System for on-demand regulation and control of cell behaviors based on subject-object recognition space reversible rearrangement cell receptors and application thereof

Abstract

The invention provides a system for on-demand regulation and control of cell behaviors based on subject-object recognition of spatial reversible rearrangement cell receptors and application of the system. The system comprises a beta-cyclodextrin polymer, a ferrocene-labeled Met binding nucleic acid aptamer and adamantane. Linear beta-cyclodextrin polymers and cross-linked beta-cyclodextrin polymers are used in the system of the invention. The two beta-cyclodextrin polymers have different regulation and control effects on cell receptors, and a system formed by the linear beta-cyclodextrin polymers can sensitively rearrange the Met receptors, so that HGF-induced Met receptor activation is obviously inhibited, related signal channels are blocked, and cell behaviors are indirectly regulated. A system formed by the cross-linked beta-cyclodextrin polymer can activate a cell receptor and directly regulate cell behaviors. The system disclosed by the invention can be applied to preparation of a detection kit for cell analysis and preparation of a medicine for cell regulation and control so as to regulate the phosphorylation level, cell proliferation and cell migration behaviors of the Met receptor as required.

Description

Technical Field

[0001] The present invention belongs to the field of bioengineering technology, and in particular relates to a system for regulating cell behavior on demand based on spatial reversible rearrangement of cell receptors in host-guest recognition and its application. Background Art

[0002] Receptor tyrosine kinases (RTKs) are a class of cell membrane receptors that are closely related to cell signaling and function. Many cell behaviors in physiological and pathological processes, such as cell proliferation, differentiation, apoptosis, metabolism, and migration, are regulated by RTK receptors. In general, the oligomerization of cell receptors and their spatial arrangement play a crucial role in activating and inhibiting the downstream signaling cascades of cells.

[0003] Activation of RTK receptors can promote the development of regenerative therapies, while inhibition of RTK receptors can promote the development of targeted cancer therapies. Therefore, it is of great significance to artificially manipulate RTK receptor oligomerization or receptor rearrangement to control cell behavior in a customized manner. At present, some cell regulation strategies based on light control, chain displacement, pH response, etc. have also been developed. These strategies achieve reversible and controllable regulation of cell migration and other behaviors by regulating the oligomerization or spatial arrangement of cell receptors. However, in general, related research is far from enough, and it is still necessary to further develop user-defined non-genetic strategies in bioengineering to controllably and reversibly manipulate cell behavior. Summary of the invention

[0004] The technical problem to be solved by the present invention is to overcome the deficiencies in the prior art and provide a universal and simple controllable and reversible regulation method for cell receptors (S-CDP-Ad). The most typical RTK receptor family member, the mesenchymal epidermal transformation factor (Met) receptor, is selected as the research object. This method is based on β-cyclodextrin polymers (β-CDPs) host-guest recognition and biomolecule ligand-receptor interaction to reversibly manipulate the arrangement of cell membrane surface receptors to achieve on-demand regulation of cell proliferation, migration and other behaviors, providing methods and references for developing user-defined non-genetic strategies to manipulate cell behaviors.

[0005] In order to solve the above technical problems, the present invention provides a system for regulating cell behavior based on host-guest recognition spatially reversible rearrangement of cell receptors, the system comprising: a β-cyclodextrin polymer, a Met-binding nucleic acid aptamer (SL1-Fc) labeled with ferrocene, and the gene sequence of the Met-binding nucleic acid aptamer is shown in SEQ ID NO.1.

[0006] In the above system, further, the β-cyclodextrin polymer is a linear β-cyclodextrin polymer (L-β-CDP), and the system also includes HGF.

[0007] In the above system, further, the β-cyclodextrin polymer is a cross-linked β-cyclodextrin polymer (C-β-CDP).

[0008] The above system further includes adamantane.

[0009] In the above system, further, the concentration of the β-cyclodextrin polymer is 100 μM to 500 μM, the concentration of the SL1-Fc is 50 nM to 200 nM; and the concentration of the adamantane is 0.1 mM to 1.0 mM.

[0010] Based on a general technical concept, the present invention also provides the application of the system in the preparation of a detection kit for cell analysis. The application method is: analyzing the upstream binding of SL1-Fc / β-CDPs to cells by flow cytometry and confocal imaging, and analyzing the regulation of the proposed S-CDP-Ad strategy in cell behavior by Western blot technology, cell scratch experiment, CCK-8 test, etc.

[0011] Based on a general technical concept, the present invention also provides the use of the system in the preparation of drugs for cell regulation. The application method is to regulate the behavior of cells by rearranging or oligomerizing cell receptors, and further, to achieve reversible regulation of cell receptors through the selective competition of β-cyclodextrin polymers to customize cell functions as needed.

[0012] Compared with the prior art, the advantages of the present invention are:

[0013] (1) The present invention provides a system (SL-CDP) for indirectly regulating cell behavior by spatially rearranging cell receptors based on host-guest recognition, wherein the β-cyclodextrin polymer is L-β-CDP, which programs the cell receptors to achieve on-demand regulation of cell behavior. SL-CDP can sensitively rearrange Met receptors to significantly inhibit HGF-induced Met receptor activation, block related signaling pathways, and indirectly regulate cell behavior. Furthermore, a SL-CDP-Ad strategy of adding adamantane (Ada) to the system, Ada dissociates the SL1-Fc / L-β-CDP complex on the cell surface through competition, causing the Met receptor to de-rearrange, so that SL-CDP-Ad can reversibly rearrange cell receptors to customize cell behavior on demand.

[0014] (2) The present invention provides a system (SC-CDP) for directly regulating cell behavior based on spatial rearrangement of cell receptors through host-guest recognition, wherein the β-cyclodextrin polymer is C-β-CDP, and SC-CDP exhibits functions similar to HGF and can directly activate Met receptor behavior. Furthermore, a SC-CDP-Ad strategy of adding adamantane (Ada) to the system is adopted. After the addition of Ada, Ada competes for the binding of SL1-Fc to C-β-CDP, thereby causing the cell membrane receptors to rearrange. Therefore, by alternately adding C-β-CDP and Ada to the system, reversible regulation of cell behavior can be achieved.

[0015] (3) The present invention provides a system for regulating cell behavior on demand based on spatial reversible rearrangement of cell receptors by host-guest recognition, and its application in the preparation of a detection kit for cell analysis. Compared with most existing technologies that can only regulate cell behavior in one direction, the S-CDP-Ad here provides a new strategy for reversibly activating or inhibiting cell receptors based on the selective host-guest recognition effect of β-cyclodextrin polymers, so as to regulate the phosphorylation level of Met receptor, cell proliferation and cell migration behavior on demand.

[0016] (4) The present invention provides a system for regulating cell behavior on demand based on spatial reversible rearrangement of cell receptors by host-guest recognition, and its application in the preparation of drugs for cell regulation. Compared with most existing technologies that can only regulate cell behavior in one direction, the S-CDP-Ad here provides a new strategy for reversibly activating or inhibiting cell receptors based on the selective host-guest recognition effect of β-cyclodextrin polymers, so as to regulate the phosphorylation level of Met receptor, cell proliferation and cell migration behavior on demand. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to make the purpose, technical solution and advantages of the embodiments of the present invention more clear, the technical solution in the embodiments of the present invention will be clearly and completely described below in conjunction with the accompanying drawings in the embodiments of the present invention.

[0018] Figure 1 Schematic diagram of β-cyclodextrin polymers (β-CDPs) with different structures in the present invention dynamically and reversibly regulating cell behavior by spatially reprogramming membrane receptor organization through the S-CDP-Ad strategy.

[0019] Figure 2 This is the result of investigating the average molecular weights of L-β-CDP and C-β-CDP in Experiment 1 of the present invention.

[0020] Figure 3 This is the investigation result of the hydrated particle size of L-β-CDP and C-β-CDP in Experiment 1 of the present invention.

[0021] Figure 4This is the flow cytometry result of Met protein expression on the surface of different cells in Experiment 2 of the present invention.

[0022] Figure 5 This is the result of Western blotting experiment on the expression of Met protein on the surface of different cells in Experiment 2 of the present invention.

[0023] Figure 6 This is the characterization result of the co-localization of SL1-Fc and L-β-CDP on the surface of A549 and HCT116 cells in Experiment 3 of the present invention.

[0024] Figure 7 This is the effect of SL-CDP on Met autophosphorylation in Experiment 4 of the present invention.

[0025] Figure 8 Schematic diagram of the SL-CDP strategy in Example 2 for spatially reprogramming membrane receptor organization to indirectly regulate cell behavior.

[0026] Fig. 9 This is the phosphorylation level of Met receptor in A549 cells under different treatments in Experiment 4 of the present invention.

[0027] Fig.10 This is the phosphorylation level of Met receptor in HCT116 cells under different treatments in Experiment 4 of the present invention.

[0028] Fig.11 This is the analysis result of the relative viability value of each group of cells under different treatments in Experiment 5 of the present invention.

[0029] Fig.12 This is the result of SL-CDP indirectly regulating the wound healing activity of A549 cells in Experiment 6 of the present invention.

[0030] Fig.13 This is the result of SL-CDP indirectly regulating the wound healing activity of SH-SY5Y cells in Experiment 6 of the present invention.

[0031] Fig.14 This is the result of SL-CDP indirectly regulating the wound healing activity of HCT116 cells in Experiment 6 of the present invention.

[0032] Fig.15 This is a schematic diagram of the reversible regulatory effect of the SL-CDP-Ad strategy on cell behavior in Example 3 of the present invention.

[0033] Fig.16 This is a diagram showing the analysis results of adamantane competing for the binding of SL1-Fc to L-β-CDP in Experiment 7 of the present invention.

[0034] Fig.17This is the result of Western blotting experiment on the regulation of A549 cell receptor by SL-CDP-Ad strategy in Experiment 8 of the present invention.

[0035] Fig.18 These are the results of Western blotting experiments on the regulation of HCT116 cell receptors by the SL-CDP-Ad strategy in Experiment 8 of the present invention.

[0036] Fig.19 These are the results of an investigation into the indirect dynamic and reversible regulation of Met signal-mediated migration behavior of A549 and SH-SY5Y cells by SL-CDP in Experiment 9 of the present invention.

[0037] Fig. 20 This is the result of investigating the indirect dynamic and reversible regulation of Met signal-mediated HCT116 cell migration behavior by SL-CDP in Experiment 9 of the present invention.

[0038] Fig.21 This is a schematic diagram of the principle of C-β-CDP regulating cell behavior in Example 4.

[0039] Fig. 22 This is the characterization result of the co-localization of SL1-Fc and C-β-CDP on the surface of A549 cells in Experiment 10 of the present invention.

[0040] Fig.23 This is the characterization result of SC-CDP promoting the aggregation of Met receptors on the surface of A549 cells in Experiment 11 of the present invention.

[0041] Fig.24 This is the result of the Western blot experiment in Experiment 12 of the present invention to detect the direct regulatory effect of SC-CDP on p-Met expression.

[0042] Fig.25 This is the CCK-8 detection result of SC-CDP regulating A549 cell proliferation in Experiment 13 of the present invention.

[0043] Fig.26 C-β-CDP was used in the SC-CDP-Ad strategy to investigate the principle of the reversibility of the process.

[0044] Fig. 27 This is a diagram showing the analysis results of Ada competing for the binding of SL1-Fc to C-β-CDP in Experiment 14 of the present invention.

[0045] Fig.28 This is the result of Western blotting experiment on the regulation of A549 cell receptors by the SC-CDP-Ad strategy in Experiment 15 of the present invention.

[0046] Fig.29These are the migration rate investigation results of A549 and SH-SY5Y cells treated with different components in Experiment 16 of the present invention. DETAILED DESCRIPTION

[0047] The present invention is further described below in conjunction with specific preferred embodiments, but the protection scope of the present invention is not limited thereby.

[0048] The materials, reagents and instruments used in the following examples can all be purchased from commercial channels. The experimental methods in the following examples are all conventional methods in the art unless otherwise specified. The unit mM is mmol / L, and the unit μM is μmol / L.

[0049] All oligonucleotides were synthesized and purified by Sangon Biotechnology Co., Ltd. (Shanghai, China). Cyclodextrin monomers were purchased from J&K Technology Co., Ltd. Cross-linked β-cyclodextrin polymer (C-β-CDP) and adamantane (Ada) were purchased from Aladdin Biochemical Technology Co., Ltd. (Shanghai, China). FITC-adamantane was purchased from Ruixi Biotechnology Co., Ltd. (Xi'an, China). Nuclear dye Hoechst and dialysis membrane (8kD) were purchased from Sangon Biotechnology Co., Ltd. (Shanghai, China). Recombinant human HGF was purchased from Novoprotein (China). Crizotinib was purchased from MedChemExpress (MCE). Cell Counting Kit-8 (CCK-8) was purchased from APExBIO (USA). Met primary antibody and GAPDH primary antibody were purchased from Proteintech (Wuhan, China). Phosphorylated Met (p-Met) primary antibody was purchased from ABclonal Technology (Wuhan, China). Secondary antibody (goat anti-rabbit IgG (H&L)-HRP) was purchased from Abiowell (Changsha, China). RIPA lysis buffer, BCA protein assay kit, phosphatase inhibitor cocktail, phenylmethylsulfonyl fluoride (PMSF), antibody diluent, and SDS-PAGE loading buffer were purchased from Biotech (Jiangsu, China). Enhanced 3-color regular range protein (Marker) was purchased from SMOBIO (Beijing, China). 0.45 μm PVDF membrane was purchased from Millipore, and ECL substrate solution was purchased from Meilunbio (Dalian, China).

[0050] The sequence of oligonucleotide SL1 (from 5' to 3'): ATCAGGCTGGATGGTAGCTCGGTCGGGGTGGGTGGGTTGGCAAG TCTGAT.

[0051] Example 1

[0052] A β-cyclodextrin polymer (β-CDPs) of the present invention is L-β-CDP or C-β-CDP.

[0053] L-β-CDP and C-β-CDP are two β-cyclodextrin polymers with the same average molecular weight but different spatial structures, where L-β-CDP is a linear β-cyclodextrin polymer and C-β-CDP is a cross-linked network β-cyclodextrin polymer. β-CDPs further bind to the Met receptor through host-guest recognition with the Fc group labeled on SL1 to reconstitute the Met receptor. Different configurations of L-β-CDP or C-β-CDP can achieve different spatial programming of the Met receptor, thereby regulating Met receptor-related cellular behaviors differently.

[0054] Two different configurations of β-CDPs, L-β-CDP and C-β-CDP, were used in the strategy proposed in this invention (S-CDP-Ad), which reversibly programmed cell receptors differently and achieved on-demand regulation of cell behavior. SL-CDP can sensitively rearrange Met receptors to significantly inhibit HGF-induced Met receptor activation, block related signaling pathways, and indirectly regulate cell behavior. SC-CDP exhibits similar functions to HGF and can directly activate Met receptor behavior. Both types of regulation can be reversibly regulated by simple competitive reactions. L-β-CDP was synthesized according to the reference, and C-β-CDP was purchased from Aladdin Reagents (Shanghai) Co., Ltd.

[0055] Figure 1 Figure 1 is a schematic diagram of β-cyclodextrin polymers (β-CDPs) with different structures dynamically and reversibly regulating cell behavior through the S-CDP-Ad strategy to spatially reprogram membrane receptor organization. The S-CDP-Ad strategy mainly includes three steps. Figure 1 As shown, first, the ferrocene (Fc)-modified Met-binding aptamer (SL1-Fc) binds to the Met receptor on the cell surface. Then L-β-CDP or C-β-CDP reconstitutes the Met receptor through host-guest recognition with SL1-Fc. Finally, given that adamantane (Ada) and β-CDPs have stronger host-guest recognition ability, it can compete with Fc-SL1 to preferentially bind to β-CDPs, causing the cell membrane receptor to rearrange, thereby reversibly regulating cell behavior on demand.

[0056] Experiment 1: Investigate the characterization of molecular weight and particle size of β-CDPs.

[0057] Given the importance of the spatial arrangement of cell receptors in cell function, controlling the nanoscale arrangement of ligands to regulate the spatial distribution of cell receptors is a key step. Two β-CDPs with different structures (L-β-CDP and C-β-CDP) are used here to regulate the function of Met receptors. Both L-β-CDP and C-β-CDP are made by cross-linking β-cyclodextrin (β-CD) monomers with epichlorohydrin, but the difference is that L-β-CDP is embedded in the hydrophobic chamber of β-CD with toluene before cross-linking so that the obtained cyclodextrin polymer is linear, while C-β-CDP is directly obtained by cross-linking β-CD monomers with epichlorohydrin, showing a cross-linked network. The molecular weight and particle size of the two β-CDPs were characterized.

[0058] Figure 2 The average molecular weight of L-β-CDP and C-β-CDP is 9.65Kd and 9.18Kd, respectively, indicating that the number of cyclodextrin monomers in the two cyclodextrin polymers is about 8.

[0059] Figure 3 The results of the investigation of the hydrated particle size of L-β-CDP and C-β-CDP. As can be seen from the figure: the hydrated particle sizes of L-β-CDP and C-β-CDP are 13.68±0.65nm and 4.61±0.52nm, respectively. It can be seen that although the two β-CDPs contain similar amounts of cyclodextrin monomers, the particle sizes are significantly different. This may be due to the different structures of the two β-CDPs, which also indicates that the arrangement and density of cyclodextrin monomers in the two β-CDPs are different.

[0060] Example 2

[0061] A system (SL-CDP) for regulating cell behavior based on L-β-CDP host-guest recognition and spatial rearrangement of cell receptors, including SL1-Fc, L-β-CDP and HGF.

[0062] SL1-Fc targets the Met receptor on the cell membrane, and forms a SL1-Fc / L-β-CDP complex through host-guest recognition of SL1-Fc by linear β-cyclodextrin polymer (L-β-CDP), spatially rearranges the Met receptor, and thus significantly inhibits HGF-induced Met receptor activation, blocks related signaling pathways, and indirectly regulates cell behavior.

[0063] SL1-Fc is a Met-binding nucleic acid aptamer labeled with ferrocene (Fc), and its DNA sequence (from 5' to 3') is specifically shown in SEQ ID NO.1:

[0064] 5'-ATCAGGCTGGATGGTAGCTCGGTCGGGGTGGGTGGGTTGGCAAGTCTGAT-3'.

[0065] Experiment 2: Investigate the characterization of Met protein expression levels on the surface of different cells.

[0066] All cells were cultured in an incubator at 37°C with 5% CO2. A549 cells, L02 cells, and HCT116 cells were cultured in RPMI1640 medium supplemented with 10% fetal bovine serum and 1% penicillin and streptomycin. SH-SY5Y cells were cultured in DMEM medium supplemented with 10% fetal bovine serum and 1% penicillin and streptomycin. In order to characterize the expression of Met receptors on the surface of different cells, flow cytometry was used to analyze the binding of Met binding aptamer FAM-SL1 to different cells. 100nM FAM-SL1 was incubated with A549 cells, HCT116 cells, L02 cells, and SH-SY5Y cells at 4°C for 20min. After washing three times with 10mM PBS buffer, the cells were counted by flow cytometry for 10 4 The data were processed using FlowJo software.

[0067] Figure 4 The flow cytometry results of Met protein expression on the surface of different cells. It can be seen from the figure that A549 cells have the highest expression of Met receptor, followed by HCT116 cells and L02 cells, and SH-SY5Y is a Met negative cell.

[0068] Figure 5 The results of Western blot experiments further characterized the expression of Met receptors on the surfaces of four types of cells. As can be seen from the figure: the results of Western blot experiments are the same as those of flow cytometry.

[0069] Experiment 3: Investigate the co-localization of SL1-Fc / L-β-CDP on the cell surface.

[0070] Targeting cell surface Met receptors with SL1-Fc and L-β-CDP is the first step to change the arrangement of Met receptors to customize cell functions. To test the biorecognition of SL1-Fc / Met receptors and the host-guest interaction of L-β-CDP / SL1-Fc, the colocalization of SL1-Fc and L-β-CDP on the cell surface was successfully performed using confocal fluorescence imaging. Cy5-labeled SL1-Fc (Cy5-SL1-Fc) and FITC-labeled L-β-CDP (FITC-L-β-CDP) were used for confocal imaging, and Hoechst dye was used to stain the cell nucleus. A549 or HCT116 cells were seeded in 35 mm confocal culture dishes and cultured overnight. They were stained with Hoechst at 37°C for 15 min. Then, the cells were treated with Cy5-SL1-Fc for 20 min at 4°C, followed by incubation with FITC-L-β-CDP for 40 min, and washed three times before confocal imaging analysis. All images were recorded using a 100× oil objective.

[0071] Figure 6 The results of the colocalization of SL1-Fc and L-β-CDP on the surface of A549 and HCT116 cells are shown in Figure 1. As can be seen from the figure, there is an obvious colocalization signal between the Cy5 and FITC channels, and it is mainly concentrated on the cell membrane. This shows that Cy5-SL1-Fc and FITC-L-β-CDP are successfully anchored on the surface of Met-positive A549 and HCT116 cells through biorecognition and host-guest interaction.

[0072] Experiment 4: Western blot was used to investigate the regulatory effect of SL-CDP on Met receptor.

[0073] The successful assembly of SL1-Fc and L-β-CDP on the cell surface has been demonstrated above; however, the visualization technology for changes in the spatial organization of the receptor is limited. Therefore, the regulatory effect of the proposed strategy on the Met receptor was subsequently confirmed by evaluating changes in downstream signals of the Met receptor.

[0074] Western blot experiments were performed to study the effect of SL-CDP on Met autophosphorylation. Cells treated with different formulations were collected:

[0075] Control group: A549 cells without any treatment.

[0076] SL1+L-β-CDP group: A549 cells treated with SL1-Fc and L-β-CDP.

[0077] Lysis was performed in RIPA lysis buffer containing protease inhibitors and phosphatase inhibitors for 30 min, followed by denaturation at 99 ° C for 5 min. Proteins were separated using 10% denaturing PAGE gel electrophoresis and then transferred to PVDF membranes. After the PVDF membrane was blocked with 5% BSA at room temperature for 1 h. The PVDF membrane containing proteins was incubated in Met, p-Met and GAPDH primary antibodies at 4 ° C overnight, and then incubated with the corresponding secondary antibodies at room temperature for 1 h. Finally, the membrane was exposed by the ECL system and captured by the chemiluminescent gel imaging system. Gray value analysis was performed using Image J software to compare the relative expression content of each protein.

[0078] Figure 7 The effect of SL-CDP on Met autophosphorylation. Figure A is a Western blot of Met signaling proteins in A549 cells after different treatments in the absence of HGF; Figure B is the relative quantification of p-Met and GAPDH in (A).

[0079] As can be seen from the figure: compared with the blank control, the treatment of SL-CDP did not cause obvious Met phosphorylation, indicating that SL-CDP cannot directly activate Met receptors. This may be because the insufficient spacing of SL1 in SL1-Fc / L-β-CDP allows Met receptors to aggregate. Although SL-CDP has no direct regulatory effect on Met receptors, it has the potential to indirectly regulate Met receptor function. The Met signaling pathway is closely related to cell growth, survival and migration cues. After binding to the dimer inducer HGF, the two Met receptors are dimerized, resulting in autophosphorylation and subsequent initiation of downstream signaling cascades in the cell. Interfering with HGF / Met interaction has been shown to be an attractive method to interrupt Met signal transduction. SL-CDP is expected to effectively hinder the binding of HGF to Met by rearranging the Met receptor and occupying the binding site of the Met protein, thereby limiting its dimerization. Figure 8 A schematic diagram of this principle is shown below.

[0080] To support this hypothesis, Western blot experiments were performed to detect the phosphorylation level of Met receptor in A549 cells under different treatments.

[0081] Control group: A549 cells without any treatment.

[0082] HGF-treated group: A549 cells were treated with HGF only.

[0083] HGF+SL1-Fc group: A549 cells were treated with SL1-Fc and HGF.

[0084] HGF+SL1-Fc+CDP group: A549 cells were treated with SL1-Fc, L-β-CDP and HGF.

[0085] Fig. 9 Figure 1 shows the phosphorylation level of Met receptor in A549 cells under different treatments. Figure A is a Western blot image; Figure B is a bar graph of the relative expression level of p-Met.

[0086] The same treatment was performed on Met receptor-positive HCT116 cells. Fig.10 The result diagram is shown in Figure A, which is a Western blot diagram of protein expression in HCT116 cells under different treatments; and Figure B is a bar graph of the relative expression level of p-Met.

[0087] from Fig. 9 and Fig.10 It can be seen that compared with the SL1 aptamer alone treatment group, the expression of HGF-induced p-Met was significantly reduced after SL-CDP treatment, and its inhibitory effect was comparable to that of the small molecule inhibitor crizotinib.

[0088] Experiment 5: Analyze the regulatory effect of SL-CDP on cell viability in the presence of HGF.

[0089] Next, the CCK-8 experiment was used to study the effect of SL-CDP on cell viability in the presence of HGF. The cells were cultured in a 96-well plate for 24 hours. The cells were treated with fresh culture medium solutions (100 μL) of SL1-Fc, 500 μM L-β-CDP and 40 ng / mL HGF at different concentrations (10-200 nM) for 24 hours, 10 μL of CCK-8 was added to each well and incubated for 1 hour, and the light absorption at 450 nm was recorded using an ELISA reader. The data are expressed as relative values ​​compared to the absorbance of the blank control.

[0090] Fig.11 The relative viability analysis results of each group of cells under different treatments. It can be seen from the figure that when the concentration of L-β-CDP is constant, the cell viability gradually decreases with the increase of SL1-Fc concentration, which may be due to the rearrangement of Met receptors by L-β-CDP.

[0091] Experiment 6: Evaluate the indirect regulation of Met signaling-mediated cell migration behavior by SL-CDP.

[0092] A549, HCT116 and SH-SY5Y cells were seeded in 12-well plates, and after the cell density reached 90%, the cells were starved in 0.2% cell culture medium for 24 hours. Subsequently, the cell monolayer was scratched with the tip of a 200 μL pipette to form a wound. Each well was washed three times with 10mM PBS to remove the detached cells. Each group of cells was treated according to different formulas. 100nMSL1-Fc was first incubated on the cell surface for 20 minutes, washed twice with 10mM PBS, L-β-CDP (500uM) was used to treat the cells for 1.0 hours, and then Ada was used to treat the cells for 1.0 hours after washing twice with PBS, and then incubated in HGF for 30 minutes. The wound area was recorded by an inverted microscope at t = 0h, 24h (10x objective). The wound healing rate is related to the cell migration ability. The scratch area was measured by Image J software and calculated according to the following formula:

[0093] Scratch healing rate (%) = (0 hour scratch area - 24 hour scratch area) / 0 hour scratch area × 100%.

[0094] Fig.12 The results of the investigation of SL-CDP indirectly regulating the cell migration behavior mediated by Met signal in A549 cells. A in the figure is the result of the cell wound healing assay after various treatments. B is a bar graph of the relative wound healing rate statistically obtained from Figure (A), and is expressed as mean ± standard deviation.

[0095] The results showed that the wound healing rate of A549 cells incubated with HGF was significantly increased compared with the blank group. SL-CDP treatment significantly reduced HGF-induced cell wound healing. The inhibitory effects of SL1 and L-β-CDP alone on HGF-promoted cell wound healing were negligible, indicating that the operation of SL-CDP can effectively block the HGF / Met signaling activity.

[0096] Fig.13 The results of SL-CDP indirectly regulating the wound healing activity of SH-SY5Y cells. A in the figure is the result of cell wound healing assay after various treatments. B is a bar graph of relative wound healing rates statistically obtained from (A) and expressed as mean ± standard deviation. It can be seen from the figure that the wound healing activity of SH-SY5Y cells is hardly affected by SL-CDP, because its Met expression level is very low.

[0097] Fig.14The results of SL-CDP indirectly regulating the wound healing activity of HCT116 cells. A in the figure is the result of the cell wound healing assay after various treatments. B is a bar graph of the relative wound healing rate statistically obtained from (A) and expressed as mean ± standard deviation. It can be seen from the figure that the wound healing analysis results of HCT116 cells are almost the same as those of A549 cells.

[0098] The above results indicate that L-β-CDP can be anchored on Met with the help of SL1-Fc and rearrange the Met receptor in a certain way, thereby interfering with the interaction between the Met receptor and HGF. Therefore, SL-CDP is a powerful strategy to inhibit tumor metastasis by blocking HGF / Met signaling.

[0099] Example 3

[0100] A system (SL-CDP-Ad) for customizing cell behavior on demand by spatially reversibly rearranging cell receptors based on L-β-CDP host-guest recognition, comprising L-β-CDP, SL1-Fc, adamantane (Ada) and HGF.

[0101] SL1-Fc targets the Met receptor on the cell membrane. β-cyclodextrin polymer (L-β-CDP) recognizes the host and guest of SL1-Fc, forming a SL1-Fc / L-β-CDP complex, which rearranges the Met receptor to affect its downstream cell function. Ada dissociates the SL1-Fc / L-β-CDP complex on the cell surface through competition, causing the Met receptor to rearrange. Therefore, SL-CDP-Ad can reversibly rearrange cell receptors to customize cell behavior on demand.

[0102] Fig.15 The schematic diagram of the reversible regulation of cell receptors by the SL-CDP-Ad strategy. It can be seen from the figure that the SL-CDP-Ad strategy includes three main steps. First, SL1-Fc binds to the cell surface Met receptor through biological recognition. L-β-CDP targets SL1-Fc on the cell surface through host-guest recognition, spatially rearranges the cell surface Met receptor, thereby blocking HGF's activation of the Met receptor. After the addition of Ada, Ada competes for the binding of SL1-Fc to L-β-CDP, thereby causing the cell membrane receptor to rearrange. Therefore, by alternately adding L-β-CDP and Ada to the system, reversible regulation of cell receptors can be achieved.

[0103] SL1-Fc is a Met-binding nucleic acid aptamer labeled with ferrocene, and its DNA sequence (from 5' to 3') is specifically shown in SEQ ID NO.1: ATCAGGCTGGATGGTAGCTCGGTCGGGGTGGGTGGGTTGGCAAG TCTGAT.

[0104] Experiment 7: Investigating the competition between adamantane (Ada) and SL1-Fc for binding to L-β-CDP

[0105] Inspired by the reversible regulation of cell behavior based on DNA strand displacement, the S-CDP-Ad strategy proposed here also attempts to reversibly regulate cell behavior based on a simple competitive reaction. Given that the host-guest recognition between Ada and β-cyclodextrin is stronger than that between Fc, Ada can dissociate the SL1-Fc / L-β-CDP complex through a competitive reaction, achieve spatial de-rearrangement of the Met receptor, and thus reversibly regulate Met receptor-related cell behavior.

[0106] The occurrence of the above competitive reaction was verified by fluorescence method. 600nM SL1-Cy5 was mixed with 1.5mM L-β-CDP, reacted at 25℃ for 3h, and then different concentrations of Ada (0.1-6.0mM) were added and continued to react at 25℃ for 3h. The fluorescence intensity was detected by fluorimeter, with excitation wavelength of 650nm and emission wavelength of 670 to 750nm.

[0107] Fig.16 This is the analysis result of Ada competing for the binding of SL1-Fc and L-β-CDP by fluorescence method. The figure shows that after binding with L-β-CDP, the fluorescence intensity of Cy5-SL1-Fc is significantly enhanced, which is due to the change of the surrounding environment after Fc enters the β-CD cavity. However, as the concentration of Ada in the system increases, the enhanced fluorescence intensity of Cy5-SL1-Fc gradually decreases, and finally returns to the same level as the initial fluorescence intensity of Cy5-SL1-Fc alone. These results show that Ada can replace Fc to occupy the cavity of L-β-CDP to dissociate the SL1-Fc / L-β-CDP complex, so that SL1-Fc is free again in the solution and restores its original fluorescence intensity. The feasibility of the SL-CDP-Ad strategy was preliminarily verified.

[0108] Experiment 8: Western blot was used to investigate the reversible regulation of Met receptor phosphorylation level by SL-CDP-Ad.

[0109] The above results preliminarily confirmed that Ada and L-β-CDP have stronger host-guest recognition ability, and therefore can dissociate the SL1-Fc / L-β-CDP complex through competitive reaction. Next, the ability of the SL-CDP-Ad strategy to work on Met-positive cells was further studied. Met signal transduction-related processes were also used to evaluate the reversible regulatory effect of the SL-CDP-Ad strategy on cell behavior.

[0110] The cells were treated and proteins were extracted in the following ways: (a) control group; (b) SL1-Fc and L-β-CDP treatment; (c) HGF treatment; (d) SL1-Fc, L-β-CDP and HGF treatment; (e) SL1-Fc, L-β-CDP, Ada and HGF treatment; (f) SL1-Fc, L-β-CDP, Ada, L-β-CDP and HGF treatment. The implementation steps were the same as those in Experiment 4.

[0111] Fig.17 The results of Western blotting experiments, Figure A is the Western blotting results of Met signaling protein in A549 cells under different treatment conditions; Figure B is the relative quantification of p-Met and GAPDH in (A).

[0112] As can be seen from the figure: A549 cells incubated with HGF have a higher relative amount of p-Met than untreated cells. After SL-CDP treatment, HGF-promoted p-Met was significantly inhibited. However, after Ada treatment, the effect of SL-CDP can be removed, so HGF can still promote Met receptor phosphorylation, similar to the treatment with HGF alone. In addition, further addition of L-β-CDP after the addition of Ada can inhibit the expression level of p-Met promoted by HGF.

[0113] In addition, to explore the versatility of the SL-CDP-Ad strategy, Western blotting experiments were also performed on HCT116 cells. Fig.18 The results are shown in Figure 1. A is the Western blot result of Met signaling protein in HCT116 cells under different treatment conditions; Figure B is the relative quantification of p-Met and GAPDH in (A). The Western blot results are almost the same as those of A549 cells. It can be seen that the content of p-Met in cells can be controlled as needed by adding different formulas to the system.

[0114] Experiment 9: Wound healing assay to analyze the reversible rearrangement of Met receptor by SL-CDP-Ad to regulate cell migration behavior on demand.

[0115] The cells were treated in the following ways: (a) control group; (b) SL1-Fc and L-β-CDP treatment; (c) HGF treatment; (d) SL1-Fc, L-β-CDP and HGF treatment; (e) SL1-Fc, L-β-CDP, Ada and HGF treatment; (f) SL1-Fc, L-β-CDP, Ada, L-β-CDP and HGF treatment. The implementation steps were the same as those of Experiment 6.

[0116] Fig.19The results of wound migration rate investigation of A549 and SH-SY5Y cells under different treatments are shown in Figure A. Figure A is the result of wound healing assay of A549 cells after various treatments. Figure B is a bar graph of relative wound healing rate statistically obtained from Figure (A) and expressed as mean ± standard deviation. Figure C is a statistical bar graph of wound healing rate of SH-SY5Y cells after various treatments. It can be seen from the figure that A549 cells incubated with HGF have higher wound healing ability than untreated cells. After SL-CDP treatment, wound healing promoted by HGF was inhibited. However, after Ada treatment, the effect of SL-CDP can be removed, so HGF can still significantly enhance cell migration activity, similar to the treatment with HGF alone. In addition, the further addition of L-β-CDP after the addition of Ada can inhibit HGF-induced cell migration. The wound healing activity of SH-SY5Y cells with low expression of Met protein is almost unaffected by SL-CDP.

[0117] Fig. 20 The results of the migration rate investigation of HCT116 cells under different treatments are shown in Figure A. The results of the wound healing assay of HCT116 cells after various treatments are shown in Figure B. The relative wound healing rate bar graph statistically obtained from Figure (A) is expressed as mean ± standard deviation. The results show that SL-CDP-Ad can also be effectively implemented in HCT116 cells. The above results indicate that the SL-CDP-Ad strategy can reversibly regulate the behavior of Met receptor-positive cells through alternating recognition between L-β-CDP and SL1-Fc or Ada.

[0118] Example 4

[0119] A system (SC-CDP) for regulating cell behavior by spatially rearranging cell receptors based on C-β-CDP host-guest recognition, including SL1-Fc and C-β-CDP.

[0120] It has been confirmed that the spatial distribution of receptors is closely related to the function of receptors, and different nanoscale arrangements of receptors can affect the function of receptors and their downstream signals. Considering that C-β-CDP is more compact than L-β-CDP in structure, SL1-Fc / C-β-CDP may induce a denser arrangement of receptors, leading to the activation of Met receptors.

[0121] Fig.21 This is a schematic diagram of the regulatory effect of C-β-CDP on cell behavior. It can be seen from the figure that SL1-Fc binds to the Met receptor on the cell surface, and then C-β-CDP aggregates the Met receptor through host-guest recognition with SL1-Fc, thereby regulating cell behavior.

[0122] Experiment 10: Investigate the co-localization of SL1-Fc / C-β-CDP on the cell surface.

[0123] Similarly, confocal fluorescence imaging was used to observe the colocalization of SL1-Fc and C-β-CDP on the cell surface. Cy5-labeled SL1-Fc (Cy5-SL1-Fc) and FITC-labeled C-β-CDP (FITC-C-β-CDP) were used for confocal imaging, and Hoechst dye was used to stain the cell nucleus. The implementation steps were the same as those in Experiment 3.

[0124] Fig. 22 The results of the colocalization of SL1-Fc and C-β-CDP on the surface of A549 cells are shown in Figure 1. As can be seen from the figure, there is an obvious colocalization signal between the Cy5 and FITC channels, and it is mainly concentrated on the cell membrane. This shows that Cy5-SL1-Fc and FITC-C-β-CDP are successfully anchored on the surface of Met-positive A549 cells through biorecognition and host-guest interaction.

[0125] Experiment 11: Confocal imaging to investigate SL1-Fc / C-β-CDP-induced Met receptor aggregation.

[0126] Confocal imaging was also used to characterize SC-CDP-induced Met receptor aggregation. A549 cells were seeded in 35 mm confocal culture dishes and cultured overnight. They were stained with Hoechst for 15 min at 37 °C. Then, cells were treated with Cy5-SL1-Fc and Cy3-SL1-Fc for 20 min at 4 °C and analyzed by confocal imaging in the presence and absence of β-CDPs. All images were recorded using a 100× oil objective.

[0127] Fig.23 The fluorescence resonance energy transfer (FRET) signal results of Cy5-SL1-Fc and Cy3-SL1-Fc in the presence and absence of β-CDPs are shown in the figure. The results show that Cy5-SL1-Fc and Cy3-SL1-Fc exhibit strong FRET signals in the presence of C-β-CDP, while in the absence of C-β-CDP, the FRET signals are weak, indicating that C-β-CDP makes Cy5-SL1-Fc and Cy3-SL1-Fc gather more closely together, thereby inducing Met receptor aggregation. The FRET signal induced by SL-CDP is weak, which may be because the distance between cyclodextrin monomers in L-β-CDP is not as compact as that in C-β-CDP, so the distance between the ligands SL1 is not enough to produce a strong FRET signal.

[0128] Experiment 12: Western blot was used to investigate the regulatory effect of SC-CDP on Met receptor.

[0129] The implementation steps are the same as Experiment 4.

[0130] Fig.24 The figure is the result of Western blot experiment to detect the direct regulatory effect of SC-CDP on p-Met expression. A in the figure is the protein blot result of Met signal protein in A549 cells under different treatments; B in the figure is the relative quantification of p-Met and GAPDH in (A). It can be seen from the figure that when the concentration of C-β-CDP is constant, the relative expression content of p-Met increases with the increase of SL1-Fc (25-200nM), indicating that SC-CDP promotes the autophosphorylation of Met receptor.

[0131] Experiment 13: Analyze the regulatory effect of SC-CDP on cell proliferation.

[0132] Fig.25 The results of CCK-8 detection show that as the concentration of SL1-Fc increases, the ability of SC-CDP to promote cell proliferation increases. The above results show that SC-CDP can directly activate Met receptor signal transduction, thereby promoting the phosphorylation of Met receptor and cell proliferation.

[0133] Example 5

[0134] A system (SC-CDP-Ad) for regulating cell behavior on demand based on C-β-CDP host-guest recognition spatially reversible rearrangement of cell receptors, comprising SL1-Fc, C-β-CDP and Ada.

[0135] C-β-CDP was also used in the S-CDP-Ad strategy to investigate the reversibility of the process (SC-CDP-Ad). Fig.26 . As can be seen from the figure: SL1-Fc binds to the Met receptor on the cell surface, and then C-β-CDP aggregates the Met receptor through host-guest recognition with SL1-Fc, thereby activating cell behavior. After adding Ada, Ada competes for the binding of SL1-Fc to C-β-CDP, thereby causing the cell membrane receptor to rearrange. Therefore, by alternately adding C-β-CDP and Ada to the system, reversible regulation of cell behavior can be achieved.

[0136] Experiment 14: Investigating the competition between adamantane (Ada) and SL1-Fc for binding to C-β-CDP

[0137] The fluorescence method was used to investigate that Ada dissociates the SL1-Fc / C-β-CDP complex through competitive reaction, realizes the spatial rearrangement of Met receptor, and thus reversibly regulates the cell behavior related to Met receptor. 600nM SL1-Cy5 was mixed with 1.5mM C-β-CDP, reacted at 25℃ for 3h, and then different concentrations of Ada (0.1-4.0mM) were added and continued to react at 25℃ for 3h. The fluorescence intensity was detected by fluorometer, with excitation wavelength of 650nm and emission wavelength of 670 to 750nm.

[0138] Fig. 27 The figure shows the analysis results of Ada competing for the binding of SL1-Fc and C-β-CDP. The figure shows that after binding to C-β-CDP, the fluorescence intensity of Cy5-SL1-Fc is significantly enhanced. However, as the concentration of Ada in the system increases, the enhanced fluorescence intensity of Cy5-SL1-Fc gradually decreases, and finally returns to the same level as the initial fluorescence intensity of Cy5-SL1-Fc alone. These results show that Ada can replace Fc to occupy the cavity of C-β-CDP to dissociate the SL1-Fc / C-β-CDP complex, allowing SL1-Fc to be free again in the solution and restore its original fluorescence intensity. The feasibility of the SC-CDP-Ad strategy was preliminarily verified.

[0139] Experiment 15: Western blot experiment examined whether SC-CDP-Ad could reversibly regulate the phosphorylation level of Met receptor.

[0140] Western blot experiments were performed to study the effect of SC-CDP-Ad on Met autophosphorylation, and A549 cells treated with different formulations were collected: the implementation steps were the same as those of experiment four.

[0141] (a) SL1-Fc treatment group; (b) SL1-Fc, C-β-CDP treatment group; (c) SL1-Fc, C-β-CDP, Ada treatment group; (d) SL1-Fc, C-β-CDP, Ada, C-β-CDP treatment group; (e) HGF treatment group.

[0142] Fig.28 The results of the relative content of p-Met in A549 cells under different treatments are shown in Figure A. Figure A is the protein blot of Met signaling protein in A549 cells after various treatments; Figure B is the relative quantification of p-Met and GAPDH in (A).

[0143] As can be seen from the figure: A549 cells treated with SC-CDP have higher p-Met content than cells treated with SL1-Fc alone. After Ada treatment, the activation effect of SC-CDP can be removed, that is, the SC-CDP-Ad treatment group is similar to the control group, indicating that the addition of Ada reverses the activation of Met receptor by SC-CDP. In addition, the continued addition of C-β-CDP after Ada treatment can produce Met activation signals similar to SC-CDP. Given that the effect of SL1-Fc alone on p-Met levels is negligible, it is shown that the above-mentioned regulatory process is caused by SC-CDP changing the distance between receptors. Although the direct visualization technology of receptor aggregation is limited in this study, the observed effects on upstream binding and downstream signal transduction indicate that SC-CDP treatment can promote Met receptor aggregation rather than simple multivalent binding.

[0144] Experiment 16: Wound healing assay to analyze the reversible rearrangement of Met receptor by SC-CDP-Ad to regulate cell migration behavior on demand.

[0145] The cells were treated in the following ways: (a) SL1-Fc treatment group; (b) SL1-Fc, C-β-CDP treatment group; (c) SL1-Fc, C-β-CDP, Ada treatment group; (d) SL1-Fc, C-β-CDP, Ada, C-β-CDP treatment group; (e) HGF treatment group. The implementation steps were the same as those in Experiment 6.

[0146] Fig.29 The results of the migration rate investigation of A549 and SH-SY5Y cells under different treatments are shown in Figure A. The results of the wound healing assay of A549 cells after various treatments are shown in Figure B. The relative wound healing rate bar graph statistically obtained from Figure (A) is expressed as mean ± standard deviation. The results of the statistical bar graph of the wound healing rate of SH-SY5Y cells after various treatments are shown in Figure C.

[0147] As can be seen from the figure: A549 cells treated with SC-CDP have higher wound healing ability than cells treated with SL1-Fc alone. After Ada treatment, the activation effect of SC-CDP can be removed. In addition, the further addition of C-β-CDP after the addition of Ada can promote cell migration. SH-SY5Y cells were selected as negative control cells. The results showed that there was no significant difference in the migration rate of cells under various treatment conditions. This is due to the low expression of Met on SH-SY5Y cells. The above results show that the S-CDP-Ad strategy is also applicable to C-β-CDP. The SC-CDP-Ad strategy can also reversibly regulate the behavior of Met receptor-positive cells through alternating recognition between C-β-CDP and SL1-Fc or Ada.

[0148] In summary, a non-genetic strategy S-CDP-Ad was proposed to customize cell behaviors such as proliferation and migration in a defined manner by regulating the rearrangement and de-rearrangement of the cell surface receptor Met. Both L-β-CDP and C-β-CDP are suitable for the S-CDP-Ad strategy, and both can achieve dynamic and reversible regulation of cell receptors through simple competitive reactions. SL-CDP can significantly inhibit HGF-induced cell receptor activation and indirectly regulate cell behavior, while SC-CDP can activate cell behavior and directly regulate cell behavior. Therefore, the arrangement of the membrane receptor Met can be manipulated accordingly by adding different formulations, regulating the downstream signaling pathways in the cell and ultimately controlling cell behavior. This strategy can be used to manipulate other cell physiological processes by changing the aptamer to recognize other receptors, thereby broadening the opportunities for cancer treatment.

[0149] The above is only a preferred embodiment of the present invention and does not limit the present invention in any form. Although the present invention has been disclosed as above in the preferred embodiment, it is not used to limit the present invention. Any technician familiar with the art can make many possible changes and modifications to the technical solution of the present invention by using the methods and technical contents disclosed above without departing from the spirit and technical solution of the present invention, or modify it into an equivalent embodiment of equivalent changes. Therefore, any simple modification, equivalent replacement, equivalent change and modification made to the above embodiments according to the technical essence of the present invention without departing from the content of the technical solution of the present invention, still fall within the scope of protection of the technical solution of the present invention.

Claims

1. A system for regulating cell behavior on demand based on spatial reversible rearrangement of cell receptors based on host-guest recognition, characterized in that: The system comprises: a beta-cyclodextrin polymer and a Met-binding nucleic acid aptamer (SL1-Fc) labeled with ferrocene, and the gene sequence of the Met-binding nucleic acid aptamer is shown in SEQ ID NO.

1.

2. The system according to claim 1, characterized in that The β-cyclodextrin polymer is a linear β-cyclodextrin polymer, and the system further comprises HGF.

3. The system according to claim 1, characterized in that The β-cyclodextrin polymer is a cross-linked β-cyclodextrin polymer.

4. The system according to any one of claims 1 to 3, characterized in that The system also includes adamantane.

5. The system according to claim 4, characterized in that The concentration of the β-cyclodextrin polymer is 100 μM to 500 μM; the concentration of the SL1-Fc is 50 nM to 200 nM; and the concentration of the adamantane is 0.1 mM to 1.0 mM.

6. Use of the system according to any one of claims 1 to 5 in preparing a detection kit for cell analysis.

7. Use of the system according to any one of claims 1 to 5 in the preparation of a drug for cell regulation.

Images