Molecular markers and methods for identifying the sex of Porphyra yezoensis

Abstract

This invention discloses molecular markers and methods for identifying the sex of *Porphyra yezoensis*. The female molecular marker sequence is shown in SEQ ID NO:1, and the primer PhF1 sequence for amplifying this marker is shown in SEQ ID NO:2 and SEQ ID NO:3. The male molecular marker sequence is shown in SEQ ID NO:4, and the primer PhM1 sequence for amplifying this marker is shown in SEQ ID NO:5 and SEQ ID NO:6. The identification method includes: extracting genomic DNA from the filaments or thallus of *Porphyra yezoensis*, performing PCR amplification using primers PhF1 and PhM1, detecting the amplification products by electrophoresis, and determining the sex of *Porphyra yezoensis* by the specific bands. This invention can identify the sex of *Porphyra yezoensis* thallus through PCR amplification and agarose gel electrophoresis, and simultaneously distinguish between homozygous and heterozygous filaments. The operation is simple, rapid, and unaffected by environmental factors.

Description

Technical Field

[0001] This invention belongs to the field of biological detection and seaweed genetic breeding technology, specifically relating to molecular markers and methods for identifying the sex of Porphyra tenuifolia. Background Technology

[0002] Laver (Pyropia / Porphyra spp.) is widely consumed due to its delicious taste and high nutritional value, and is cultivated on a large scale in China, Japan, and South Korea. Laver cultivation not only generates significant economic value but also plays a vital role in the ecological restoration of the cultivation areas. Currently, the laver species cultivated on a large scale in my country are Pyropia haitanensis and Pyropia yezoensis. The former is mainly cultivated in Fujian, Zhejiang, and Guangdong provinces, while the latter is cultivated in Jiangsu and Shandong provinces. In 2023, my country's laver industry covered 64,000 hectares, with an annual output of 210,000 tons, ranking first in the world. Pyropia haitanensis accounted for approximately 75% of the country's total laver production.

[0003] The life cycle of *Pyropia haitanensis* consists of two heteromorphic generations: a microscopic filamentous sporophyte (2n) and a large thallus gametophyte (n). Upon maturation, the thallus forms female (carpodium) and male (sperm) gametes, which reproduce sexually by producing carpospores. These carpospores germinate into filamentous bodies, which then mature and release conchispores, which germinate into thallus. Hybridization experiments using color mutants and wild-type thallus have confirmed that the initial two divisions of conchispore germination in *Pyropia haitanensis* are meiotic, with sex determined by a pair of alleles that segregate during meiosis. Therefore, the thallus of sexually reproduced offspring is hermaphroditic (Zhang Y, Yan XH, Aruga Y. The sex and sex determination in *Pyropia haitanensis* (Bangiales, Rhodophyta). PLoS One, 2013, 8:e73414). In addition, the thallus regenerated from isolated cells of *Porphyra yezoensis*, whether female or male, can undergo parthenogenesis, producing genetically homozygous filaments through natural chromosome doubling. The offspring thallus of the latter are parthenogenetic and fertile (Yan Xinghong, Li Lin, Chen Junhua, Yuhe Yousheng. Parthenogenesis and genetic homozygosity of *Porphyra yezoensis*. High Technology Communications, 2007, 17(2):205-210).

[0004] Under normal circumstances, the male thallus of *Porphyra yezoensis* matures earlier, while the female thallus matures relatively later. Furthermore, the timing of thallus maturity directly affects the yield and quality of the laver. Therefore, the offspring thallus of currently selected superior *Porphyra yezoensis* varieties are mostly female. However, during the breeding process, sex can only be determined after the thallus matures, which slows down the breeding process. In addition, during *Porphyra yezoensis* hybridization breeding, both heterozygous carpospores and carpospores can germinate into filaments during parthenogenesis, making it impossible to distinguish whether the selected filaments are heterozygous or homozygous. Confirmation can only be made by observing whether chimeric thallus forms appear in the offspring thallus, which is time-consuming and labor-intensive. Therefore, finding a method for early sex determination is of great value in accelerating the breeding speed of *Porphyra yezoensis*.

[0005] Currently, sex-specific molecular markers can be used to accurately identify the genetic sex of organisms. Sex-related DNA molecular markers have been developed for many economically important plants and animals, such as large yellow croaker (Larimichthys crocea), tongue sole (Cynoglossus semilaevis), asparagus (Asparagus officinalis), kelp (Saccharina japonica), and seaweed (Gracilariopsis lemaneiformis). However, to date, there is still a lack of effective molecular markers for identifying the genetic sex of *Porphyra yezoensis*. Summary of the Invention

[0006] The purpose of this invention is to provide a molecular marker and method for rapidly and accurately identifying the sex of Porphyra yezoensis.

[0007] The above-mentioned objective of the present invention is achieved through the following technical solution:

[0008] This invention provides a molecular marker for identifying the female sex of *Porphyra yezoensis*, comprising a female molecular marker and a male molecular marker; wherein:

[0009] The nucleotide sequence of the female molecular marker is shown in SEQ ID NO:1, specifically: ctgcggctgttgctgttctgacaagttgctccgtatggattggttgtgtctctcctcctggcccctcgcttgtctccctctgtacactcatgcagccatgggcatctgcgtcaccatcctcaagcgacgttgccgttccgtaggcatccacgcttggccgtaccgaaagatggccatggttgagaagaggattcagctgcgcgagacgatgctcttggatggtagcgccgagcttactgatgactcgtctgaggcgctcagggcggagatatccgagctgaagctccgtatggatctgcttcggaagaatccgaacttgaagtcaagcgacctggtctgaggtatgcctatgaccgtgttctgaacctcatgcttctgtgagtgtctatttattctccgctctcagcctgtctatctgagtggctatgaaattttggcaaacaaggcgtgtacaaagtactccgccaaggcatga;

[0010] The nucleotide sequence of the male molecular marker is shown in SEQ ID NO:4, specifically:

[0011] Preferably, the sequence of the primer PhF1 for amplifying the female molecular marker is shown in SEQ ID NO:2 and SEQ ID NO:3, specifically:

[0012] F: ctgcggctgttgctgttc (SEQ ID NO: 2);

[0013] R: tcatgccttggcggagta (SEQ ID NO: 3).

[0014] Preferably, the sequence of the primer PhM1 for amplifying the male molecular marker is shown in SEQ ID NO:5 and SEQ ID NO:6, specifically:

[0015] F: actcatgcacgtcctccctt (SEQ ID NO: 5);

[0016] R: ctcggttggaaagtctgtgg (SEQ ID NO: 6).

[0017] The present invention also provides primers for amplifying the female molecular markers or the application of primer PhF1 in identifying female or hybrid strains of Porphyra yezoensis.

[0018] The present invention also provides primers for amplifying the male molecular marker or the application of primer PhM1 in identifying male or hybrid strains of Porphyra yezoensis.

[0019] This invention also provides a method for identifying the sex of *Porphyra yezoensis*, comprising the following steps:

[0020] (1) Extract genomic DNA from the filamentous or thallus of Porphyra yezoensis;

[0021] (2) PCR amplification was performed using primers PhF1 and PhM1, respectively;

[0022] (3) Electrophoretic detection of amplification products;

[0023] 1) If only one specific band of 475bp in length can be detected in the primer PhF1 amplification product, then the filamentous body of the *Porphyra yezoensis* is determined to be homozygous and its offspring thallus is female.

[0024] 2) If only one specific band of 596 bp can be detected in the amplification product of primer PhM1, then the filamentous body of the *Porphyra yezoensis* is determined to be homozygous and its offspring thallus is male.

[0025] 3) If a specific band of 475bp and 596bp in length can be detected in the amplification products of primer PhF1 and primer PhM1, respectively, then the filamentous body of the *Porphyra yezoensis* is determined to be heterozygous, and its offspring thallus is hermaphroditic.

[0026] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0027] (1) This invention uses DNA molecular marker technology to identify the sex of Porphyra yezoensis. Only two simple PCR amplifications and agarose gel electrophoresis are needed to identify the sex of the thallus of Porphyra yezoensis and to distinguish between homozygous and heterozygous filaments. The results are accurate, reliable and unaffected by environmental factors.

[0028] (2) The molecular markers provided by this invention have advantages such as stable detection results, fast operation, good stability and low detection cost. They are used to identify the sex of the thallus of Porphyra yezoensis and have important application value in the fields of biological detection and seaweed genetic breeding. Attached Figure Description

[0029] Figure 1The images show the electrophoresis results of DNA amplification products from the filaments and thallus of female *Porphyra yezoensis* strains using female (A) and male (B) specific primers in the examples. Specifically, 1-3 are thallus of the XS-1 strain; 4-6 are thallus of the WT-10 strain; 7-9 are thallus of the SF-2 strain; 10 is filament of the XS-1 strain; 11 is filament of the WT-10 strain; 12 is filament of the SF-2 strain; and M is a 2000bp DNA ladder marker.

[0030] Figure 2 The images show the electrophoresis results of DNA amplification products from the filaments and thallus of male *Porphyra yezoensis* strains using female (A) and male (B) specific primers in the examples. Specifically, 1-3 are thallus of the HR-6 strain; 4-6 are thallus of the BA-1 strain; 7-9 are thallus of the T2-1 strain; 10 is filament of the HR-6 strain; 11 is filament of the BA-1 strain; 12 is filament of the T2-1 strain; and M is a 2000bp DNA ladder marker.

[0031] Figure 3 The electrophoresis results of DNA amplification products from heterozygous filaments and their progeny tetrachromatic thalli using female (A) and male (B) specific primers in the examples are shown. Among them, 1-6 are thalli, the progeny of heterozygous filament Z149; 7-12 are thalli, the progeny of heterozygous filament Z150; 13 is heterozygous filament Z149; 14 is heterozygous filament Z150; M is a 2000bp DNA ladder marker. Detailed Implementation

[0032] The following embodiments will further illustrate the present invention with reference to the accompanying drawings.

[0033] Example 1

[0034] This embodiment proposes a marker and method for identifying the sex of *Porphyra yezoensis*, as detailed below:

[0035] (1) DNA extraction: Genomic DNA was extracted from the filaments and leaves of Porphyra yezoensis, and the DNA quality was detected by measuring the OD value and 1% agarose gel electrophoresis.

[0036] (2) PCR amplification: Female-specific primer PhF1 and male-specific primer PhM1 were used to amplify the DNA of the filamentous and thallus of Porphyra yezoensis by PCR.

[0037] The sequences of the PhF1 primers are as follows:

[0038] F: ctgcggctgttgctgttc (SEQ ID NO: 2);

[0039] R: tcatgccttggcggagta (SEQ ID NO: 3).

[0040] The sequences of the PhM1 primers are as follows:

[0041] F: actcatgcacgtcctccctt (SEQ ID NO: 5);

[0042] R: ctcggttggaaagtctgtgg (SEQ ID NO: 6).

[0043] The PCR reaction system was as follows: 1 μL of 20 ng / μL DNA template, 12.5 μL of 2×Taq Master Mix, 1 μL each of 10 μmol / L primer-F and primer-R, and ddH2O to a final volume of 25 μL.

[0044] The reaction procedure was as follows: pre-denaturation at 94℃ for 5 min; 40 cycles: denaturation at 94℃ for 30 s, annealing (temperature depends on primers) for 30 s, extension at 72℃ for 30 s; extension at 72℃ for 10 min, and holding at 4℃.

[0045] 5 μL of PCR amplification product was taken and electrophoresed on a 1% agarose gel. The electrophoresis conditions were: 1×TAE buffer, 200V voltage, 150mA current, and 0.5h time. The electrophoretic products were then detected using a gel imaging system. The results are as follows: Figure 1-3 As shown, the PhF1 primer amplified a 475bp band in the filaments and thallus of female *Porphyra yezoensis* strains, while the PhM1 primer produced no amplification product in the female strains. Figure 1 PhF1 primers produced no extended products in the filaments and thallus of male *Porphyra yezoensis* strains, while PhM1 primers extended to a 596 bp band in male strains. Figure 2 Both PhF1 and PhM1 primers amplified bands in *Porphyra yezoensis* heterozygous filaments and their progeny tetrachimeric thallus (hermaphroditic), with sizes of 475 bp and 596 bp, respectively. Figure 3 ).

[0046] (3) Sequencing of the target band: The target band obtained in step (2) of Example 1 was recovered and sequenced. The results showed that the target band sequence of 475bp was as shown in SEQ ID NO:1 and the target band sequence of 596bp was as shown in SEQ ID NO:4.

[0047] The test results of this embodiment show that the marker bands amplified by PhF1 and PhM1 primers can be used to identify the sex of the leaf-like parts of *Porphyra yezoensis*, and can distinguish between homozygous and heterozygous filamentous parts.

[0048] In summary, the molecular markers provided by this invention can be used to identify the sex of Porphyra yezoensis. Only two simple PCR amplifications and agarose gel electrophoresis are needed to identify the sex of the thallus of Porphyra yezoensis, and to distinguish between homozygous and heterozygous filaments. The results are accurate and reliable, and are not affected by environmental factors. It has important application value in biological detection and seaweed genetic-assisted breeding.

[0049] The above description of the embodiments is intended to enable those skilled in the art to understand and use the present invention. It will be apparent to those skilled in the art that various modifications can be made to these embodiments, and the general principles described herein can be applied to other embodiments without inventive effort. Therefore, the present invention is not limited to the above embodiments. Improvements and modifications made by those skilled in the art based on the principles of the present invention, without departing from the scope of the invention, should be within the protection scope of the present invention.

Claims

1. A molecular marker for identifying the sex of *Porphyra yezoensis*, characterized in that, Includes female and male molecular markers; among which: The nucleotide sequence of the female molecular marker is shown in SEQ ID NO:1; The nucleotide sequence of the male molecular marker is shown in SEQ ID NO:

4.

2. The molecular marker for identifying the sex of *Porphyra yezoensis* according to claim 1, characterized in that, The sequences of primers PhF1 for amplifying the female molecular marker are shown in SEQ ID NO:2 and SEQ ID NO:3; the sequences of primers PhM1 for amplifying the male molecular marker are shown in SEQ ID NO:5 and SEQ ID NO:

6.

3. The application of the primers for amplifying the sex markers of claim 1, or the primers PhF1 and PhM1 of claim 2, in identifying the sex of Porphyra yezoensis.

4. A method for identifying the sex of *Porphyra yezoensis*, characterized in that, Includes the following steps: (1) Extract genomic DNA from the filamentous or thallus forms of *Porphyra yezoensis*; (2) Perform PCR amplification using primers PhF1 and PhM1 as described in claim 2, respectively; (3) Electrophoretic detection of amplification products; 1) If only one specific band of 475 bp in length can be detected in the primer PhF1 amplification product, then the filamentous body of the *Porphyra yezoensis* is determined to be homozygous and its offspring thallus is female. 2) If only one specific band of 596 bp in length is detected in the amplification product of primer PhM1, then the filamentous body of the *Porphyra yezoensis* is determined to be homozygous and its offspring thallus is male. 3) If a specific band of 475 bp and 596 bp in length can be detected in the amplification products of primer PhF1 and primer PhM1, respectively, then the filamentous body of the *Porphyra yezoensis* is determined to be heterozygous, and its offspring thallus is hermaphroditic.

Images