported back to the laboratory and frozen in a -20°C refrigerator for extraction of genomic DNA.

[0044] 2 Main reagents and instruments

[0045] EDTA-K2 vacuum blood collection tubes were purchased from Jiangsu Yuli Medical Instrument Co., Ltd.; blood genomic DNA extraction kits were purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; Nano Drop 2000 spectrophotometer was purchased from Thermo Fisher Scientific, USA; DL2000 Marker, agarose, and nucleic acid dyes were purchased from Beijing Solebold Technology Co., Ltd.; 2×L-Exp Taq Master Mix (dye plus) was purchased from Hunan Aikerui Bioengineering Co., Ltd.; electrophoresis instrument was purchased from Beijing Liuyi Instrument Factory; PCR instrument was purchased from BioRad. IgA (MB-4907A), IgG (MB-4616A), and IgM (MB-4908A) detection kits were purchased from Jiangsu Enzyme Biotechnology Co., Ltd.

[0046] 3 Methods

[0047] 3.1 Immunoglobulin IgA, IgG, and IgM detection

[0048] According to the IgA, IgG, and IgM detection kits of Jiangsu Enzyme Biotechnology Co., Ltd., the double antibody one-step sandwich method was used for determination. First, the required strips were taken out from the aluminum foil bag after equilibration at room temperature for 20 minutes, and the remaining strips were sealed with a self-sealing bag and returned to 4°C. Set up standard wells and sample wells, and add 50μL of different concentrations of standard wells to each standard well; first add 10μL of the sample to be tested to the sample well, and then add 40μL of sample diluent; blank wells are not added. In addition to the blank wells, 100μL of horseradish peroxidase (HRP)-labeled detection antibody is added to each well of the standard well and sample well, and the reaction wells are sealed with a sealing film, and incubated at 37°C water bath or constant temperature box for 60min. Discard the liquid, pat dry on absorbent paper, fill each well with washing solution, let stand for 1min, shake off the washing solution, pat dry on absorbent paper, and repeat the washing 5 times (you can also use a plate washer to wash the plate). Add 50μL of substrate A and B to each well and incubate at 37°C in the dark for 15min. Add 50 μL of stop solution to each well, and measure the OD value of each well at a wavelength of 450 nm within 15 minutes. Finally, draw a standard curve: in an Excel worksheet, use the concentration of the standard as the horizontal axis and the corresponding OD value as the vertical axis to draw a linear regression curve of the standard, and calculate the IgA, IgG, and IgM concentration values ​​of each sample according to the curve equation.

[0049] 3.2 Extraction of genomic DNA from blood

[0050] The blood genomic DNA extraction kit of Tiangen Biochemical Technology (Beijing) Co., Ltd. was used to extract genomic DNA from the blood samples. The extracted DNA was placed under an ultraviolet spectrophotometer to detect the concentration and purity. The concentration>20ng / μL and OD260 / OD280 between 1.7 and 1.9 met the experimental requirements and was stored at -20℃ for future use.

[0051] 3.3 Primer design

[0052] Referring to the chromosome 1 gene sequence of the yak genome LU_Bosgru_v3.0 version (Ensemble accession number: ENSBGRG00000003372), specific primers were designed using Primer5 software, including the g163690745T>C SNP site.

[0053] Primer sequences

[0054] F: 5'-GCGACCTCCTCATTCTCCT-3' (SEQ ID NO: 2);

[0055] R: 5'-TGTACCTTCTTCCACCCAC-3' (SEQ ID NO: 3).

[0056] The length of the amplified fragment was 408 bp, and the primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0057] 3.4 PCR amplification and sequencing

[0058] PCR amplification system 25uL: 2×L-Exp Taq Master Mix (dye plus) 12.5μL, RNase free water 8.5μL, upstream primer 1μL, downstream primer 1μL, template 2μL.

[0059] PCR amplification program: 94°C for 1 min, 98°C for 10 s, 58°C for 30 s, 72°C for 1 min, for a total of 35 cycles; extension at 72°C for 2 min.

[0060] The PCR products were detected by 1% agarose gel electrophoresis. After the PCR products were qualified by agarose gel electrophoresis, they were sequenced by direct sequencing, and the sequencing was completed by Beijing Qingke Biotechnology Co., Ltd. The amplified nucleotide sequence is shown in SEQ ID NO: 1, and the SNP marker is located at position 226 of the nucleotide sequence shown in SEQ ID NO: 1, and the site can be C / T (the nucleotide sequence of the SNP marker is shown in SEQ ID NO: 1).

[0061] The biological analysis software MEGA 11.0 was used to compare the sequencing results of PCR products, analyze the sequencing peak graph, and complete the typing.

[0062] 4 Statistical analysis

[0063] According to the genotyping results, the number of individuals with different genotypes at each site was counted. Popgen32 software was used to calculate the g163690745T>C gene frequency, genotype frequency, effective allele number (Ne), site heterozygosity (He), and Hardy-Weinberg equilibrium test, and PIC (polymorphism information content, referred to as PIC) calculation software was used to calculate the polymorphic information content. The general linear model in IBM SPSS Statistics 26 software was used to analyze the association between different genotypes of yaks and immunoglobulins IgA, IgG, and IgM, and the results were expressed as "mean ± standard error".

[0064] 5 Results

[0065] 5.1 PCR amplification and sequencing results

[0066] The amplified product of the g163690745T>C SNP site on chromosome 1 of yak was detected by 1% agarose gel (see Figure 1 ), the bands were clear without any other bands, the specificity was good, and the PCR product fragment size was 408bp, which was in line with the expected size, so the next step of the experiment could be carried out.

[0067] SEQ ID NO:1

[0068] GCGACCTCCTCATTCTCCTTTAGCTCTGTGAATCTGTCTGATGTTTCAGGAATGCACAGAAATTGGAGCCCCTTCCCTGAAAAACTATGTGTAGCTTGAGCCTGGCCTGACCATCGTTCACTTTTATTGCCTTTCCCTAATTGTTTATGTTTTTCATTAATTTTGCACCTCAGGAGGCACATCTCATCAATTTGCAGAGATGCACCTTGCATGTTCTCAGAGGAC T GGTCTGTCCTCTGCCTTGTTAATAACCTGTCAAAAGGAAATGCCTGGAGACAAAAAAACACTGCATGATCTCACTTATGGTGGAATTAAAGAAAAACAGGAGCCACCAAACTCATAGAAAAAAGAGATCAGATTTGTGGTTTTCAGAGGTGGGGGAGTGGGGCGTGGGTGGAAGAAGGTACA

[0069] The peak map and sequence obtained after purification and sequencing of the PCR product are shown in Figure 2 . From Figure 2 it can be seen that a T-C mutation occurred at the g163690745T>C SNP locus, and there are three genotypes: CC, CT, and TT.

[0070] 5.2 Statistical analysis results

[0071] The genotypes and allele frequencies of the g163690745T>C SNP locus on chromosome 1 of yaks were analyzed from the perspective of population genetics. As shown in Table 1, at the g163690745T>C SNP locus, the CT genotype frequency was the highest, being the dominant genotype, and the C allele frequency was 53.2%, showing as the dominant allele. The χ 2 goodness-of-fit test showed that the SNP locus conformed to the Hardy-Weinberg equilibrium state (P>0.05) (Table 1). The expected heterozygosity of this locus was 0.498, and the PIC was 0.374. Since 0.25<PIC<0.50, it belongs to moderate polymorphism.

[0072] Table 1 Polymorphism of the g163690745T>C SNP locus on chromosome 1 of yaks

[0073]

[0074] 5.3 Association analysis between different genotypes and immunoglobulins IgA, IgG, and IgM

[0075] The general linear model in IBM SPSS Statistics 26 software was used to analyze the association between different genotypes of yaks and the content of immunoglobulins IgA, IgG, and IgM. The results showed that the immunoglobulins IgA, IgG, and IgM of yaks with TT genotype were significantly higher than those of CT and CT genotypes (p<0.05), and there was no significant difference in immunoglobulin IgA and IgG between CC and CT genotypes (p>0.05), and there was no significant difference in immunoglobulin IgM between CT and CC and TT genotypes (p>0.05), indicating that the base of the g163690745T>C SNP site on chromosome 1 of yaks is significantly correlated with yak IgA, IgG, and IgM, and is a SNP marker related to yak IgA, IgG, and IgM. The results are shown in Table 2.

[0076] Table 2 Correlation analysis between different genotypes and immunoglobulins IgA, IgG, and IgM

[0077]

[0078] Note: Different lowercase letters in the same row of data indicate significant differences (P<0.05).

[0079] In summary, the SNP molecular marker described in the present invention is located at the 163690745th base on chromosome 1 of the yak genome LU_Bosgru_v3.0 version; the variation type is C / T, named g163690745T>C, and there are three genotypes. When the 163690745th base on chromosome 1 is C, the genotype is CC or CT; when the 163690745th base on chromosome 1 is T, the genotype TT; through the association analysis between different genotypes and the content of immunoglobulins IgA, IgG, and IgM, the immunoglobulins IgA, IgG, and IgM of yak individuals with the TT genotype were significantly higher than those of individuals with the CT and CT genotypes (p<0.05), and there was no significant difference in immunoglobulin IgA and IgG between individuals with CC and CT genotypes (p>0.05), and there was no significant difference in immunoglobulin IgM between individuals with CT and CC and TT genotypes (p>0.05). The present invention can determine the content of immunoglobulins IgA, IgG, and IgM of yak individuals by detecting the bases at the 163690745th nucleotide site on chromosome 1 of yaks. The present invention provides a new SNP molecular marker resource for marker-assisted selection of yak immune traits for non-diagnostic purposes.

[0080] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Use of a reagent for detecting SNP molecular markers in the preparation of an in vitro detection reagent for immune traits of Niangya yaks or in the preparation of a detection reagent for immune traits of Niangya yaks for assisted breeding, characterized in that: The SNP molecular marker is located at the 163690745th base on chromosome 1 of the yak reference genome LU_Bosgru_v3.0 version, and the mutant base is C or T; Among them, the immunoglobulins IgA, IgG, and IgM of Niangya yak individuals with TT genotype were significantly higher than those of individuals with CT and CT genotypes; The immune traits refer to the contents of immunoglobulin A, immunoglobulin G and immunoglobulin M.

2. The use according to claim 1, characterized in that: The reagent for detecting the SNP molecular marker is a primer pair as shown in SEQ ID NO.2~3.

3. A method for marker-assisted selection of immune traits of Niangya yaks for non-diagnostic purposes, characterized in that: The steps include: (1) Extraction of Niangya yak genomic DNA; (2) using the Niangya yak genomic DNA obtained in step (1) as a template, and using the primer pairs shown in SEQ ID NOs. 2-3 to perform amplification to obtain an amplified product; (3) performing genotyping analysis on the amplified products to obtain Niangya yaks with different genotypes; correlating the genotypes of the Niangya yaks with immune indicators; the immune indicators are the contents of immunoglobulin A, immunoglobulin G, and immunoglobulin M; The primer pair is used to amplify the SNP molecular marker, which is located at the 226th base as shown in SEQ ID No.1, and the mutant base is C or T; wherein, the immunoglobulins IgA, IgG, and IgM of Niangya yak individuals with TT genotype are significantly higher than those of individuals with CT and CT genotypes.

4. The method according to claim 3, characterized in that The amplification system in step (2) is 25 μL in total, including: 2× L- Exp Taq Master Mix 12.5μL, RNase free water 8.5μL, upstream primer 1μL, downstream primer 1μL, template 2μL.

5. The method according to claim 3, characterized in that: The amplification program of step (2) was as follows: 94°C for 1 min, 98°C for 10 s, 58°C for 30 s, and 72°C for 1 min, for a total of 35 cycles; extension at 72°C for 2 min.

Images