A SNP molecular marker associated with feed conversion efficiency in Large White pigs and its application

Abstract

The present invention discloses a SNP molecular marker related to the feed conversion rate of Large White pigs and its application, belonging to the technical field of molecular marker-assisted selection. The present invention discloses a SNP molecular marker related to the feed conversion rate of Large White pigs. The DNA samples of 5256 Large White pigs were genotyped using the Porcine 80K SNP high-density chip, and a SNP site significantly correlated with the feed conversion rate of pigs was finally screened out through genome-wide association analysis (GWAS). The site genomic version of the SNP molecular marker corresponds to position 263045504 on chromosome 1 of the Ensembl Sscrofa 11.1 reference genome. The polymorphic site is G or A. When the genotype of the site is G / G, the pig has a higher feed utilization rate.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular marker-assisted selection, and more particularly to a SNP molecular marker related to the feed conversion rate of Large White pigs and an application thereof. Background Art

[0002] Pork is one of humanity's primary sources of meat. my country is not only a major producer but also a major consumer of pork, with pork long-standing as a dominant component of the nation's meat consumption structure. Economic development, coupled with evolving market consumption patterns and consumer habits, has placed higher demands on the swine industry. Selecting superior pig breeds with high fertility, rapid growth, and superior meat quality has become a key focus of modern breeding efforts. Early breeding efforts focused primarily on phenotypes of individuals, siblings, and offspring, resulting in low efficiency and slow progress. However, with advances in molecular biology, marker-assisted selection (MAS) has been introduced and matured in breeding. Compared to traditional breeding techniques, MAS is less susceptible to environmental influences, offers shorter generation intervals, and offers higher accuracy, significantly accelerating the breeding process and improving efficiency. On this basis, thanks to the rapid development of high-throughput sequencing technology and the completion of livestock and poultry-related gene resequencing, a genome-wide association study (GWAS) method that uses single nucleotide polymorphisms (SNPs) as molecular markers and can screen SNPs related to target phenotypic trait variations across the entire genome has been increasingly used in livestock and poultry breeding, and has achieved a series of remarkable results.

[0003] Feed Conversion Ratio (FCR), a key growth trait in pigs, reflects how efficiently pigs utilize nutrients in feed to maintain metabolism, promote muscle growth, and accumulate fat. It is directly related to feed costs and is crucial to profitability. Improving pig feed efficiency is crucial for the overall advancement of the pig farming industry. Therefore, identifying SNPs associated with FCR can provide a theoretical basis and reference for subsequent pig breeding efforts.

[0004] Therefore, providing a SNP molecular marker related to the feed conversion rate of Large White pigs and its application is an urgent problem to be solved by those skilled in the art. Summary of the Invention

[0005] In view of this, the present invention provides a SNP molecular marker related to the feed conversion rate of Large White pigs and its application. The present invention genotypes the DNA of 5256 collected Large White pigs and uses the GWAS method to further screen out SNP sites significantly associated with the pig feed conversion rate trait, with the aim of providing a new molecular marker for the selection of the feed conversion rate trait of Large White pigs.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions:

[0007] Feed conversion rates were measured and recorded for 5,256 Large White pigs. DNA collected was sequenced using the Porcine 80K SNP high-density functional locus array, yielding a total of 187,255 SNP markers. After genotype quality control, the remaining 97,476 markers and 5,256 pigs were subjected to a GWAS to screen for SNPs significantly associated with pig feed conversion efficiency. A single significant SNP was identified based on the Ensemble database Sus Scrofa 11.1 reference genome, located at chr1:263045504. The nucleotide sequence is shown in SEQ ID NO.1. The SNP marker is located at position 101 of the sequence, and the polymorphic sites are either G or A. The SNP markers identified by this method can be used as molecular markers for pig feed conversion efficiency. For the chr1:263045504 locus, strains with a G / G genotype should be selected for breeding.

[0008] ATTTAACCAAGTCCCAGTTCTGGCATCTTTCTATGCCATGGGAGCCTGGTCAGCCTTGGCCTTCCACCAATTCATAAGCACTCTCATGTCCTCCTCCCCAGCCCCTAGTTACCATAATCCTATCCTTTTCTCTATGAATCTGACT CTTTTAGTTTCCACAATAAAAGGGAGATTATGCAGTATTTTCTTATTTTGAGTTTGGCATTTCACTAGCATAATGGACAAAGATGCAATAATGTAAGAGGTATAGGTTCTATGAGGTTGAACACATAGCACAATGACTCTGGT; SEQ IDNO.1.

[0009] A SNP molecular marker associated with the feed conversion rate of Large White pigs. The SNP molecular marker is located at chr1:263045504 of the genome version Ensembl Sscrofa 11.1, and the polymorphic site is G or A.

[0010] Furthermore, the nucleotide sequence containing the SNP molecular marker is shown in SEQ ID NO.1; the SNP molecular marker is located at position 101 of the nucleotide sequence shown in SEQ ID NO.1.

[0011] Furthermore, a primer for detecting the SNP molecular marker is provided, and the primer sequence is as follows:

[0012] Forward primer: 5'-ATTTAACCAAGTCCCAGTTCTGG-3'; SEQ ID NO. 2;

[0013] Reverse primer: 5'-ACCAGAGTCATTGTGCTATGTG-3'; SEQ ID NO. 3.

[0014] Furthermore, the SNP molecular marker or the primer is used in detecting the feed conversion rate trait of pigs.

[0015] Furthermore, a strain with a genotype of G / G at the chr1:263045504 locus was selected for breeding, and the strain with a genotype of G / G had a high feed utilization rate.

[0016] Furthermore, the breed of the pig is Large White pig.

[0017] Furthermore, the SNP molecular marker or the primer is used in pig genetic breeding.

[0018] Furthermore, a kit for detecting the SNP molecular marker comprises the primers according to claim 3.

[0019] Furthermore, a method for improving pig breeds comprises the following steps: detecting the SNP molecular marker on pig chromosome 1, selecting a strain with a genotype of G / G for breeding, thereby reducing the feed consumption of offspring pigs during the production process, improving feed conversion rate traits, and increasing feed utilization.

[0020] As can be seen from the above technical solution, compared with the existing technology, the present invention provides a SNP molecular marker associated with the feed conversion efficiency of Large White pigs and its application. DNA collected from 5,256 Large White pigs was genotyped using the Porcine 80K SNP high-density functional locus array. Genome-wide association analysis identified a SNP site significantly associated with the pig's feed conversion efficiency trait. This SNP is located at nucleotide position 263045504 on chromosome 1. When the genotype at this site is G / G, the pig has a higher feed utilization efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are merely embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying any creative work.

[0022] Figure 1 The attached figure shows the distribution of feed conversion efficiency phenotypes of the experimental group of Large White pigs; the horizontal axis is the phenotypic value of the experimental group;

[0023] Figure 2 The accompanying figure is a Manhattan plot of the genome-wide association analysis of feed conversion efficiency traits; the present invention selects a SNP located at chr1:263045504 with a smaller P value above the threshold line for subsequent further analysis;

[0024] Figure 3 The accompanying figure is a Q-Qplot diagram of the genome-wide association analysis of feed conversion efficiency traits;

[0025] Figure 4 The accompanying drawing shows the genotyping of 5256 Large White pigs at the SNP sites screened by the present invention; the ordinate in the figure is the phenotypic value of FCR, and the abscissa is the genotypes of the three groups GG, GA and AA. DETAILED DESCRIPTION

[0026] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0027] Example 1 Genotyping Detection

[0028] (1) Ear samples were collected from 5256 Large White pigs, DNA samples were extracted, and genotyped using the Porcine 80K SNP high-density functional locus array, resulting in a total of 187,255 SNP loci.

[0029] (2) Plink v1.90 software was used to perform quality control on the genotype data. The quality control criteria were as follows: SNP callrate > 90%, minimum allele frequency (MAF) > 0.01, mind < 0.1, geno < 0.1. Missing genotypes were then filled according to the Beagle default parameters. The filled genotype files were quality controlled again with a MAF > 0.01 standard.

[0030] (3) After quality control, 5256 individuals and 97476 SNP sites were retained for subsequent GWAS studies of feed conversion efficiency traits.

[0031] Example 2 Genome-wide association analysis of SNP sites and feed conversion efficiency traits

[0032] (1) The feed conversion rate data of 5256 large white pigs were collected and recorded using the Aoshiben production performance measurement system. The distribution is as follows: Figure 1 As shown, feed conversion efficiency was used as a phenotype in GWAS analysis.

[0033] (2) The MLM model in the rMVP package was used for analysis, adding field and sex as fixed effects and the first three PCs as covariates. The specific model was: y = Xβ + Vα + Zμ + e, where y is the phenotypic value, β is the fixed effect, α is the SNP vector, μ is the random effect, X, V, and Z are the correlation matrices, and e is the residual vector.

[0034] (3) To improve the reliability of the experimental results, the present invention uses the Bonferroni method for correction and sets the genome significance level threshold to 0.05 / N (N is the number of markers, which is 97476 in the present invention). According to the results of GWAS, the P value of each SNP site is converted to -log 10 (P), significant threshold line according to the formula -log 10 (0.05 / N) is calculated, that is, -log for each SNP site 10 When the (P) value is greater than or equal to 6.29, it indicates that there is a significant association between the SNP and the trait. Then, the Manhattan plot and QQ plot of the feed conversion rate trait were drawn using R packages such as qqman and CMplot in the R language ( Figure 2 、 Figure 3 ).

[0035] (4) The present invention further screened out a variant site with a small P value on pig chromosome 1 with accession number rs320361477 from the SNP sites on the significance threshold line. The differences in group phenotypic values ​​between different genotypes in the experimental group at this site and the distribution of the number of individuals with corresponding phenotypic values ​​are shown in Figure 2. Figure 4 For the SNP sites finally screened, lines with the genotype of G / G should be selected for breeding.

[0036] Example 3 Target DNA sequence amplification and sequencing

[0037] (1) Design primers

[0038] For SEQ ID NO.1, the following primers were designed:

[0039] Forward primer: 5'-ATTTAACCAAGTCCCAGTTCTGG-3'; SEQ ID NO. 2;

[0040] Reverse primer: 5'-ACCAGAGTCATTGTGCTATGTG-3'; SEQ ID NO. 3.

[0041] (2) PCR amplification:

[0042] PCR reaction system: To a 10 μl reaction system, add 5 μl of Taq Mix, 0.3 μl each of forward and reverse primers, 1 μl of DNA template, and 3.4 μl of ddH2O. PCR reaction conditions were: initial denaturation at 94°C for 3 min, followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 53°C for 30 s, and extension at 72°C for 30 s; and a final extension at 72°C for 5 min.

[0043] (3) DNA sequence determination:

[0044] Finally, the products amplified by PCR are sequenced, and the gene fragment sequencing requires bidirectional sequencing.

[0045] The sequencing results are shown in SEQ ID NO.4:

[0046] ATTTAACCAAGTCCCAGTTCTGGCATCTTTCTATGCCATGGGAGCCTGGTCAGCCTTGGCCTTCCACCAATTCATAAGCACTCTCATGTCCTCCTCCCCARCCCCTAGTTACCATAATCCTATCCTTTTCTCTATGAATCTGACT CTTTTAGTTTCCACAATAAAAGGGAGATTATGCAGTATTTTCTTATTTTGAGTTTGGCATTTCACTAGCATAATGGACAAAGATGCAATAATGTAAGAGGTATAGGTTCTATGAGGTTGAACACATAGCACAATGACTCTGGT; SEQ IDNO.4.

[0047] Note: R in the sequence table indicates the mutation site G / A, and the primer sequences are shown in bold at the beginning and end of the sequence.

[0048] (4) The present invention provides a method for improving the feed conversion rate trait of pigs, comprising the following steps: detecting the SNP site at the 263045504 nucleotide on pig chromosome 1, and selecting a strain with a G / G genotype at the site for breeding, thereby reducing the feed consumption of Large White pigs during the production process and improving feed utilization.

[0049] The above description of the disclosed embodiments is intended to enable one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be readily apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention is not limited to the embodiments shown herein but is intended to conform to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. Application of SNP molecular markers or amplification primers thereof in detecting feed conversion efficiency traits of pigs, characterized in that: The SNP molecular marker is located at chr1:263045504 of the genome version Ensembl Sscrofa 11.1, and its polymorphic site is G or A; the pig breed is Large White pig.

2. The use according to claim 1, characterized in that The strain with the genotype of G / G at the chr1:263045504 locus was selected for breeding. The strain with the genotype of G / G has a high feed utilization rate.

3. Application of SNP molecular markers or amplification primers thereof in genetic breeding of pig feed conversion efficiency traits, characterized in that: The SNP molecular marker is located at chr1:263045504 of the genome version Ensembl Sscrofa 11.1, and its polymorphic site is G or A; the pig breed is Large White pig.

4. The use according to any one of claims 1 to 3, characterized in that The amplification primer sequences are as follows: Forward primer: 5'-ATTTAACCAAGTCCCAGTTCTGG-3'; SEQ ID NO. 2; Reverse primer: 5'-ACCAGAGTCATTGTGCTATGTG-3'; SEQ ID NO.

3.

5. A method for improving the feed conversion efficiency of pigs, characterized in that: The following steps are involved: The SNP molecular marker located at chr1:263045504 of the genome version Ensembl Sscrofa 11.1 was detected, and the polymorphic site was G or A. A strain with a genotype of G / G was selected for breeding; the pig breed was Large White pig.

Images