Plant disease-resistant genes and methods and applications for improving plant disease resistance
By connecting the wheat TFR1 gene with a pathogen-inducible promoter or a strong promoter to form a specific or broad-spectrum disease-resistance gene, and transferring it into plants through genetic transformation methods, the problems of inconvenience in plant disease-resistance gene modification and insufficient broad-spectrum disease resistance in existing technologies are solved, and effective disease resistance to multiple pathogens and cost reduction are achieved.
Patent Information
- Application Number
- CN202411645644.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-15
- Publication Date
- 2025-09-19
- Estimated Expiration
- 2044-11-15
Smart Images

Figure CN119242653B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of functional genes, and in particular relates to plant disease-resistant genes and methods and applications for improving plant disease resistance. Background Art
[0002] The wheat TFR1 gene (NCBI Reference Sequence: XP_044432367.1) is homologous to the Rph3 gene for resistance to stem rust, already discovered in barley, but its function in wheat has not been reported. Plant cells contain two types of resistosomes. One type binds to specific effectors to form multimers, which create pores in the cell membrane, triggering a calcium ion flux and inducing a disease resistance response. The other type requires the assistance of helper genes after effector binding to polymerize, creating pores in the cell membrane and inducing a calcium ion flux, triggering a disease resistance response. However, the current design and modification of plant resistosomes remains challenging, and their performance is often unsatisfactory in the face of a variety of diseases, including fungi, bacteria, and viruses. Furthermore, cloning and discovering more resistosomes from plants requires significant human, material, and financial resources.
[0003] At the same time, the current discovery of disease-resistant genes is limited. Traditional disease-resistant gene discovery programs consume a lot of manpower and material resources, and traditional disease-resistant genes can only fight against one or several physiological subspecies and cannot achieve joint disease resistance of large categories. Summary of the Invention
[0004] The present invention provides a plant disease resistance gene and a method and application for improving plant disease resistance, introduces TFR1 into the disease resistance of multiple plants, and proves its role in plant disease resistance.
[0005] The present invention provides a plant-specific disease-resistant gene, comprising a promoter and a wheat disease-resistant gene TFR1 connected in sequence, wherein the NCBI Reference Sequence of the wheat disease-resistant gene TFR1 is XP_044432367.1; the promoter is a pathogen-inducible promoter corresponding to the pathogen resistant to the target disease.
[0006] Preferably, the pathogen-inducible promoter includes PR10pro.
[0007] The invention provides a plant broad-spectrum disease-resistant gene, comprising a strong promoter and a wheat disease-resistant gene TFR1 connected in sequence. The NCBI Reference Sequence of the wheat disease-resistant gene TFR1 is XP_044432367.1.
[0008] Preferably, the strong promoter includes Mas.
[0009] The present invention also provides the use of the wheat disease resistance gene TFR1 or the above-mentioned plant specific disease resistance gene or the above-mentioned plant broad-spectrum disease resistance gene in plant disease resistance. The NCBI Reference Sequence of the wheat disease resistance gene TFR1 is: XP_044432367.1; the plant and wheat have species differences.
[0010] Preferably, the plant species include monocots or dicots.
[0011] Preferably, the monocotyledonous plant includes rice;
[0012] The dicotyledonous plants include tobacco.
[0013] The present invention provides a method for improving plant-specific disease resistance, comprising transferring the plant-specific disease resistance gene into the plant.
[0014] The present invention also provides a method for improving the broad-spectrum disease resistance of plants, comprising transferring the above-mentioned broad-spectrum disease-resistant gene into the plants.
[0015] The present invention also provides the use of the wheat disease resistance gene TFR1 or the above-mentioned plant specific disease resistance gene or the above-mentioned plant broad-spectrum disease resistance gene in creating disease-resistant plant germplasm. The NCBI Reference Sequence of the wheat disease resistance gene TFR1 is: XP_044432367.1.
[0016] Beneficial effects: The present invention provides a class of disease-resistant genes based on the wheat TFR1 gene, including specific disease-resistant genes formed by connecting to pathogen-inducible promoters, and broad-spectrum disease-resistant genes formed by connecting to strong promoters. The disease-resistant gene design method is more flexible and the designability is significantly enhanced. The present invention transfers the disease-resistant genes into a variety of plants. The specific disease-resistant genes exhibit the same disease resistance as the pathogen-inducible promoter, and the broad-spectrum disease-resistant genes exhibit broad-spectrum disease resistance. It is flexible and versatile and applicable to multiple crops. The promoter sequence is flexible and versatile and can be added according to different crops and different pathogens. This achieves transformation by connecting a gene to different promoters, thereby producing disease-resistant types against multiple pathogens and reducing the cost of transgenics. BRIEF DESCRIPTION OF THE DRAWINGS
[0017] Figure 1 Figure 1 shows the verification results that wheat TFR1 protein has the basic characteristics of plant disease resistance protein. Figure a shows the results of TFR1-induced HR response and ROS burst in tobacco cells, b shows the results of TFR1-induced ROS burst in Nicotiana benthamiana - ROS measurement, c shows the results of TFR1-induced high expression of tobacco disease resistance-related genes, and d shows the results of TFR1-induced ion leakage in Nicotiana benthamiana.
[0018] Figure 2 Figure 1 shows the results of the resistance verification of mTFR1 transgenic tobacco to Phytophthora capsici and Rhizoctonia solani (Rhizoctonia solani was isolated in the field from tobacco target spot disease leaves and has not been published). In the figure, a is the result of mTFR1 inoculated with Phytophthora capsici lesions, b is the corresponding lesion area in figure a, c is the result of mTFR1 inoculated with Rhizoctonia solani lesions, d is the corresponding lesion area in figure c;
[0019] Figure 3 Figure 1 is a graph showing the size of rice blast lesions in transgenic rice grown with pTFR1. Figure a shows the results of rice leaf lesions and ROS bursts caused by TFR1, b shows the size of rice blast lesions in pTFR1, and c shows the corresponding lesion area in Figure b.
[0020] Figure 4 This is the map of the MAS-TFR1 recombinant plasmid. DETAILED DESCRIPTION
[0021] The present invention provides a plant-specific disease-resistant gene, comprising a promoter and a wheat disease-resistant gene TFR1 connected in sequence, wherein the NCBI Reference Sequence of the wheat disease-resistant gene TFR1 is XP_044432367.1; the promoter is a pathogen-inducible promoter corresponding to the pathogen resistant to the target disease.
[0022] The wheat disease-resistance gene TFR1 described in the present invention (NCBI Reference Sequence: XP_044432367.1) has an amino acid sequence of NCBI Reference Sequence: XP_044432367.1. The pathogen-inducible promoter described in the present invention preferably includes PR10pro from rice. Thus, the specific disease-resistance gene formed by linking the PR10pro promoter and TFR1 has the effect of resisting rice blast.
[0023] The pathogen-inducible promoter of the present invention refers to a promoter that activates the target gene under the induction of pathogen infection and expresses the target gene at a higher level during the pathogen infection period.
[0024] The invention provides a plant broad-spectrum disease-resistant gene, comprising a strong promoter and a wheat disease-resistant gene TFR1 connected in sequence. The NCBI Reference Sequence of the wheat disease-resistant gene TFR1 is XP_044432367.1.
[0025] The strong promoter of the present invention preferably includes Mas. The broad-spectrum disease resistance gene of the present invention has a broad-spectrum disease resistance effect on a variety of crop diseases. For example, when the broad-spectrum disease resistance gene formed by linking Mas with TFR1 is introduced into tobacco in the examples, it has significant resistance to Phytophthora capsici and Rhizoctonia solani.
[0026] The present invention also provides the use of the wheat disease resistance gene TFR1 or the above-mentioned plant specific disease resistance gene or the above-mentioned plant broad-spectrum disease resistance gene in plant disease resistance. The NCBI Reference Sequence of the wheat disease resistance gene TFR1 is: XP_044432367.1; the plant and wheat have species differences.
[0027] The present invention can introduce the TFR1, specific disease resistance gene, or broad-spectrum disease resistance gene into plants that differ from wheat species, thereby exhibiting disease resistance. The present invention does not specify the type of plant; the plant can be either a monocot or a dicot. While the present invention is illustrated using the monocot rice plant and the dicot tobacco plant as examples, these are not intended to be the sole examples in the full scope of the present invention.
[0028] The present invention provides a method for improving plant-specific disease resistance, comprising transferring the plant-specific disease resistance gene into the plant.
[0029] The present invention does not specifically limit the method of transfer. The corresponding gene is amplified using conventional means in the art and then inserted into an expression vector to construct a recombinant expression vector, and the recombinant expression vector is transferred into the target plant using a transformation method to construct a plant with specific disease resistance.
[0030] The present invention also provides a method for improving the broad-spectrum disease resistance of plants, comprising transferring the above-mentioned broad-spectrum disease-resistant gene into the plants.
[0031] The present invention does not specifically limit the method of transfer. The corresponding gene is amplified using conventional means in the art and then inserted into an expression vector to construct a recombinant expression vector, and the recombinant expression vector is transferred into the target plant using a transformation method, thereby constructing a plant with broad-spectrum disease resistance.
[0032] The present invention also provides the use of the wheat disease resistance gene TFR1 or the above-mentioned plant specific disease resistance gene or the above-mentioned plant broad-spectrum disease resistance gene in creating disease-resistant plant germplasm. The NCBI Reference Sequence of the wheat disease resistance gene TFR1 is: XP_044432367.1.
[0033] The present invention does not particularly limit the method for creating germplasm, but preferably includes genetic transformation.
[0034] To further illustrate the present invention, the plant disease-resistant gene and the method and application for improving plant disease resistance provided by the present invention are described in detail below in conjunction with the examples, but they should not be construed as limiting the scope of protection of the present invention.
[0035] Example 1: Wheat TFR1 induces tobacco cell death, demonstrating plant disease resistance gene immunity
[0036] S1. Vector construction:
[0037] TFR1 was amplified and constructed into the pCAMBIA1300 vector by homologous recombination.
[0038] The primer sequences were designed as follows:
[0039] p1300-TFR1-F (SEQ ID No. 1): 5'ACACCAAATCGACTCTAGAAATGCCGCACATTGCTC3';
[0040] p1300-TFR1-R (SEQ ID No. 2): 5'CTTGCTCACCATGGTCTCGACGCCTTCGTCTGCC3'.
[0041] Amplification of the TFR1 segment: PCR amplification was performed using a synthetic TFR1 (NCBI Reference Sequence: XP_044432367.1) fragment as a template. Reaction conditions were: 95°C denaturation for 5 min, 95°C for 30 sec, 58°C for 30 sec, and 72°C for 30 sec, for 28 cycles, and 72°C for 5 min.
[0042] Homologous recombination ligation: The pCAMBIA1300 vector was digested with HindIII, and the digestion product and the corresponding fusion fragment were ligated to construct a tobacco expression vector, which was then transformed into Escherichia coli DH5α to obtain a vector containing the TFR1 gene (abbreviated as TFR1).
[0043] S2. Immune signature analysis:
[0044] (1) Transient expression of TFR1 in Nicotiana benthamiana to induce plant hypersensitivity (HR) response: This experiment was divided into three groups, pCAMBIAsuper1300 empty vector (EV) and positive control Xa23 (AIX09985.1) that induces HR response. TFR1 and Xa23 were constructed into pCAMBIAsuper1300 vectors and transformed into Agrobacterium GV3101. After shaking culture for 16 hours, the bacteria were resuspended in infection solution (10mMMgCl2, 10mM MES and 150μM acetosyringone) and the OD of each component was adjusted. 600TFR1, an empty vector negative control (EV), and a positive control Xa23 were injected into four-week-old Nicotiana benthamiana leaves. 24 hours after injection, the leaves were observed and photographed.
[0045] Primer sequences:
[0046] p1300-Xa23-F (SEQ ID No. 3): ATACACCAAATCGACTCTAGAAAGCTTATGTTGCATCATCTCAAGGAGCT;
[0047] p1300-Xa23-R (SEQ ID No. 4): TCGCCCTTGCTCACCATGGTCTCTTAAACAGGGAGAATAACCATCTTGTCG.
[0048] The results are as follows Figure 1 As shown in (a), both TFR1 and the positive control Xa23 can induce HR response in tobacco cells, while the empty vector (EV) does not.
[0049] (2) TFR1-induced reactive oxygen species (ROS) burst in Nicotiana benthamiana - DAB staining: As described in (1), TFR1, an empty vector negative control (EV), and a positive control Xa23 were injected into four-week-old Nicotiana benthamiana leaves. 15 h after injection, the injected leaves were immersed in 20 ml of DAB staining solution, incubated horizontally in the dark for 8 h, then decolorized in 95% ethanol, incubated horizontally for 48 h, and photographed under white light.
[0050] The results are as follows Figure 1 As shown in (a), both TFR1 and the positive control Xa23 can stain ROS burst, while the empty vector (EV) control group does not. This indicates that TFR1 expression in tobacco cells can induce ROS burst like the positive control Xa23.
[0051] (3) TFR1-induced ROS burst in Nicotiana benthamiana - ROS assay: The experiment was divided into eight groups, namely TFR1 / Flg22 group, EV / Flg22 group, TFR1 / mock group (control group 1), and EV / mock group (control group 2). In the TFR1 / Flg22 group, the TFR1 / Flg22 group was induced with a mixed solution containing the N-terminal 22aa of bacterial flagellin (Flg22, purchased from Sigma: SRP8029) (final concentration 0.02mM) to induce Nicotiana benthamiana leaves containing TFR1 Agrobacterium, the EV / Flg22 group was induced with a mixed solution containing the N-terminal 22aa of bacterial flagellin (Flg22) (final concentration 0.02mM) to induce Nicotiana benthamiana leaves containing empty vector EV Agrobacterium, the TFR1 / mock group was treated with distilled water to treat Nicotiana benthamiana leaves containing TFR1 Agrobacterium, and the EV / mock group was treated with distilled water to treat Nicotiana benthamiana leaves containing empty vector EV Agrobacterium. Each sample group had at least eight biological replicates.
[0052] Agrobacterium containing expression plasmids for TFR1 and an empty vector (EV) was injected into 4-week-old Nicotiana benthamiana leaves. Agrobacterium expressing the empty vector served as an EV control. Seven hours later, 3 mm × 3 mm discs of Nicotiana benthamiana leaves were collected and immersed in distilled water overnight in a 96-well plate. The distilled water was discarded, and 100 μL of a mixed solution (50 μM luminol (Wako), 10 μg / mL horseradish peroxidase, and 2 mM Flg22) was added to each well. 100 μL of distilled water was added to each well of the TFR1 / mock and EV / mock groups as controls. Chemiluminescence was measured at 500 ms intervals for 60 minutes in a SPARK-10M microplate reader (TECAN).
[0053] The results are as follows Figure 1 As shown in middle b, after induction with Flg22, the reactive oxygen species in tobacco expressing the TFR1 gene increased sharply, significantly higher than that in materials not expressing the TFR1 gene, indicating that TFR1 expression can induce the production of reactive oxygen species, and the total amount of reactive oxygen species is much higher than that of control groups 1 to 2.
[0054] (4) Detection of disease resistance-related genes: Experimental method: The experiment was divided into four groups, namely, Agrobacterium tumefaciens injected with TFR1 expression plasmid in Nicotiana benthamiana as the experimental group and Agrobacterium tumefaciens injected with empty vector expression plasmid in Nicotiana benthamiana as the EV control. Each sample was subjected to at least three biological replicates.
[0055] RNA extraction and reverse transcription quantitative PCR analysis: Tobacco leaves containing TFR1 and control EVs were collected 15 hours after Agrobacterium injection and quickly frozen in liquid nitrogen. The leaves were ground in liquid nitrogen and used for RNA extraction. Total RNA was extracted from the samples using the RNAprep PurePlant Kit (TianGenBiotech; China). RNA was purified from the total RNA using DNase I (Thermo Scientific). Complementary DNA (cDNA) was synthesized using the HiScript II First-Strand cDNA Synthesis Kit (Vazyme). qRT-PCR was performed using SYBR Green cocktail (Vazyme) on a Bio-Rad CFX96 Real-Time System with a C1000 Thermal Cycler (Bio-Rad), using the tobacco actin gene as an internal reference gene. Primer sequences are as follows:
[0056] qRT-NbEF1a-F (SEQ ID No. 5): AGAGGCCCTCAGACAAAC;
[0057] qRT-NbEF1a-R (SEQ ID No. 6): TAGGTCCAAAGGTCACAA;
[0058] Detection of PR1b in tobacco samples, primer sequences:
[0059] qRT-NbPR1b-F (SEQ ID No. 7): GTGGACACTATACTCAGGTG;
[0060] qRT-NbPR1b-R (SEQ ID No. 8): TCCAACTTGGAATCAAAGGG;
[0061] Detection of PR2b in tobacco samples, primer sequences:
[0062] qRT-NbPR2b-F (SEQ ID No. 9): AGGTGTTTGCTATGGAATGC;
[0063] qRT-NbPR2b-R (SEQ ID No. 10): CTGTACCACCACCATTCTGC;
[0064] Detection of LOX in tobacco samples, primer sequences:
[0065] qRT-LOX-F(SEQ ID No.11):AAAACCTATGCCTCAAGAAC;
[0066] qRT-LOX-R (SEQ ID No. 12): ACTGCTGCATAGGCTTTGG.
[0067] 2 -ΔΔCt The method was used to calculate the gene expression levels.
[0068] The results are as follows Figure 1 As shown in Figure c, the expression levels of disease-resistant genes such as LOX, PR1b, and PR2b in tobacco samples injected with TFR1 were significantly increased, significantly higher than those in the control group, indicating that the expression of TFR1 activated the expression of plant disease-resistant genes and proved that the TFR1 gene has the immune characteristics of plant R genes.
[0069] (5) TFR1-induced ion leakage assay in Nicotiana benthamiana: The experiment consisted of three groups: TFR1 group, Xa23 group, and EV group. Each group injected the corresponding Agrobacterium (TFR1, Xa23, or EV) into the same tobacco leaf, with three replicates for each treatment group. Eight leaf discs with a diameter of 3 mm were cut from the injection area at 10 h, 15 h, and 20 h after injection. The leaf discs were immediately placed in a 10 mL centrifuge tube containing 5 mL of sterile ultrapure water. The centrifuge tube was incubated for 2 hours to allow the leaf discs to release ions, and the conductivity of the solution in the centrifuge tube was measured using a conductivity meter. The leaf discs were boiled for 10 minutes to ensure that the plant cells were completely ruptured and all electrolytes were released. The conductivity of the solution in the centrifuge tube was measured again to determine the maximum conductivity after boiling. The plant ion leakage rate was counted and calculated.
[0070] Example 2 Analysis of resistance of mTFR1 transgenic tobacco to Phytophthora capsici and Rhizoctonia solani
[0071] Preparation of S1 and mTFR1 transgenic tobacco materials
[0072] The TFR1 vector constructed into the pCAMBIA1300 vector in Example 1 was used ( Figure 4 ) to prepare transgenic Nicotiana benthamiana.
[0073] The transgenic method is as follows:
[0074] (1) Agrobacterium infection of tobacco: Cut tobacco leaves of Nicotiana benthamiana into 2 cm pieces. 2 Leaves were cultured on co-cultivation medium (MS medium + 0.1 mg / L NAA + 1.5 mg / L 6-BA). The cut leaves were placed in an Agrobacterium solution containing the artificially designed plant disease resistance protein vector constructed in Example 1 at an OD value of 0.4-0.6 and immersed for 10 minutes. The bacterial solution was then poured out and the leaves were transferred to sterile filter paper, the bacterial solution was discarded, and the leaves were air-dried.
[0075] (2) Differentiation and screening of transgenic tobacco: Leaves co-cultured for 3 days were transferred to a culture medium (macroelements (20×) 50 mL, trace elements (200×) 5 mL, iron salts (200×) 5 mL, organic matter (200×) 5 mL, Sucrose 30.0 g, pH adjusted to 5.8). Culture was carried out at 25°C under light conditions. After culturing for two to three weeks, the tobacco shoots that grew were excised and transferred to a seedling medium (MS + 0.1 mg / L 6-BA + 0.01 mg / L NAA + 30 mg / L hygromycin) for cultivation.
[0076] (3) Rooting of transgenic tobacco: Tobacco seedlings with roots were selected and transferred to rooting medium (MS + 30 mg / L hygromycin) for culture and testing.
[0077] (4) Extract genomic DNA samples using the CTAB method.
[0078] (5) PCR identification of transgenic plants: PCR detection was performed using specific primers, and the target fragment size obtained was 840 bp. The PCR product was sequenced by Sanger sequencing to identify the editing sites of positive transgenic plants, and Maspro-TFR1 transgenic tobacco was obtained and named mTFR1.
[0079] PCR detection primers are as follows:
[0080] SeqTFR1-F (SEQ ID No. 13): ATGCCGCACATTGCTC;
[0081] SeqTFR1-R (SEQ ID No. 14): GACGCCTTCGTCTGCC.
[0082] After culturing the mTFR1 transgenic tobacco obtained above for one month, disease resistance immunity test was performed.
[0083] Phytophthora capsica LT263 (Li, Qi, et al. "A Phytophthora capsici Effector Targets ACD11 Binding Partners thatRegulate ROS-Mediated Defense Response in Arabidopsis." Molecular Plant, vol. 12, 2019, pp. 565-581.) or Rhizoctonia solani HN-18 was activated on a PDA plate and cultured at 25°C for 3-4 days. The bacterial cake was punched with a 3mm punch and inoculated onto two tender leaves of mTFR1 transgenic tobacco and wild-type tobacco (WT) that had been cultured for one month. mTFR1 transgenic tobacco was used as the experimental group, and WT tobacco was used as the control group. 36 hours after inoculation (hpi), photos were taken under ultraviolet (UV) light for statistics.
[0084] The results are as follows Figure 2 As shown in the figure, the size of the lesions of pepper Phytophthora and Rhizoctonia solani in mTFR1 was significantly smaller than that in the control group. In conclusion, mTFR1 transgenic tobacco has significant resistance to both pepper Phytophthora and Rhizoctonia solani.
[0085] Example 3 Analysis of resistance of pTFR1 transgenic rice to rice blast fungus
[0086] Use TFR1 in Example 1 to connect the PR10pro promoter to construct the pRHE vector
[0087] The transgenic method is as follows:
[0088] (1) Seed disinfection: Soak peeled rice seeds in 75% ethanol for 1 minute, then treat them twice with 2.5% sodium hypochlorite for 15 minutes each time, and finally rinse them with sterile ddH2O 3 to 5 times.
[0089] Callus induction and subculture: Sterilized mature seeds were cultured in the dark at 28°C for 25-28 days to induce callus. After the callus reached an appropriate size, smooth, light yellow, and hard embryonic calli were selected and evenly spread on subculture callus medium (50 mL of macroelements (20×), 5 mL of trace elements (200×), 5 mL of iron salts (200×), 5 mL of organic matter (200×), 30.0 g of Sucrose, pH adjusted to 5.8, 1 L of ddH2O, 7.4 g of agar, autoclaved at 121°C for 30 min, and then cooled to 60°C before adding 200 μL of zeatin (1 mg / mL), 1 mL of kanamycin (100 mg / mL), and 1 mL of hygromycin (25 mg / mL)). Culture was continued for 7-8 days.
[0090] (2) Agrobacterium-mediated transformation of rice callus and co-culture: After activation, Agrobacterium was co-cultured with callus (macroelements (20×) 50 mL, trace elements (200×) 5 mL, iron salts (200×) 5 mL, inositol (20 mg / mL) 5 mL, vitamin B1 (1 mg / mL) 1.3 mL, 2,4-D (1 mg / mL) 200 μL, KH2PO4 (100 mg / mL) 2 mL, KT (1 mg / mL) 100 μL, Sucrose 30 g, pH adjusted to 5.8, ddH2O to 1 L, agar 7.4 g, autoclaved at 121°C for 30 min.) to make the OD of Agrobacterium ≥ 1. 600 The co-cultured callus was washed three times with sterile water, then soaked in sterile water containing 500 mg / L cephalosporin for 30 minutes, dried with filter paper, and plated on a selective medium (50 mL of macroelements (20×), 5 mL of trace elements (200×), 5 mL of iron salts (200×), 5 mL of organic matter (200×), 30.0 g of Sucrose, adjusted to pH 5.8, made up to 1 L with ddH2O, 7.4 g of agar, autoclaved at 121°C for 30 min, and when cooled to 60°C, 100 μL of IAA (1 mg / mL), 2 mL of zeatin (1 mg / mL), 1 mL of kanamycin (100 mg / mL), and 1 mL of hygromycin (25 μg / mL) were added.
[0091] (3) Selection and culture of transformed callus tissue: After co-cultivation, the calli were first washed three times with sterile water, then soaked in sterile water containing 500 mg / L of cephalosporin for 30 minutes, then dried with filter paper, evenly spread on the selection medium, and cultured in the dark at 28°C for 10 days. After that, a second screening was carried out to select light yellow calli with good growth status and continue to culture.
[0092] (4) Differentiation culture of callus tissue: yellow, round callus tissue was selected and evenly spread on pre-differentiation culture medium (macroelements (20×) 50 mL, trace elements (200×) 5 mL, iron salts (200×) 5 mL, organic matter (200×) 5 mL, Sucrose 30.0 g, pH adjusted to 5.8, ddH2O to 1 L, agar 7.4 g, autoclaved at 121°C for 30 min, and then cooled to 60°C before adding zeatin (1 mg / mL) 200 μL, kanamycin (100 mg / mL) 1 mL, and hygromycin (25 μg / mL) 1 mL.) and cultured in the dark at 28°C for 7 days. Then, embryonic calli with good growth and light yellow color were selected and placed in differentiation medium (macroelements (20×) 50 mL, trace elements (200×) 5 mL, iron salts (200×) 5 mL, organic matter (200×) 5 mL, IBA (1 mg / mL) 2 mL, Sucrose 30.0 g, agar 7.4 g, pH adjusted to 5.8, ddH2O diluted to 1 L, autoclaved at 121°C for 30 min, and added with kanamycin (100 mg / mL) 500 μL and hygromycin (25 μg / mL) 11 mL when cooled to 60°C), and cultured at 28°C for about 30 to 60 days under light conditions until transgenic seedlings grew.
[0093] (5) Extract genomic DNA samples using the CTAB method.
[0094] (6) PCR identification of transgenic plants: PCR detection was performed using specific primers, and the target fragment size obtained was 840 bp. The PCR product was sequenced by Sanger sequencing to identify the editing site of the positive transgenic plant, and PR10pro-TFR1 transgenic tobacco was obtained and named pTFR1.
[0095] PCR detection primers are as follows:
[0096] SeqTFR1-F (SEQ ID No. 15): ATGCCGCACATTGCTC;
[0097] SeqTFR1-R (SEQ ID No. 16): GACGCCTTCGTCTGCC.
[0098] The pTFR1 transgenic rice obtained above was cultured for one month and then subjected to disease resistance test.
[0099] Magnaporthe oryzae EA18 strain (Yin Wang, Lei Yang, Chang Ma, et al., "Genome Sequence of Magnaporthe oryzae EA18 Virulent to Multiple Widely Used Rice Varieties," Molecular Plant-Microbe Interactions, vol. 35, no. 8, 2022, pp. 25) was activated on OTA plates and incubated at 25°C for 7–10 days. The plates were then punched with a 3 mm borer and inoculated into leaves of one-month-old mTFR1 transgenic rice and wild-type rice (WT). The transgenic rice served as the experimental group, and the WT rice served as the control group. Images were taken and counted 14 days after inoculation (dpi).
[0100] The results are as follows Figure 3 As shown in the figure, the size of rice blast lesions in pTFR1 was significantly smaller than that in the control group. In conclusion, pTFR1 transgenic rice has significant resistance to rice blast.
[0101] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.
Claims
1. Application of wheat disease resistance gene TFR1 in plant disease resistance, characterized in that: The NCBI Reference Sequence of the wheat disease resistance gene TFR1 is XP_044432367.1; After the wheat disease resistance gene TFR1 is expressed in tobacco, tobacco has significant resistance to pepper phytophthora and Rhizoctonia solani; After the wheat disease-resistant gene TFR1 is expressed in rice, the rice has significant resistance to rice blast.
2. A method for improving plant disease resistance, characterized in that: The method comprises transferring the wheat disease resistance gene TFR1 into the plant, wherein the NCBI Reference Sequence of the wheat disease resistance gene TFR1 is XP_044432367.1; When the plant is tobacco, the disease resistance is resistance to Phytophthora capsici and Rhizoctonia solani; When the plant is rice, the disease resistance is resistance to rice blast.
3. Application of wheat disease resistance gene TFR1 in creating disease-resistant plant germplasm, characterized in that: The NCBI Reference Sequence of the wheat disease resistance gene TFR1 is XP_044432367.1; The disease-resistant plant germplasm is tobacco resistant to pepper phytophthora and Rhizoctonia solani or rice resistant to rice blast.