SNP (Single Nucleotide Polymorphism) molecular marker influencing immune globulin M and immune globulin A of yak and application of SNP molecular marker

Abstract

The invention relates to the technical field of molecular biological detection, and provides cloning of an SNP molecular marker influencing yak immune globulin and application of the SNP molecular marker. The SNP molecular marker related to the immune traits of the yak is obtained through screening and is located at the 43165308th basic group on the 21st chromosome of a yak reference genome LUBosgruv3.0, and the mutant basic group is C or T. The SNP molecular marker related to the immune traits of the yak is obtained through screening and is located at the 43165308th basic group. The molecular marker can be used for judging the content of immune globulin A and immune globulin M of an individual yak. The invention provides a new SNP molecular marker resource for non-diagnostic yak immune trait marker-assisted selection, and provides a basis for improving yak immunity breeding.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology detection, and particularly relates to an SNP molecular marker affecting yak immunoglobulin M and immunoglobulin A and its application. Background Art

[0002] Yaks are widely distributed in the Qinghai-Tibet Plateau and its adjacent areas, and are unique bovine resources and the dominant livestock species in alpine pastoral areas. Due to the lack of forage resources, backward production methods, and backward disease prevention and control technologies in the production areas, there are great risks in the healthy breeding of yaks. With the progress of science and technology and the development of industrial technologies, using molecular marker technology to explore genetic markers closely related to the disease resistance of yaks, and then assisting in the disease-resistant breeding work of yaks, is a forward-looking and innovative research direction.

[0003] With the continuous increase in the drug resistance and mutations of infectious pathogens to antibiotics, traditional means of preventing and controlling infectious diseases, such as vaccination and antibiotic use, face increasingly severe challenges in modern livestock farming. The pathogenesis of yak diseases is not only affected by external environmental pollutants, but also closely related to its own gene regulation. The resistance of animals to various diseases depends to a large extent on genetic factors. Therefore, by excavating disease-resistant related genes and carrying out targeted disease-resistant breeding work, it is possible to effectively improve animal immunity, reduce drug dependence, and then promote the healthy and sustainable development of the livestock industry.

[0004] DNA molecular markers are a class of DNA fragments that can intuitively reflect genetic differences between the same species or different species. With the rapid development of DNA molecular marker technology, it has laid a foundation for people to study the genetic mechanism of yak disease resistance at the molecular level. However, the current research on molecular markers related to yak immune characteristics and immune genes is still relatively scarce. Therefore, further strengthening basic research and applied research, and using DNA molecular marker technology to screen SNP molecular markers related to yak disease resistance, are expected to achieve more accurate and efficient yak breeding goals in the future, thereby improving the overall health level and production performance of yaks. Summary of the Invention

[0005] The purpose of the present invention is to provide an SNP molecular marker affecting yak immunoglobulin M and immunoglobulin A and its application.

[0006] In order to achieve the above-mentioned invention purpose, the present invention provides the following technical solutions:

[0007] The present invention provides an SNP molecular marker affecting yak immunoglobulin A and immunoglobulin M, and the SNP molecular marker is located at the 43,165,308th base on chromosome 21 of the yak reference genome LU_Bosgru_v3.0 version, and the mutated base is C or T.

[0008] Preferably, the genotype of yaks with a mutated base of C is CC or CT; the genotype of yaks with a mutated base of T is TT;

[0009] The content of immunoglobulin M in yaks with genotypes CC and CT is significantly higher than that in yaks with genotype TT, and the content of immunoglobulin A in yaks with genotype CC is significantly higher than that in yaks with genotype TT.

[0010] The present invention also provides the application of the SNP molecular marker in the preparation of products for detecting the immunity of yaks or products for yak assisted breeding.

[0011] The present invention also provides a primer pair for amplifying the SNP molecular marker, and the sequences of the primer pair are shown as SEQ ID NO: 1-2.

[0012] The present invention also provides the application of the primer pair in the preparation of products for detecting the immunity of yaks or products for yak assisted breeding.

[0013] The present invention also provides a kit for detecting the immunity of yaks, comprising a reagent for detecting the SNP molecular marker or the primer pair.

[0014] The present invention also provides a kit for yak assisted breeding, comprising a reagent for detecting the SNP molecular marker or the primer pair.

[0015] The present invention also provides a method for marker-assisted selection of yak immune traits for non-diagnostic purposes, comprising the following steps:

[0016] (1) Extract yak genomic DNA;

[0017] (2) Using the yak genomic DNA obtained in step (1) as a template, amplify with the primer pair to obtain an amplification product;

[0018] (3) Perform genotype analysis on the amplification product to obtain yaks with different genotypes; correlate the genotypes of yaks with immune indicators; the immunoglobulins are immunoglobulin A and immunoglobulin M.

[0019] Preferably, the amplification system in step (2) is: 2×L-Exp Taq MasterMix 12.5 μL, RNasefree water 8.5 μL, upstream primer 1 μL, downstream primer 1 μL, and template 2 μL.

[0020] Preferably, the amplification program in step (2) is: 98°C for 2 min, 98°C for 10 s, 58.0°C for 30 s, 72°C for 10 s, for a total of 35 cycles; extension at 72°C for 2 min.

[0021] Compared with the prior art, the present invention has the following beneficial effects:

[0022] The present invention provides the cloning and application of SNP molecular markers related to yak immunoglobulins. Through research, the present invention finds that the SNP locus related to yak immunity is located at the 43,165,308th base on chromosome 21 of the yak reference genome LU_Bosgru_v3.0 version, the mutation type is C / T, and there are 3 genotypes. When the 43,165,308th base on chromosome 21 is C, the genotype is CC or CT; when the 43,165,308th base on chromosome 21 is T, the genotype is TT; through the correlation analysis of different genotypes with the contents of immunoglobulin A, immunoglobulin G, and immunoglobulin M, it is found that the content of immunoglobulin M in yak individuals with genotypes CC and CT is significantly higher than that of immunoglobulin M in yak individuals with genotype TT (p<0.05), and the content of immunoglobulin A in yak individuals with genotype CC is significantly higher than that of immunoglobulin A in yak individuals with genotype TT (p<0.05). There is no significant difference in immunoglobulin G among CT genotype individuals (p>0.05).

[0023] By detecting the bases at the 43,165,308th nucleotide site on chromosome 21 of the yak, the present invention can judge the immunoglobulin content of yak individuals. The present invention provides a new SNP molecular marker resource for marker-assisted selection of yak immune traits for non-diagnostic purposes. It provides a basis for breeding yaks with high immunity. Description of the Drawings

[0024] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the drawings in the following description are only the embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained according to the provided drawings without creative efforts.

[0025] Figure 1 Is the PCR amplification product: where M represents Marker; 1 and 2 represent the product bands.

[0026] Figure 2 Is the peak map and sequence obtained after sequencing the PCR product. Detailed Embodiments

[0027] The technical solutions provided by the present invention will be described in detail below in conjunction with embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0028] Example 1

[0029] 1 Sample collection

[0030] In the present invention, female Yaks are used as the detection object. 5 mL of fasting Yak blood samples were collected from the pasture in Jiali County, Nagqu City, Tibet Autonomous Region, and placed in clean coagulant-promoting vacuum blood collection tubes. After standing for 30 minutes, they were centrifuged at 3500 r / min for 10 minutes. The supernatant was aspirated into a PE tube, sealed, and stored in a -20 °C low-temperature refrigerator. Another 5 mL of blood sample was added to a blood collection tube containing EDTA-K2 anticoagulant. After the blood sample was collected, it was quickly mixed evenly, placed in a sampling box containing ice packs for temporary storage, and stored frozen in a -20 °C refrigerator after being transported back to the laboratory for genomic DNA extraction.

[0031] 2 Main reagents and instruments

[0032] EDTA-K2 vacuum blood collection tubes were purchased from Jiangsu Yuli Medical Instrument Co., Ltd.; Blood genomic DNA extraction kits were purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; NanoDrop 2000 spectrophotometers were from Thermo Fisher Scientific Company, USA; DL2000 Marker, agarose, and nucleic acid dyes were all purchased from Beijing Solarbio Science & Technology Co., Ltd.; 2×L-Exp Taq MasterMix (dye plus) was purchased from Hunan Aikery Bioengineering Co., Ltd.; Electrophoresis apparatuses were purchased from Beijing Liuyi Instrument Factory; PCR apparatuses were purchased from BioRad Company. IgA (MB-4907A), IgG (MB-4616A), and IgM (MB-4908A) detection kits were purchased from Jiangsu Enzyme-linked Immunosorbent Assay Biotechnology Co., Ltd.

[0033] 3 Method

[0034] 3.1 Detection of immunoglobulins IgA, IgG, and IgM

[0035] According to the IgA, IgG, and IgM detection kits of Jiangsu Enzyme Biotechnology Co., Ltd., the double antibody one-step sandwich method was used for determination. First, the required strips were taken out from the aluminum foil bag after equilibration at room temperature for 20 minutes, and the remaining strips were sealed with a self-sealing bag and returned to 4°C. Set up standard wells and sample wells, and add 50μL of different concentrations of standard wells to each standard well; first add 10μL of the sample to be tested to the sample well, and then add 40μL of sample diluent; blank wells are not added. In addition to the blank wells, 100μL of horseradish peroxidase (HRP)-labeled detection antibody is added to each well of the standard well and sample well, and the reaction wells are sealed with a sealing film, and incubated at 37°C water bath or constant temperature box for 60min. Discard the liquid, pat dry on absorbent paper, fill each well with washing solution, let stand for 1min, shake off the washing solution, pat dry on absorbent paper, and repeat the washing 5 times (you can also use a plate washer to wash the plate). Add 50μL of substrate A and B to each well and incubate at 37°C in the dark for 15min. Add 50 μL of stop solution to each well, and measure the OD value of each well at a wavelength of 450 nm within 15 minutes. Finally, draw a standard curve: in an Excel worksheet, use the concentration of the standard as the horizontal axis and the corresponding OD value as the vertical axis to draw a linear regression curve of the standard, and calculate the IgA, IgG, and IgM concentration values ​​of each sample according to the curve equation.

[0036] 3.2 Extraction of genomic DNA from blood

[0037] The blood genome extraction kit of Tiangen Biochemical Technology (Beijing) Co., Ltd. was used to extract genomic DNA from the blood samples. The extracted DNA was placed under an ultraviolet spectrophotometer to detect the concentration and purity. The concentration was >20ng / μL and OD 260 / OD 280 A value between 1.7 and 1.9 meets the experimental requirements and can be stored at -20°C for future use.

[0038] 3.3 Primer design

[0039] Referring to the chromosome 21 sequence of the yak genome LU_Bosgru_v3.0 version, the Primers online tool provided by the NCBI website was used to design specific primers, including the g43165308C>TSNP site.

[0040] Primer sequences

[0041] F: TGATGAGAGACCTCACA (SEQ ID NO: 1);

[0042] R: AGCATTCCTGACTTCTTCTT (SEQ ID NO: 2).

[0043] The length of the amplified fragment was 501 bp, and the primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0044] 3.4 PCR Amplification and Sequencing

[0045] The PCR amplification system was 25 μL: 12.5 μL of 2×L-Exp Taq MasterMix (dye plus), 8.5 μL of RNase free water, 1 μL of forward primer, 1 μL of reverse primer, and 2 μL of template.

[0046] The PCR amplification program was: 98°C for 2 min, 98°C for 10 s, 58.0°C for 30 s, 72°C for 10 s, for a total of 35 cycles; 72°C for extension for 2 min.

[0047] The PCR products were detected by 1% agarose gel electrophoresis. After the PCR products were qualified by agarose gel electrophoresis, direct sequencing was used for sequencing, which was completed by Beijing Qingke Biotechnology Co., Ltd. The results of agarose gel electrophoresis are as Figure 1 shown. Figure 1 shown that the length of the sequence amplified by PCR was 501 bp. Through sequencing, it was found that a C / T mutation occurred at the 501st nucleotide sequence of the amplification product (at the 43,165,308th base on chromosome 21 of the genome LU_Bosgru_v3.0 version). The amplification product band was clear without miscellaneous bands and had good specificity. This site was preliminarily identified as a SNP marker site of yaks and named g43165308C>T SNP. The sequence amplified by PCR was as shown in SEQ ID NO: 3, and the 388th position of this sequence was a C mutation. The fragment size of the PCR amplification product was consistent with the expected size, and the next experiment could be carried out.

[0048] SEQ ID NO: 3

[0049] TGATGACGAGACCTCACAACGTGGCTGTTTCTTTCACAGCAGAGAAGACGTATCAGGAATGAAATGGGATTTTAAGATGATTGTACCCGATAAGTAAGAGTGAGTACCTGATTTCAAAGCAGCTGTCACATGACCCGACCCCTCCATGCCCCCATGCCATTCAGTCACCTGTCAGGCAGCATGAGCTAAGCAGGCGGGGGCCAGAAACCGCTGCCTCTTTTGCTTCTCCCACTTTCCAGGGTTCTGATATACCCCTCTTCCTTCCCTCTGTCCCTCCCTTCTTTCCTTCAGATACCTTGCTAACCCTATGGTACAGGCATATATTCACTATTGTAAGGTATACAAAACTACCTTTCTCAGACAGATTTAGCCCCACCACCGTCTTCC C CCATCCATTGGAGCACACCCCTCACCTGAGTCTTCTACTGCAGTCTTTGAAGTTGCCAGTTTCACAAAAAGCTGTGAGGACCAGAAAAAAAACAAGAAGAAGTCAGGAATGCT

[0050] The sequencing results of PCR products were aligned using the bioinformatics software MEGA 11.0, and the sequencing peak maps were analyzed to complete genotyping.

[0051] 4 Statistical analysis

[0052] According to the gene typing results, the number of individuals with different genotypes at each locus was counted. The gene frequency, genotype frequency, effective number of alleles (Ne), locus heterozygosity (He), and Hardy-Weinberg equilibrium test of the g43165308C>T gene were calculated using the Popgen32 software, and the polymorphic information content was calculated using the PIC (polymorphism information content) calculation software. The general linear model in the IBM SPSS Statistics 26 software was used to analyze the association between different genotypes of yaks and immunoglobulins IgA, IgG, and IgM, and the results were expressed as "mean ± standard error".

[0053] 5 Results

[0054] 5.1 PCR amplification and sequencing results

[0055] The amplification products of the g43165308C>T SNP locus on chromosome 21 of yaks were detected using 1% agarose gel (see Figure 1 ). The bands were clear without background bands, indicating good specificity. The size of the PCR product fragment was 501bp, which was consistent with the expected size, and the next experiment could be carried out.

[0056] The peak maps and sequences obtained after purification and sequencing of the PCR products are shown in Figure 2 . As can be seen from Figure 2 , a C-T mutation occurred at the g43165308C>T SNP locus, and there were three genotypes: CC, CT, and TT.

[0057] 5.2 Statistical analysis results

[0058] The genotypes and allele frequencies of the g.43165308C>T SNP locus on chromosome 21 of yaks were analyzed from the perspective of population genetics. As shown in Table 1, at the g.43165308C>T SNP locus, the frequency of the C allele was 72%, showing a dominant allele. The χ 2 goodness-of-fit test showed that the SNP locus was in Hardy-Weinberg equilibrium (P>0.05) (Table 1). The expected heterozygosity of this locus was 0.41, and the PIC was 0.32. Since 0.25<PIC<0.50, it belonged to moderate polymorphism.

[0059] Table 1 Polymorphism of the g43165308A>G SNP locus on chromosome 21 of yaks

[0060]

[0061] 5.3 Correlation analysis between different genotypes and immunoglobulins IgA, IgG, and IgM. The general linear model in IBM SPSS Statistics 26 software was used to analyze the correlation between different genotypes of yaks and the contents of immunoglobulins IgA, IgG, and IgM. The results showed that the content of immunoglobulin M in yak individuals with genotypes CC and CT was significantly higher than that in yak individuals with genotype TT (p<0.05). The content of immunoglobulin A in yak individuals with genotype CC was significantly higher than that in yak individuals with genotype TT (p<0.05). There was no significant difference in immunoglobulin G among CT genotype individuals (p>0.05). The results are shown in Table 2.

[0062] Table 2 Correlation analysis between different genotypes and immunoglobulins IgA, IgG, and IgM

[0063]

[0064] Note: Different lowercase letters as superscripts for the same row of data indicate significant differences (P<0.05).

[0065] As shown in Table 2, the content of immunoglobulin M in yak individuals with genotypes CC and CT was significantly higher than that in yak individuals with genotype TT (p<0.05), and the content of immunoglobulin A in yak individuals with genotype CC was significantly higher than that in yak individuals with genotype TT (p<0.05). It shows that the base at the g43165308C>TSNP locus on chromosome 21 of yak is significantly correlated with yak IgA and IgM (p<0.05), and it is an SNP marker related to yak IgA and IgM.

[0066] The SNP molecular marker described in the present invention is located at the 43,165,308th base on chromosome 21 of the reference yak genome version LU_Bosgru_v3.0; the mutation type is C / T, named g43165308C>T, and there are three genotypes. When the 43,165,308th base on chromosome 21 is C, the genotype is CC or CT; when the 43,165,308th base on chromosome 21 is T, the genotype is TT; through the association analysis of different genotypes with the contents of IgA, IgG, and IgM, it is found that the content of immunoglobulin M in yak individuals with genotypes CC and CT is significantly higher than that in yak individuals with genotype TT (p<0.05), and the content of immunoglobulin A in yak individuals with genotype CC is significantly higher than that in yak individuals with genotype TT (p<0.05). By detecting the base at the 43,165,308th nucleotide locus on chromosome 21 of yak, the contents of IgA and IgM in yak individuals can be judged. The present invention provides a new SNP molecular marker resource for marker-assisted selection of yak immune traits for non-diagnostic purposes.

[0067] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and modifications can be made, and these improvements and modifications should also be regarded as the protection scope of the present invention.

Claims

1. A SNP molecular marker affecting yak immunoglobulin A and immunoglobulin M, characterized in that, The SNP molecular marker is located at the 43,165,308th base on chromosome 21 of the yak reference genome LU_Bosgru_v3.0 version, and the mutated base is C or T.

2. The SNP molecular marker according to claim 1, characterized in that, The genotypes of yaks with the mutated base C are CC or CT; the genotypes of yaks with the mutated base T are TT; The content of immunoglobulin M in yak individuals with genotypes CC and CT is significantly higher than that in yak individuals with genotype TT, and the content of immunoglobulin A in yak individuals with genotype CC is significantly higher than that in yak individuals with genotype TT.

3. The application of the SNP molecular marker according to claim 1 or 2 in the preparation of products for detecting yak immunity or products for yak assisted breeding.

4. A primer pair for amplifying the SNP molecular marker according to claim 1 or 2, characterized in that, The sequences of the primer pair are as shown in SEQ ID NO: 1 to 2.

5. The application of the primer pair according to claim 4 in the preparation of products for detecting yak immunity or products for yak assisted breeding.

6. A kit for detecting the immunity of yaks, characterized in that, It includes reagents for detecting the SNP molecular marker according to claim 1 or 2 or the primer pair according to claim 4.

7. A kit for yak assisted breeding, characterized in that, It contains reagents for detecting the SNP molecular marker according to claim 1 or 2 or the primer pair according to claim 4.

8. A method for marker-assisted selection of yak immune traits for non-diagnostic purposes, characterized in that, It includes the following steps: (1) Extract yak genomic DNA; (2) Using the yak genomic DNA obtained in step (1) as a template, amplify with the primer pair according to claim 4 to obtain an amplification product; (3) Perform genotype analysis on the amplification product to obtain yaks with different genotypes; associate the genotypes of yaks with immune indicators; the immunoglobulins are immunoglobulin A and immunoglobulin M.

9. The method according to claim 8, wherein The amplification system in step (2) is: 2×L-Exp TaqMasterMix 12.5 μL, RNase free water 8.5 μL, upstream primer 1 μL, downstream primer 1 μL, and template 2 μL.

10. The method according to claim 8, wherein The amplification program in step (2) is: 98°C for 2 min, 98°C for 10 s, 58.0°C for 30 s, 72°C for 10 s, a total of 35 cycles; extension at 72°C for 2 min.

Images