Method for creating cadmium-resistant rice with low grain cadmium accumulation and application

Abstract

The invention discloses a method for creating cadmium-resistant rice with low grain cadmium accumulation and application. The rice oshma3oslct1 double mutant expressing the Cd binding autophagy adapter protein AIM-SpMTL-GFP is constructed through CRISPR-Cas9, so that the transfer of Cd from xylem to phloem and the accumulation of Cd in root vacuoles are reduced, meanwhile, the Cd binding autophagy adapter protein AIM-SpMTL-GFP can also accumulate cadmium in protoplast vacuoles of leaves, the yield and quality of rice grains are not influenced, and the yield and quality of the rice grains are greatly improved. Cd accumulation of grains is reduced, and Cd is enriched into straws at non-edible parts, so that industrial treatment is facilitated. The cadmium-resistant rice with low grain cadmium accumulation can reduce cadmium pollution in a food chain, so that the harm of cadmium to a human body is reduced.

Description

Technical Field

[0001] The present invention relates to the field of gene editing technology and crop breeding technology, and in particular to a method for creating cadmium-resistant rice with low cadmium accumulation in grains and an application thereof. Background Art

[0002] Cadmium (Cd) is a heavy metal and environmental pollutant widely used in industrial production. Due to the increasing discharge of industrial wastewater and waste gas, and the excessive use of metal-containing pesticides and fertilizers, the cadmium content in farmland soil has continued to rise. Cadmium is easy to accumulate in the human body and difficult to be excreted. It has a long half-life, which can reach 10 to 30 years in the kidney. Long-term consumption of rice with excessive cadmium content will endanger human health and cause diseases such as liver disease, kidney damage, bone mutation and cancer. Reducing the accumulation of cadmium in rice grains and repairing soil cadmium pollution are of great significance to ensuring food security and human health.

[0003] Rice is susceptible to cadmium contamination because Cd 2+ Essential metal element Fe 2+ 、Zn 2+ , Mn 2+ The cadmium in the soil is transported to the symplasm of the root cells by metal transporters (MT), and part of it is sequestered in the vacuole of the root cells by OsHMA3 (Heavy metal-transporting ATPase3, OsHMA3), and the other part is transported to the xylem by OsHMA2 and OsCCX2, and finally reaches the grain after transport from the xylem to the phloem and then transported from the phloem. Low-affinity cation transporter (OsLCT1) is mainly expressed in the diffuse vascular bundles connected to the panicle in rice, and is involved in the transfer of cadmium from the enlarged large vascular bundles to the diffuse vascular bundles connected to the panicle, resulting in the accumulation of cadmium in the grains.

[0004] In recent years, people have taken various measures to prevent and control cadmium pollution in rice. Most methods for repairing cadmium pollution in rice have limitations. Field remediation techniques, such as soil improvement, bioremediation, and hyperaccumulation phytoremediation, have long cycles and low efficiency. In addition to field remediation techniques, cultivating rice varieties with low cadmium accumulation is an economical and effective way to reduce cadmium pollution in the food chain. Most studies use CRISPR-Cas9 and other technologies to knock out the main cadmium transport gene NRAMP5 in the root to reduce the absorption of cadmium by rice. Similarly, manipulating the mutations of OsHMA2 and OsLCT1 can reduce the loading of Cd in the xylem and the long-distance transportation and distribution of Cd from underground to aboveground parts in rice. In addition, further coordinated overexpression of OsHMA3 can promote the compartmentalization of Cd in the root cell vacuole, thereby reducing the accumulation of Cd in the grain. However, the loss of the above-mentioned gene function will also be accompanied by the disturbance of the homeostasis of other mineral elements. For example, the loss of OsHMA2 function will reduce the content of Zn in the grain while reducing the Cd in the grain. Although gene editing can reduce the cadmium content in rice grains, it will also cause the loss of other essential metal elements for the human body, and cadmium pollution in the soil will still exist.

[0005] In order to adapt to the cadmium-contaminated soil environment, rice has evolved various strategies to resist cadmium toxicity, including cadmium deposition in the cell wall, vacuolar sequestration, chelation, and efflux. The vacuole is the main organelle for sequestering cadmium in rice. At the same time, the vacuole is also the final destination of the transported substances in the cell autophagy pathway in plants and yeast. Cellular autophagy is the process of encapsulating damaged organelles, denatured or aged macromolecules, etc. in autophagic vesicles and transporting them to the vacuole (plants and yeast) or lysosome (mammals) for degradation or sequestration. The autophagy pathway is regulated by a series of conserved autophagy-related (AuTophaGy-related, ATG) genes, among which ATG8 is regarded as a landmark protein of the autophagy pathway. Autophagy can be divided into selective autophagy and non-selective autophagy according to the selectivity of degradation substrates. Selective autophagy is the interaction between adapter proteins and ATG8, which encapsulates different substrates to be degraded into autophagic vesicles. The interaction between these adapter proteins and ATG8 is mediated by the conserved AIM (ATG8-interacting motif) motif on the adapter proteins. The core sequence of the AIM motif is W / Y / F-XX-L / I / V, where the first and fourth amino acids are conserved amino acids, and "X" can be any amino acid. The AIM promotes binding to ATG8 by cooperating with the conserved hydrophobic gap on the surface of ATG8, encapsulating the selective autophagy substrate into the vesicle. Summary of the invention

[0006] The technical problem to be solved by the present invention is the above-mentioned defects and deficiencies in the prior art, and a method and application of creating cadmium-resistant rice with low cadmium accumulation in grains is provided.

[0007] The first object of the present invention is to provide a composition.

[0008] The second object of the present invention is to provide the use of the above composition in creating cadmium-resistant rice.

[0009] The third object of the present invention is to provide a method for creating cadmium-resistant rice.

[0010] The fourth object of the present invention is to provide the use of the cadmium-resistant rice obtained by the above method in resisting cadmium pollution of rice.

[0011] In order to achieve the above object, the present invention is implemented by the following scheme:

[0012] The present invention firstly constructs a rice oshma3 oslct1 double mutant and a rice oshma3 oslct1 double mutant plant expressing a Cd-binding autophagy adaptor protein AIM-SpMTL-GFP by using CRISPR-Cas9 gene editing technology, then uses a cadmium-specific dye to detect whether the Cd-binding autophagy adaptor protein AIM-SpMTL can enrich Cd in the protoplast vacuole of leaves, and detects the tolerance of the created rice oshma3 oslct1 double mutant expressing a Cd-binding autophagy adaptor protein AIM-SpMTL-GFP to cadmium.

[0013] Therefore, the present invention claims the following:

[0014] A composition comprising an sgRNA expression cassette specifically targeting the OsHMA3 gene, an sgRNA expression cassette specifically targeting the OsLCT1 gene, and a gene encoding an adaptor protein related to autophagy.

[0015] Preferably, the nucleotide sequence of the sgRNA expression cassette specifically targeting the OsHMA3 gene is shown as SEQ ID NOs: 1 to 2, the nucleotide sequence of the sgRNA expression cassette specifically targeting the OsLCT1 gene is shown as SEQ ID NOs: 3 to 4, and the nucleotide sequence of the gene encoding the autophagy-related adaptor protein is shown as SEQ ID NO: 5.

[0016] Preferably, the gene encoding the autophagy-related adaptor protein further contains a green tissue-specific expression promoter upstream, that is, the gene encoding the autophagy-related adaptor protein contains a green tissue-specific expression promoter.

[0017] More preferably, the green tissue-specific expression promoter is GSSP3, and its nucleotide sequence is shown in SEQ ID NO:6. Then the nucleotide sequence of the gene encoding the autophagy-related adaptor protein containing the green tissue-specific expression promoter is shown in SEQ ID NO:7.

[0018] The above composition is used in creating cadmium-resistant rice, and the grains of the cadmium-resistant rice have low cadmium accumulation.

[0019] A method for creating cadmium-resistant rice comprises the following steps: cloning a composition into a vector to construct a recombinant vector, transforming the recombinant vector into wild-type rice, and identifying the obtained transformed seedlings.

[0020] Preferably, the method for constructing the recombinant vector comprises the following steps:

[0021] S1. Assembling the sgRNA expression cassette specifically targeting the OsHMA3 gene and the sgRNA expression cassette specifically targeting the OsLCT1 gene into a vector to construct a dual gene editing vector;

[0022] S2. using restriction endonucleases to digest the double gene editing vector obtained in step S1 to obtain a linearized double gene editing vector;

[0023] S3. The gene encoding the autophagy-related adaptor protein is cloned into the linearized double gene editing vector obtained in step S2 to obtain a recombinant vector.

[0024] Preferably, the vector is a binary vector pYLCRISPR / Cas9P ubi -H, the nucleotide sequence of which is available at NCBI (txid1648237).

[0025] Preferably, the restriction endonuclease used in the assembly of step S1 is BsaⅠ, and the obtained dual gene editing vector is pYLCRISPR / Cas9P ubi -H's BsaⅠ site is inserted into a fragment with a nucleotide sequence as shown in SEQ ID NO:8.

[0026] Preferably, the restriction endonuclease described in step S2 is PmeI, and the recombinant vector obtained in step S3 is a fragment of the nucleotide sequence shown in SEQ ID NO:9 inserted into the PmeI site of the linearized dual gene editing vector obtained in step S2.

[0027] Preferably, the gene encoding the autophagy-related adaptor protein expressed in step S3 also contains a green tissue-specific expression promoter upstream, that is, the gene encoding the autophagy-related adaptor protein expressed containing a green tissue-specific expression promoter.

[0028] More preferably, the green tissue-specific expression promoter is GSSP3, and its nucleotide sequence is shown in SEQ ID NO:6. Then the nucleotide sequence of the gene encoding the autophagy-related adaptor protein containing the green tissue-specific expression promoter is shown in SEQ ID NO:7.

[0029] Preferably, the identification is to use the DNA of the transformed seedling as a template, design primers for PCR amplification and sequencing, and confirm that the transformed seedling is successfully constructed.

[0030] More preferably, the identification method is to use the DNA of the transformed seedling as a template, use the primers as shown in nucleotide sequences such as SEQ ID NOs:24-25 to amplify the fragment with OsHMA3 T1 and T2 target sites, use the primers as shown in nucleotide sequences such as SEQ ID NOs:26-27 to amplify the fragment with OsLCT1 T1 and T2 target sites, and directly send the amplified fragment with OsHMA3 T1 and T2 target sites and the fragment with OsLCT1 T1 and T2 target sites to sequencing to determine that the double sites of oshma3 and oslct1 are successfully mutated; and then use the primers as shown in nucleotide sequences such as SEQ ID NOs:36-37 to amplify the AIM-SpMTL fragment. If the AIM-SpMTL fragment can be amplified, it indicates that the rice oshma3 oslct1 double mutant expressing the Cd-binding autophagy adaptor protein AIM-SpMTL-GFP is successfully constructed.

[0031] Application of cadmium-resistant rice obtained by any of the above methods in resisting cadmium pollution of rice.

[0032] Preferably, the resistance to cadmium pollution in rice is resistance to cadmium accumulation in rice grains and / or repair of cadmium-contaminated rice fields.

[0033] The technical solution of the present invention has the following beneficial effects:

[0034] The present invention constructs a rice oshma3 oslct1 double mutant expressing Cd binding autophagy adaptor protein AIM-SpMTL-GFP through CRISPR-Cas9, which not only reduces the transport of Cd from xylem to phloem and the accumulation in the root vacuole, but also can accumulate cadmium in the protoplast vacuole of leaves by Cd binding autophagy adaptor protein AIM-SpMTL-GFP, and reduces the Cd accumulation in grains and enriches Cd in non-edible parts such as straw to facilitate industrial processing without affecting the yield and quality of rice grains. The cadmium-resistant rice with low cadmium accumulation in grains provided by the present invention can reduce cadmium pollution in the food chain, thereby reducing the harm of cadmium to the human body. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 Binary vector pYLCRISPR / Cas9Pubi -H schematic diagram.

[0036] Figure 2 A: OsHMA3 and OsLCT1 gene editing site map and vector schematic diagram of the construction of rice oshma3 oslct1 double mutants by CRISPR-Cas9 gene editing technology. B: Schematic diagram of the vector for the oshma3 oslct1 double mutant and the vector for expressing the Cd-binding autophagy adaptor protein AIM-SpMTL-GFP, where the vector backbone is pYLCRISPR Cas9P ubi -H(KR029109), T1 on the vector schematic is OsHMA3target1, T2 is OsHMA3target2, T3 is OsLCT1 target1, T4 is OsLCT1 target2, GSSP3 is rice green tissue-specific expression promoter, AIM is ATG8 interacting motif, SpMTL is Sedum plumbizincicolaMT-like, and GFP is green fluorescent protein.

[0037] Figure 3 The following is an identification diagram of the oshma3 oslct1 double mutant. A: The mutation of the oshma3 oslct1 double mutant at the DNA level. The part in the box is the location of the PAM sequence in the gene; B: Sequencing peak diagram of the mutation site of the oshma3 oslct1 double mutant; C: Electrophoresis detection results of AIM-SpMTL-GFP in rice oshma3 oslct1 mutant plants expressing the Cd-binding autophagy adaptor protein AIM-SpMTL-GFP. Lane 1 is the marker, lane 2 is the electrophoresis detection results of AIM-SpMTL and Actin in wild-type rice DNA, lane 3 is the electrophoresis detection results of AIM-SpMTL and Actin in oshma3 oslct1 double mutant rice DNA, and lane 4 is the electrophoresis detection results of AIM-SpMTL and Actin in rice oshma3 oslct1 mutant plants expressing the Cd-binding autophagy adaptor protein AIM-SpMTL-GFP.

[0038] Figure 4 The phenotypes of cadmium-resistant rice with low cadmium accumulation in grains under cadmium treatment. A: Phenotypes of wild-type (WT) rice, oshma3oslct1 mutant rice, and oshma3 oslct1 double mutant rice expressing the Cd-binding autophagy adaptor protein AIM-SpMTL-GFP, bar is 5 cm; B: Rice plant height statistics; C: Rice root length statistics.

[0039] Figure 5 Figure 2 is the situation of cadmium accumulation in leaf vacuoles, where accc1 abcc2 is a cadmium-sensitive mutant of Arabidopsis thaliana, and AIM-SpMTL-mCherry@accc1 abcc2 is a cadmium-sensitive mutant of Arabidopsis thaliana expressing AIM-SpMTL-mCherry. a is the bright field of abcc1 abcc2 protoplasts, b is the subcellular localization of red fluorescence in abcc1 abcc2 protoplasts, c is the subcellular localization of green fluorescence in abcc1 abcc2 protoplasts, that is, the subcellular localization of Cd in abcc1 abcc2 protoplasts, d is the fusion of bright field, red fluorescence and green fluorescence expression in abcc1 abcc2 protoplasts, e is the bright field of AIM-SpMTL-mCherry@abcc1 abcc2 protoplasts, and f is the bright field of AIM-SpMTL-mCherry@abcc1 The subcellular localization of red fluorescence in abcc2 protoplasts, that is, the subcellular localization of Cd binding to the autophagy adaptor protein AIM-SpMTL-mCherry, g is the subcellular localization of red fluorescence in AIM-SpMTL-mCherry@abcc1 abcc2 protoplasts, that is, the subcellular localization of Cd in AIM-SpMTL-mCherry@abcc1 abcc2 protoplasts, h is the expression fusion of field, red fluorescence and green fluorescence in AIM-SpMTL-mCherry@abcc1 abcc2 protoplasts. Bright is bright field, mCherry emits red fluorescence, Leadmiumgreen is a cadmium-specific dye, emits green fluorescence, and bar is 20μm. DETAILED DESCRIPTION

[0040] The present invention is further described below with reference to specific examples, but the examples do not limit the present invention in any form. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0041] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0042] Example 1 Creation of oshma3 oslct1 rice double mutant

[0043] 1. Experimental Methods

[0044] 1. Construction of CRISPR-Cas9 vector for rice oshma3 oslct1 double mutant

[0045] (1) Determine the CRISPR-Cas9 gene editing site

[0046] The genome sequences of OsHMA3 (LOC4342783) and OsLCT1 (LOC9270091) were obtained from the NCBI database, and the CRISPR-Cas9 gene editing sites were determined according to the CDS sequences in the genome sequences through the website http: / / skl.scau.edu.cn / .

[0047] The OsHMA3 gene editing site is located in CDS4 and CDS5, and the sequences are TGGAGGCGGCGCAGAACAGC (OsHMA3 target1, SEQ ID NO: 10) and AGCAGGAGTGGCCCTGATCC (OsHMA3 target2, SEQ ID NO: 11), respectively; the OsLCT1 gene editing site is located in CDS3, and the sequences are GGCCATCGTCCCCATGTCGT (OsLCT1target1, SEQ ID NO: 12) and AAGGCGGCGATCGCGAG (OsLCT1 target2, SEQ ID NO: 13), respectively. The gene editing site was compared with the NCBI database by Blast sequence to determine the specificity of the gene editing site.

[0048] (2) Primer design

[0049] According to the above gene editing sites, primers were designed to construct CRISPR-Cas9 vectors for editing OsHMA3 and OsLCT1 genes. The primer sequences are shown in Table 1.

[0050] Among them, OsHMA3-T1-primer-F (SEQ ID NO: 14) and OsHMA3-T1-primer-R (SEQ ID NO: 15) were used to construct OsHMA3 target1 (SEQ ID NO: 10); OsHMA3-T2-primer-F (SEQ ID NO: 16) and OsHMA3-T2-primer-R (SEQ ID NO: 17) were used to construct OsHMA3target2 (SEQ ID NO: 11); OsLCT1-T1-primer-F (SEQ ID NO: 18) and OsLCT1-T1-primer-R (SEQ ID NO: 19) were used to construct OsLCT1target1 (SEQ ID NO: 12); OsLCT1-T2-primer-F (SEQ ID NO: 20) and OsLCT1-T2-primer-R (SEQ ID NO: 21) were used to construct OsLCT1 target2 (SEQ ID NO: 13).

[0051] Table 1 CRISPR-Cas9 primers

[0052]

[0053] (3) Construction of OsHMA3 sgRNA expression cassette and OsLCT1 sgRNA expression cassette

[0054] ① Use Hipure plasmid kits (Meiji, P1001-03C) to extract pYLsgRNA-OsU3, pYLsgRNA-OsU6a, pYLsgRNA-OsU6b and pYLsgRNA-OsU6c plasmids (same as pYLsgRNA-OsU3, pYLsgRNA-OsU6a, pYLsgRNA-OsU6b and pYLsgRNA-OsU6c in DOI: 10.1016 / j.molp.2015.04.007);

[0055] ② Using pYLsgRNA-OsU6a plasmid DNA as a template, using universal primers UF: CTCCGTTTTACCTGTGGAATCG (SEQ ID NO: 22) and OsHMA3-T1-primer-R (SEQ ID NO: 15), Phanta-max super-fidelity DNA polymerase (Novozyme, P505-d3) was used for fragment amplification by PCR to obtain the OsU6a fragment with the OsHMA3-T1 target site. The PCR reaction system was (50 μL): Phanta-max super-fidelity DNA polymerase 1 μL, UF 2 μL, OsHMA3-T1-primer-R 2 μL, 2×Phantamax buffer 25 μL, dNTP mix 1 μL, pYLsgRNA-OsU6a plasmid DNA 1 μL, ddH2O 18 μL;

[0056] ③ Use OsHMA3-T1-primer-F (SEQ ID NO: 14) and universal primer gR: CGGAGGAAATTCCATCCAC (SEQ ID NO: 23) to amplify the fragment by PCR with Phanta-max super-fidelity DNA polymerase (Novozyme, P505-d3) to obtain the OsHMA3-T1 sgRNA fragment. The PCR reaction system is (50 μL): Phanta-max super-fidelity DNA polymerase 1 μL, OsHMA3-T1-primer-F 2 μL, gR 2 μL, 2×Phanta max buffer 25 μL, dNTP mix 1 μL, pYLsgRNA-OsU6a plasmid DNA 1 μL, ddH2O 18 μL;

[0057] ④Then the sgRNA expression cassette of OsHMA3-T1 was obtained by overlap PCR. The PCR reaction system was (50 μL): Phanta-max super-fidelity DNA polymerase 1 μL, UF 2 μL, gR 2 μL, 2×Phanta max buffer 25 μL, dNTP mix 1 μL, the above-amplified OsU6a fragment with OsHMA3-T1 target 0.5 μL, the above-amplified OsHMA3-T1 sgRNA fragment 0.5 μL, and ddH2O 18 μL. The nucleotide sequence of the obtained OsHMA3-T1 sgRNA expression cassette is shown in SEQ ID NO: 1.

[0058] ⑤Using the same method as steps ② to ④, pYLsgRNA-OsU6b plasmid DNA was used as a template to obtain the OsHMA3-T2 sgRNA expression cassette, pYLsgRNA-OsU6c plasmid DNA was used as a template to obtain the OsLCT1-T1 sgRNA expression cassette, and pYLsgRNA-OsU3 plasmid DNA was used as a template to obtain the OsLCT1-T2 sgRNA expression cassette:

[0059] (A): Using pYLsgRNA-OsU6b plasmid DNA as a template, using universal primers UF (SEQ ID NO: 22) and OsHMA3-T2-primer-R (SEQ ID NO: 17), and Phanta-max super-fidelity DNA polymerase (Novozyme, P505-d3) to amplify the fragment by PCR to obtain the OsU6b fragment with the OsHMA3-T2 target site. The PCR amplification system is shown in step ②;

[0060] Then, OsHMA3-T2-primer-F (SEQ ID NO: 16) and universal primer gR (SEQ ID NO: 23) were used to amplify the fragment by PCR using Phanta-max super-fidelity DNA polymerase (Novozyme, P505-d3) to obtain a fragment with OsHMA3-T2 sgRNA. The PCR amplification system is shown in step ③.

[0061] Then, the sgRNA expression cassette of OsHMA3-T2 was obtained by overlap PCR, and the PCR amplification system was shown in step ④;

[0062] The nucleotide sequence of the obtained OsHMA3-T2 sgRNA expression cassette is shown in SEQ ID NO:2.

[0063] (B): Using pYLsgRNA-OsU6c plasmid DNA as a template, using universal primers UF (SEQ ID NO: 22) and OsLCT1-T1-primer-R (SEQ ID NO: 19), and Phanta-max super-fidelity DNA polymerase (Novozyme, P505-d3) to amplify the fragment by PCR to obtain the OsU6c fragment with the OsLCT1-T1 target site. The PCR amplification system is shown in step ②;

[0064] Then, OsLCT1-T1-primer-F (SEQ ID NO: 18) and universal primer gR (SEQ ID NO: 23) were used to amplify the fragment by PCR with Phanta-max super-fidelity DNA polymerase (Novozyme, P505-d3) to obtain a fragment with OsLCT1-T1 sgRNA. The PCR amplification system is shown in step ③.

[0065] Then, the sgRNA expression cassette of OsLCT1-T1 was obtained by overlap PCR, and the PCR amplification system was shown in step ④;

[0066] The nucleotide sequence of the obtained OsLCT1-T1 sgRNA expression cassette is shown in SEQ ID NO:3.

[0067] (C): Using pYLsgRNA-OsU3 plasmid DNA as a template, using universal primers UF (SEQ ID NO: 22) and OsLCT1-T2-primer-R (SEQ ID NO: 21), and Phanta-max super-fidelity DNA polymerase (Novozyme, P505-d3) to amplify the fragment by PCR to obtain the OsU3 fragment with the OsLCT1-T2 target site. The PCR amplification system is shown in step ②;

[0068] Then, OsLCT1-T2-primer-F (SEQ ID NO: 20) and universal primer gR (SEQ ID NO: 23) were used to amplify the fragment by PCR with Phanta-max super-fidelity DNA polymerase (Novozyme, P505-d3) to obtain a fragment with OsLCT1-T2 sgRNA. The PCR amplification system is shown in step ③.

[0069] Then, the sgRNA expression cassette of OsLCT1-T2 was obtained by overlap PCR, and the PCR amplification system was shown in step ④;

[0070] The nucleotide sequence of the obtained OsLCT1-T2 sgRNA expression cassette is shown in SEQ ID NO:4.

[0071] (4) Clone the OsHMA3-T1 sgRNA expression cassette (SEQ ID NO: 1), OsHMA3-T2 sgRNA expression cassette (SEQ ID NO: 2), OsLCT1-T1 sgRNA expression cassette (SEQ ID NO: 3), and OsLCT1-T2 sgRNA expression cassette (SEQ ID NO: 4) into pYLCRISPR / Cas9P ubi -H vector.

[0072] pYLCRISPR / Cas9P ubi The -H vector is a binary vector for plant expression. In addition to expressing the CRISPR-Cas9 enzyme, it also contains other elements required for plant expression and a transgenic selection marker ( Figure 1). Use HiPure Plasmid Kits plasmid extraction kit (Meiji, P1001-03C) to extract pYLCRISPR / Cas9P ubi -H plasmid (same as pYLCRISPR / Cas9P in DOI: 10.1016 / j.molp.2015.04.007 ubi -H), the GoldenGate cloning method based on BsaⅠ digestion and ligation was used to sequentially assemble the OsHMA3-T1 sgRNA expression cassette (SEQ ID NO: 1), OsHMA3-T2 sgRNA expression cassette (SEQ ID NO: 2), OsLCT1-T1 sgRNA expression cassette (SEQ ID NO: 3) and OsLCT1-T2 sgRNA expression cassette (SEQ ID NO: 4) into the pYLCRISPR / Cas9P ubi -H, obtain pYLCRISPR / Cas9P ubi -H-OsHMA3 OsLCT1 gene editing vector ( Figure 2 B), the nucleotide sequence of the inserted fragment is shown in SEQ ID NO:8;

[0073] The reaction system is (15 μL): 10×cutsmart 1.5 μL, 10×T4 DNA ligase buffer 1.5 μL, pYLCRISPR / Cas9P ubi -H plasmid 1 μL, OsHMA3-T1 sgRNA expression cassette 0.5 μL, OsHMA3-T2 sgRNA expression cassette 0.5 μL, OsLCT1-T1 sgRNA expression cassette 0.5 μL, OsLCT1-T2 sgRNA expression cassette 0.5 μL, BsaI 0.5 μL, T4 DNAligase 0.2 μL, ddH2O 8.3 μL.

[0074] The reaction procedure was as follows: 37°C for 5 min, 10°C for 5 min, and 20°C for 5 min as one cycle, the number of cycles was 15, and after the cycle was completed, incubate at 37°C for another 5 min.

[0075] 2. Transformation of E. coli DH5α

[0076] The ligation product was transformed into Escherichia coli DH5α at 42°C by heat shock method, and the bacterial solution was spread on LB solid medium containing 50 mg / mL Kan antibiotics and inverted in a 37°C incubator for 12 to 16 hours.

[0077] 3. Vector Identification

[0078] Pick a single colony grown on the plate and propagate it by shaking. Perform PCR identification using the bacterial solution as a template. The reaction system is (10 μL): 2×Taq master mix (dye plus) 5 μL, universal primer UF 0.5 μL, universal primer gR 0.5 μL, bacterial solution 1 μL, ddH2O 3 μL. After identification, extract the plasmid to obtain the constructed pYLCRISPR / Cas9P ubi -H-OsHMA3 OsLCT1 gene editing vector.

[0079] 4. Obtaining Transformed Seedlings

[0080] The constructed pYLCRISPR / Cas9P ubi -H-OsHMA3 OsLCT1 gene editing vector was sent to the company to transform wild-type rice, and the T0 generation of gene-transformed seedlings was obtained. After the T0 generation of transformed seedlings were planted in the field, the seeds were sown on MS medium containing 30μg / mL hygromycin. If they can grow on MS medium containing hygromycin, they are transgenic positive seedlings, thus selecting T1 generation transgenic positive seedlings.

[0081] At about 30 days of seedling stage, DNA of WT rice and oshma3 oslct1 double mutant rice was used as template, and the primers shown in Table 2 were used to amplify the genomic sequences on both sides of the target site by PCR with 2×Taq Master Mix (Dye Plus) enzyme (Novozymes, P112-03) and sequenced. The PCR reaction system was: 2×Taq master mix (dye plus) 5 μL, upstream primer 0.5 μL, downstream primer 0.5 μL, DNA 2 μL, ddH2O 2 μL; wherein primers OsHMA3-primer-F (SEQ ID NO: 24) and OsHMA3-primer-R (SEQ ID NO: 25) were used to amplify oshma3, and primers OsLCT1-primer-F (SEQ ID NO: 26) and OsLCT1-primer-R (SEQ ID NO: 27) were used to amplify oslct1, and then compared with the wild-type genomic sequence to determine that the target site had been knocked out.

[0082] Table 2 Primers used to identify oshma3 oslct1 double mutant lines

[0083]

[0084] 2. Experimental Results

[0085] The results of identification of oshma3 oslct1 double mutant strains are shown in Figure 3 A and Figure 3 As shown in B, oshma3 and oslct1. During the T1 generation identification process, there were also cases where single mutations and mutations failed. Figure 3 A and Figure 3 Panel B shows only the identification results of successful double mutations.

[0086] Example 2 Creation of a rice double mutant oshma3oslct1 expressing the cadmium-binding autophagy adaptor protein AIM-SpMTL-GFP

[0087] 1. Experimental Methods

[0088] 1.pYLCRISPR / Cas9P ubi -H-OsHMA3 OsLCT1 gene editing vector construction

[0089] First, construct pYLCRISPR / Cas9P according to the method of Example 1. ubi -H-OsHMA3 OsLCT1 gene editing vector was used as the vector backbone and digested with PmeI at 37°C for 3 h. The vector backbone was then recovered using a gel recovery kit (MeiGen, D2111-03).

[0090] 2. GSSP3::AIM-SpMTL-GFP fragment amplification

[0091] GSSP3 is a rice green tissue-specific expression promoter that can promote the specific expression of Cd-binding autophagy adaptor protein AIM-SpMTL-GFP in rice green tissues. Using the synthesized GSSP3 fragment as the template for GSSP3, Arabidopsis cDNA as the template for AIM, Sedum plumbizincicola cDNA as the template for SpMTL, and the plasmid containing GFP as the template for GFP, the primers in Table 3 were used and Phanta-max super-fidelity DNA polymerase (Novozyme, P505-d3) was used to amplify the fragments by PCR to obtain the fragments GSSP3, AIM, SpMTL and GFP.

[0092] The PCR reaction system is (50 μL): 1 μL of Phanta-max super-fidelity DNA polymerase, 2 μL of upstream primer, 2 μL of downstream primer, 25 μL of 2×Phanta max buffer, 1 μL of dNTP mix, 1 μL of template, and 18 μL of ddH2O; GSSP3-F (SEQ ID NO: 28) and GSSP3-R (SEQ ID NO: 29) are used to amplify the GSSP3 fragment, AIM-F (SEQ ID NO: 30) and AIM-R (SEQ ID NO: 31) are used to amplify the AIM fragment, SpMTL-F (SEQ ID NO: 32) and SpMTL-R (SEQ ID NO: 33) are used to amplify the SpMTL fragment, and GFP-F (SEQ ID NO: 34) and GFP-R (SEQ ID NO: 35) are used to amplify the GFP fragment.

[0093] The above fragments were first connected to AIM-SpMTL-GFP by overlap PCR, and the PCR reaction system was (50 μL): Phanta-max super-fidelity DNA polymerase 1 μL, AIM-F 1.33 μL, SpMTL-R 0.67 μL, SpMTL-F 0.67 μL, GFP-R 1.33 μL, 2×Phanta max buffer 25 μL, dNTP mix 1 μL, AIM fragment 0.33 μL, SpMTL fragment 0.33 μL, GFP fragment 0.33 μL, ddH2O 18 μL. The nucleotide sequence of the obtained AIM-SpMTL-GFP fragment is shown in SEQ ID NO:5.

[0094] Then, the overlap PCR method was used again to connect the fragment GSSP3 (SEQ ID NO: 6) and AIM-SpMTL-GFP (SEQ ID NO: 5), and the PCR reaction system was (50 μL): Phanta-max super-fidelity DNA polymerase 1 μL, GSSP3-F 2 μL, GFP-R 2 μL, 2×Phanta max buffer 25 μL, dNTPmix 1 μL, GSSP3 fragment 0.5 μL, AIM-SpMTL-GFP 0.5 μL, dH2O 18 μL. The nucleotide sequence of the GSSP3::AIM-SpMTL-GFP fragment was obtained as shown in SEQ ID NO: 7.

[0095] Table 3 Primer sequences for amplifying fragment GSSP3::AIM-SpMTL-GFP

[0096]

[0097]

[0098] 3. Homologous Recombination

[0099] The fusion fragment GSSP3::AIM-SpMTL-GFP (SEQ ID NO: 7) was constructed into pYLCRISPR / Cas9P using homologous recombination. ubi -H-OsHMA3 OsLCT1 gene editing vector, the homologous recombination reaction system (10 μL) is: GSSP3::AIM-SpMTL-GFP fragment 0.1ng, linear pYLCRISPR / Cas9P ubi -H-OsHMA3 OsLCT1 gene editing vector fragment 0.3ng, 5×TEDA 2μL, if less than 10μL, make up to 10μL with ddH2O.

[0100] 4. Transformation of E. coli DH5α

[0101] The ligation product was transformed into Escherichia coli DH5α at 42°C by heat shock method, and the bacterial solution was spread on LB solid medium containing 50 mg / mL Kan antibiotics and inverted in a 37°C incubator for 12 to 16 hours.

[0102] 5. Vector Identification

[0103] Pick a single colony grown on the plate and propagate it by shaking. Perform PCR identification using the bacterial solution as a template. After identification, extract the plasmid to obtain the constructed pYLCRISPR / Cas9P expressing the Cd-binding autophagy adaptor protein AIM-SpMTL-GFP. ubi -H-OsHMA3 OsLCT1 gene editing vector, the nucleotide sequence of its inserted fragment is shown in SEQ ID NO:9.

[0104] 6. Obtaining Transformed Seedlings

[0105] The constructed pYLCRISPR / Cas9P expressing Cd binding autophagy adaptor protein AIM-SpMTL-GFP was ubi-H-OsHMA3 OsLCT1 gene editing vector was sent to the company to transform wild-type rice, and the T0 generation of gene-transformed seedlings was obtained. The T1 generation seeds were planted on MS medium containing 30 μg / mL hygromycin. If they can grow on MS medium containing hygromycin, they are transgenic positive seedlings, and the T1 generation transgenic positive seedlings were screened. As with the identification of oshma3 oslct1 double mutant strains, at about 30 days of seedling stage, the genomic sequences on both sides of the target site were amplified by PCR using the primers shown in Tables 2 and 4 and 2×Taq Master Mix (Dye Plus) enzyme (Novozyme, P112-03) and sequenced, and then compared with the wild-type genomic sequence to determine that the target site had been knocked out by CRISPR-Cas9, and on this basis, the gene identification of Cd-binding autophagy adaptor protein AIM-SpMTL-GFP was carried out.

[0106] Using DNA of WT rice, oshma3 oslct1 double mutant rice and oshma3 oslct1 double mutant rice expressing the Cd-binding autophagy adaptor protein AIM-SpMTL-GFP as templates, the fragment AIM-SpMTL was amplified using primers AIM-SpMTL-F (SEQ ID NO: 36) and AIM-SpMTL-R (SEQ ID NO: 37) in Table 4; the fragment Actin was amplified using primers Actin-F (SEQ ID NO: 38) and Actin-R (SEQ ID NO: 39) in Table 4.

[0107] Table 4 Primer sequences

[0108]

[0109] 2. Experimental Results

[0110] Primers OsHMA3-primer-F (SEQ ID NO: 24) and OsHMA3-primer-R (SEQ ID NO: 25) were used to amplify the fragment with OsHMA3 T1 and T2 target sites, and OsLCT1-primer-F (SEQ ID NO: 26) and OsLCT1-primer-R (SEQ ID NO: 27) were used to amplify the fragment with OsLCT1 T1 and T2 target sites. The amplified fragment with OsHMA3 T1 and T2 target sites and the fragment with OsLCT1 T1 and T2 target sites were directly sent for testing. The results of DNA level identification of oshma3 oslct1 double mutant rice are shown in Figure 2. Figure 3A and B in the figure. The fragment AIM-SpMTL was amplified using primers AIM-SpMTL-F (SEQ ID NO: 36) and AIM-SpMTL-R (SEQ ID NO: 37) to obtain a fragment AIM-SpMTL with a size of 784 bp; the fragment Actin was amplified using primers Actin-F (SEQ ID NO: 38) and Actin-R (SEQ ID NO: 39) to obtain a fragment Actin with a size of 332 bp (such as Figure 3 C).

[0111] Example 3 Phenotype of restored rice with low cadmium accumulation in grains under cadmium treatment

[0112] 1. Experimental Methods

[0113] (1) Disinfection and germination of rice seeds

[0114] Select the plump WT rice, the oshma3 oslct1 double mutant rice prepared in Example 1, and the oshma3oslct1 double mutant rice seeds expressing the Cd binding autophagy adaptor protein AIM-SpMTL-GFP prepared in Example 2, wash them with clean water, soak them in 10mL 75% alcohol (v / v) for 2min, pour out the alcohol and rinse them with deionized water for 3 to 5 times, then put the rice seeds in 10mL 50% sodium hypochlorite solution and shake and soak them for 10min, discard the sodium hypochlorite soaking solution, rinse them with 10mL deionized water for more than 3 times, and fully wash the residual soaking solution. Put the disinfected seeds on moist filter paper, place them in a 28°C incubator in dark for 2d, and obtain germinated seeds.

[0115] (2) Rice cultivation

[0116] The germinated seeds were moved to a light incubator (12 h light, 28 °C, 12 h dark, 22 °C, light intensity of 300 μMol·m -2 ·s -1 , relative humidity 60%), and transplant the rice seedlings after they grow to the 2-leaf stage (about 3-5 days). Select rice seedlings with similar growth potential and culture them in hydroponic boxes, and replace the hydroponic solution (Coolaber, NS1040) every 3 days.

[0117] (3) Cd treatment hydroponics

[0118] After the seeds germinated for 14 days, they were cultured in a hydroponic solution with a Cd concentration of 2 μM. The hydroponic solution was replaced every 3 days. The seeds were cultured for 2 weeks and the root length and plant height of the rice were measured.

[0119] 2. Experimental Results

[0120] like Figure 4As shown in the data, under cadmium stress, there were significant differences in root length and plant height between the oshma3oslct1 double mutant rice expressing the Cd-binding autophagy adaptor protein AIM-SpMTL-GFP and the oshma3 oslct1 double mutant rice, which indicates that the expression of the Cd-binding autophagy adaptor protein AIM-SpMTL-GFP in rice can make rice have better cadmium tolerance.

[0121] Example 4 Cadmium-specific dyes show that Cd binds to the autophagy adaptor protein AIM-SpMTL to enrich cadmium in leaf vacuoles

[0122] 1. Experimental Methods

[0123] The material used in this example is the Arabidopsis cadmium-sensitive mutant abcc1 abcc2 into which the Cd-binding autophagy adaptor protein AIM-SpMTL-mCherry is transferred. The material is constructed by homologous recombination of the fusion fragment AIM-SpMTL-mCherry into the pEGAD vector, and the Arabidopsis cadmium-sensitive mutant abcc1 abcc2 is infected by Agrobacterium, and the homozygous plants are obtained after the seeds are screened. AIM-SpMTL-mCherry is a fusion of the fragment AIM-SpMTL and mCherry by overlap PCR, and the PCR reaction system is (50 μL): Phanta-max super-fidelity DNA polymerase high-fidelity enzyme 1 μL, AIM-F 2 μL, mCherry-R 2 μL, 2×Phanta max buffer 25 μL, dNTP mix 1 μL, mCherry fragment 0.5 μL, AIM-SpMTL 0.5 μL, dH2O 18 μL. The primers for amplification of the mCherry fragment were: mCherry-FCTCGTGCAATTGCACTAGTATGGTGAGCAAGGGCGAG (SEQ ID NO: 40), mCherry-R

[0124] TTATCTAGATCCGGTGGCTCCCTACTTGTACAGCTCGTCCATGCC (SEQ ID NO: 41).

[0125] 1. Preparation of Protoplasts

[0126] (1) Vernalization

[0127] The seeds of the homozygous strains of the Arabidopsis cadmium-sensitive mutant abcc1 abcc2 and the Arabidopsis cadmium-sensitive mutant abcc1 abcc2 transformed with the cadmium-binding autophagy adaptor protein AIM-SpMTL-mCherry were sterilized with chlorine gas (100 mL of 84 disinfectant and 3 mL of concentrated hydrochloric acid were mixed to produce chlorine gas through redox reaction) for 4 h. The sterilized seeds were added with water and placed in a 4°C refrigerator for vernalization for 2 days.

[0128] The vernalized seeds were spotted on MS solid medium containing 0.7% agarose and then placed in a 22°C light incubator for germination for 5 days. After 5 days, the seedlings on the MS medium were transplanted to soil culture. After 1 week of soil culture, ddH2O containing 50μM Cd was used for treatment for one week (irrigation with 1L ddH2O containing Cd, irrigated twice a week), and the treated Arabidopsis leaves were used to prepare protoplasts.

[0129] (2) Enzymatic hydrolysis

[0130] Prepare enzymatic hydrolysate. The preparation method is shown in Table 5.

[0131] Table 5 Formulation

[0132]

[0133] After mixing the solvent formula in Table 5 in proportion, place in a 55°C oven for 10 minutes, and take out the dissolved enzyme solution when it is transparent light brown. After cooling to room temperature, add 0.01M CaCl2 and BSA to prepare Arabidopsis protoplast hydrolyzate.

[0134] Use art tape and transparent tape to peel off the lower epidermis of the leaves, and immerse the peeled surface downward in the enzymatic solution. Place it on a shaker in the dark and dissociate at low speed (20℃, 30 rpm) for 1 to 2 hours. Use a cut 1mL pipette tip to aspirate the enzymatic solution into a round-bottom centrifuge tube and centrifuge at 100rcf for 3 minutes. Gently aspirate the supernatant, then add 5mL of W5 solution (preparation method as shown in Table 6) along the wall of the tube to wash, centrifuge at 100rcf for 3 minutes, and repeat twice.

[0135] Table 6 Formulation of W5 solution

[0136]

[0137] Then, 3-5 mL of W5 solution was added and the mixture was placed in an ice bath for 30 min. Finally, the supernatant was gently aspirated and 3-5 mL of MMg solution (preparation method is shown in Table 7) was added to prepare protoplasts.

[0138] Table 7 Formula of MMg solution

[0139]

[0140] 2. Leadmium TM Green AM Dye Arabidopsis protoplast staining

[0141] First prepare Leadmium TM Green AM Dye: Add 50 μg Leadmium to each tube TM Green AMDye, rewarm before use and protect from light. TM Add 50 μL of anhydrous DMSO to the centrifuge tube of Green AM Dye, mix well in the dark, and dissolve. Dilute the DMSO stock solution with 0.85% saline at a volume ratio of 1:10 to make a working solution. Take 1 mL of the prepared protoplasts and add 5 μL of Leadmium TM Green AM Dye working solution, incubate at 4℃ in dark for 1h, and gently shake to mix every 15-20min. Finally, wash 2-3 times with 1mL MMg solution, centrifuge at 100g for 2min at 18℃, and discard the supernatant. Resuspend the protoplasts in 1mL MMg solution, in dark for half an hour. Detect under a fluorescence microscope.

[0142] 2. Experimental Results

[0143] like Figure 5 As shown, under the microscope, it was observed that Cd in the leaf protoplasts of abcc1 abcc2 existed in the cytoplasm and did not enter the vacuole. However, in the leaf protoplasts of the cadmium-sensitive mutant abcc1 abcc2 into which the Cd-binding autophagy adaptor protein AIM-SpMTL-mCherry was transferred, green fluorescence appeared in the vacuole, indicating that Cd was localized in the vacuole, and red fluorescence also appeared in the vacuole, indicating that the Cd-binding adaptor protein AIM-SpMTL-mCherry was also localized in the vacuole. Such results indicate that the Cd-binding autophagy adaptor protein AIM-SpMTL-mCherry can successfully enter the vacuole of plant leaves, and can also bring Cd into the vacuole of plant leaves, increasing the accumulation of Cd in plant leaves through the autophagy pathway.

[0144] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A composition, characterized in that The composition comprises an sgRNA expression cassette specifically targeting the OsHMA3 gene, an sgRNA expression cassette specifically targeting the OsLCT1 gene, and a gene encoding an adaptor protein related to autophagy expression.

2. The composition according to claim 1, characterized in that The nucleotide sequence of the sgRNA expression cassette specifically targeting the OsHMA3 gene is shown in SEQ ID NOs: 1 to 2, the nucleotide sequence of the sgRNA expression cassette specifically targeting the OsLCT1 gene is shown in SEQ ID NOs: 3 to 4, and the nucleotide sequence of the gene encoding the autophagy-related adaptor protein is shown in SEQ ID NO:

5.

3. The composition according to claim 2, characterized in that The upstream of the coding gene for expressing the autophagy-related adaptor protein also contains a green tissue-specific expression promoter.

4. The composition according to claim 3, characterized in that The green tissue-specific expression promoter is GSSP3.

5. Use of the composition according to claims 1 to 4 in resisting cadmium pollution in rice.

6. A method for producing cadmium-resistant rice, characterized in that: The composition according to claims 1 to 4 is cloned into a vector to construct a recombinant vector, the recombinant vector is transformed into wild-type rice, and the obtained transformed seedlings are identified.

7. The method according to claim 6, characterized in that The identification is to use the DNA of the transformed seedling as a template, design primers for PCR amplification and sequencing, and confirm that the transformed seedling is successfully constructed.

8. The method according to claim 6, characterized in that The vector is a binary vector pYLCRISPR / Cas9P ubi -H.

9. Use of the cadmium-resistant rice obtained by the method according to any one of claims 7 to 8 in resisting cadmium pollution of rice.

10. The use according to claim 9, characterized in that: The resistance to rice cadmium pollution is to resist cadmium accumulation in rice grains and / or repair cadmium-contaminated rice fields.

Images