Application of molecular genetic marker YZU-LAYER-MGM-1 in identifying high egg-yield chickens
Through the application of molecular genetic marker YZU-LAYER-MGM-1 and specific primer pairs, high-yielding laying hens can be identified at an early stage, solving the problems of long breeding cycle, high cost and large accuracy error in existing technologies, and realizing an efficient and accurate breeding process.
Patent Information
- Application Number
- CN202411608457.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-12
- Publication Date
- 2025-10-17
- Estimated Expiration
- 2044-11-12
AI Technical Summary
Existing technologies have problems such as long cycle, high cost, large manpower and wide error in identifying high-yielding laying hens. In addition, the accuracy error of existing egg production-related SNP sites is large, making it difficult to be widely used.
The molecular genetic marker YZU-LAYER-MGM-1, located at 2602463bp on chromosome 16, was used to determine the egg production trait through the genotypes A/A, G/A, and G/G. PCR amplification and Sanger sequencing were performed in combination with specific primer pairs to identify high-yielding laying hens at an early stage.
It realizes the early identification of high-yielding laying hens, shortens the breeding cycle, reduces breeding costs, has high accuracy, and saves labor and costs.
Smart Images

Figure CN119242821B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application relates to application of a molecular genetic marker YZU-LAYER-MGM-1 in identifying high-egg-yield chickens and belongs to the field of poultry breeding technology and gene detection. BACKGROUND
[0002] Egg yield is a key index for measuring the egg-laying performance of hens and is an important selected trait in high-egg-yield chicken breeding. Egg yield is affected by various factors, including heredity, nutrition, health status and feeding management. When the levels of the rest factors are consistent and sufficient, heredity difference is the key factor for dominating egg yield. In traditional breeding, the egg yield information of each individual needs to be tracked and recorded for a long time to guide the subsequent selection and breeding work, and there are problems of long cycle, high cost, large labor force and wide error. Therefore, early identification of high / low egg yield related genetic markers from the perspective of molecular genetics helps to accelerate the breeding process and reduce the breeding cost.
[0003] Single nucleotide polymorphism (SNP) is an important molecular genetic marker, which only involves single base variation. Based on the theory of whole genome association analysis, candidate SNP sites related to egg yield can be screened by calculation, and after accuracy verification, a detection method can be established to guide the selection of related traits. The formation of a reliable SNP genetic marker lies in: 1. accurate large-scale population phenotype information; 2. reasonable analysis and screening strategy; 3. accuracy verification. However, the existing SNP sites related to egg yield still have different degrees of accuracy error, and the detection methods are mainly based on high-cost second-generation sequencing technology, which is difficult to be widely applied. SUMMARY
[0004] The technical problem to be solved by the application is to provide application of a molecular genetic marker YZU-LAYER-MGM-1 in identifying high-egg-yield chickens, which is used for early selection of high-yield individuals and helps to accelerate the breeding process and reduce the breeding cost.
[0005] Technical scheme: In order to solve the above technical problem, the application provides application of a molecular genetic marker YZU-LAYER-MGM-1 or a detection kit containing the molecular genetic marker YZU-LAYER-MGM-1 in egg yield trait determination, and the molecular genetic marker YZU-LAYER-MGM-1 is located at 2602463bp of chromosome 16.
[0006] The genotype of the molecular genetic marker YZU-LAYER-MGM-1 is A / A, G / A or G / G.
[0007] When the genotype is A / A, the egg production trait is a high egg production trait; when the genotype is G / A, the egg production trait is a medium egg production trait; and when the genotype is G / G, the egg production trait is a low egg production trait.
[0008] The application further provides application of the molecular genetic marker YZU-LAYER-MGM-1 or a detection kit containing the molecular genetic marker YZU-LAYER-MGM-1 in identifying high egg production chickens; the molecular genetic marker YZU-LAYER-MGM-1 is located at 2602463 bp of chromosome 16.
[0009] When the genotype is A / A, the chicken to be tested is a high egg production chicken.
[0010] The application further provides application of a specific primer pair of the molecular genetic marker YZU-LAYER-MGM-1 or a kit containing the specific primer pair in determining an egg production trait; nucleotide sequences of the specific primer pair are shown in SEQ ID NO. 1 and SEQ ID NO. 2.
[0011] The method comprises the following steps: taking DNA of a chicken to be tested as a template and performing PCR amplification by using the specific primer pair; when the sequence of the amplification product shows A / A homozygous type at the 240th bp, the chicken to be tested has a high egg production trait; when the sequence of the amplification product shows G / A heterozygous type at the 240th bp, the chicken to be tested has a medium egg production trait; and when the sequence of the amplification product shows G / G homozygous type at the 240th bp, the chicken to be tested has a low egg production trait.
[0012] The application further provides application of a specific primer pair of the molecular genetic marker YZU-LAYER-MGM-1 or a kit containing the specific primer pair in identifying high egg production chickens.
[0013] The method comprises the following steps: taking DNA of a chicken to be tested as a template and performing PCR amplification by using the specific primer pair; when the sequence of the amplification product shows A / A homozygous type at the 240th bp, the chicken to be tested is a high egg production chicken.
[0014] The technical scheme of the application mainly comprises three parts: screening of a genetic marker, a detection method of the genetic marker, and verification of accuracy of the detection method.
[0015] 1. Screening of a molecular genetic marker
[0016] 1) Phenotype determination: the egg production data of different stages of 1353 Lu Dao red chickens were recorded, including egg production at 300 days of age, egg production at 301 days of age-560 days of age, egg production at 561 days of age-651 days of age, and total egg production.
[0017] 2) Genome-wide association analysis: Each individual was genotyped using a 55k gene chip. After quality control and calculation of the genome-wide significance threshold, the 55k variation information was associated with the corresponding phenotype data for genome-wide association analysis, and multiple sites significantly related to egg production at each stage were obtained. Figure 1 and Figure 2 ).
[0018] 3) Screening of candidate sites: Overlap analysis of sites significantly related to different stages found that 54 significant sites were related to egg production at 301-560 days of age, 561-651 days of age, and total egg production. Bioinformatics annotation of the 54 sites found that 30 of the Top31 sites were located on chromosome 16, with an interval of 2.47-2.64 Mb, and the 30 sites were highly linked to each other. Among them, the Top1 site chr16:2602463 (located at 2602463 bp on chromosome 16, rs740363964, reference genome GRCg6a) can be used as a Tag SNP for the 30 sites, which is a missense mutation, and multiple proteins involved in the 30 sites are enriched in various amino acid synthesis and metabolism, ATP transport, endocytosis, and cell aging-related KEGG pathways ( Figures 3-6 ). Therefore, chr16:2602463 is determined as a candidate site.
[0019] 4) Determination of the relationship between the genotype of this genetic marker and egg production
[0020] In this population, there are three genotypes at this site: A / A, G / A, and G / G, with a frequency of 0.61 for A and 0.39 for G. The average total egg production of A / A individuals is 422, that of G / A individuals is 412, and that of G / G individuals is 381, with a statistically significant difference between groups ( Figure 6 ). Therefore, it is determined that the A / A genotype at this site has high egg production traits and should be selected; the G / A and G / G genotypes at this site have medium and low egg production traits and can be eliminated.
[0021] 2. Detection method of the genetic marker
[0022] 1) Blood collection: 0.1 mL of blood was collected from the test chicken.
[0023] 2) Extraction of blood DNA: Blood DNA was extracted using a blood DNA extraction kit.
[0024] 3) PCR and product quality control: The extracted DNA was amplified by PCR using specific primers designed for the amplification. The amplified product should be a single band with a size of 340 bp, and after passing the quality control by agarose gel electrophoresis, it was used for subsequent sequencing.
[0025] 4) Product sequencing: Sanger sequencing was performed to read the base information at 240bp of the amplified product.
[0026] 5) Result determination: If A / A homozygous type is shown, it is a high egg production trait individual; if G / A heterozygous type or G / G homozygous type is shown, it is a medium or low egg production trait individual. Figure 7 ).
[0027] 3. Accuracy verification of the genetic marker detection method
[0028] Verification of the detection method was performed on another 96 individuals, and it was shown that individuals with A / A genotype at the site had higher egg production, indicating that the genetic marker and the detection method thereof in the present application could effectively identify high egg production chickens at an early stage.
[0029] The present application records the egg production information of more than 1,000 Loo Island Red chickens at different stages, and performs genotyping using a 55k gene chip. Whole genome association analysis (GWAS) is performed on egg production at different stages, and a SNP genetic marker (chr16:2602463, rs740363964, GRCg6a) highly related to egg production in the population is screened out by combining the overlap screening strategy at different stages. In the population, there are three genotypes at the SNP site: A / A, G / A, and A / A. The average total egg production of A / A individuals is 422, the average total egg production of G / A individuals is 412, and the average total egg production of G / G individuals is 381, and there is a statistical difference between groups, indicating that the A / A genotype at the site has a high egg production trait. Accordingly, the present application develops a blood DNA group detection method for the site and verifies it to realize the selection of the A / A genotype at the site. Therefore, the genetic marker and the detection method thereof can be used for early selection of individuals with high egg production traits, and can avoid the problems of long breeding cycle, high cost, large labor, and wide error in conventional breeding.
[0030] Advantages: Compared with the prior art, the present application has the following significant advantages: 1. The molecular genetic marker and the detection method thereof can identify high egg production chickens at an early stage, which can accelerate the breeding process; 2. The molecular genetic marker and the detection method thereof only need a small amount of blood sampling, and can identify high egg production chickens at an early stage, which has the advantages of convenience, high throughput, and saving labor, and can save breeding costs; if the breeding cost of one chicken from hatching to culling is 190 yuan per chicken, and according to the population gene frequency, A / A type high egg production individuals account for about 40% of the total population, then 60% of the medium and low egg production individuals can be culled at an early stage; if 10,000 chickens are raised, excluding the detection cost of the method, about 1.1 million yuan of cost can be saved (10,000 x 190 yuan / chicken x 60% - 40,000). BRIEF DESCRIPTION OF DRAWINGS
[0031] Figure 1 GWAS results of the total egg production;
[0032] Figure 2 GWAS results of the total egg production;
[0033] Figure 3 Overlap analysis of the four-stage significant associated loci;
[0034] Figure 4 chr16:2602463 can be a Tag SNP of the 30 loci revealed by LD analysis;
[0035] Figure 5 Functional enrichment of the proteins involved in the 30 loci;
[0036] Figure 6 Statistical analysis of the genotypes of the loci and the total egg production in the population, i.e., determination of the relationship between the genotypes of the genetic marker and the egg production, A / A genotype has high egg production, G / A and G / G genotypes have medium and low egg production;
[0037] Figure 7 Result interpretation of the detection method of the molecular genetic marker (chr16:2602463, GRCg6a): if the detection result is G / A double peaks at 240bp, it is determined that the genotype of the locus is G / A, as shown in a; if it is G single peak, it is determined that the genotype of the locus is G / G, as shown in b; if it is A single peak, it is determined that the genotype of the locus is A / A, as shown in c. DETAILED DESCRIPTION
[0038] The technical solutions of the present application will be further described below with reference to the accompanying drawings.
[0039] The genetic marker and its detection method of the present application can be used to identify chickens with high egg production early, and then guide the subsequent selection work.
[0040] Example 1 Screening of molecular genetic marker
[0041] 1) Phenotype determination: the egg production data of different stages of the same generation breeding population were recorded, the breed was Lo Island Red, the number of recorded data was 1353 individuals, the population was raised in Baoding City, the coordinates were 115.53, 39.46. The egg production data included: egg production at 300 days of age, egg production at 301 days of age-560 days of age, egg production at 561 days of age-651 days of age, and total egg production.
[0042] 2) Genome-wide association analysis: each individual was genotyped using a 55k gene chip (the trade name of the gene chip is "Jingxin No. 1", which is provided by Beijing Comsmart Biotechnology Co., Ltd. for detection), and the genotyping data was quality controlled (the quality control parameters were: filtering out individuals with a detection rate < 90%, filtering out gene sites with a genotype missing rate > 10% and a minimum allele frequency < 5%), and calculating the genome-wide significance threshold (1 / number of independent SNPs, the number of independent SNPs was calculated as --indep-pairwise 25 5 0.2, i.e. 25 SNPs as a sliding window and increasing by 5 SNPs each time, R 2 value greater than 0.2 with any other SNP), and using a general linear model, the variation sites after quality control were subjected to genome-wide association analysis with egg production data, and a plurality of sites significantly related to egg production at each stage were obtained. Figure 1 and Figure 2 ).
[0043] 3) Screening of candidate sites: overlap analysis of significantly related sites at different stages found that 54 significant sites were related to 301-day-old-560-day-old egg production, 561-day-old-651-day-old egg production, and total egg production. Figure 3 ). Bioinformatics annotation of the 54 sites (Table 1) found that 30 of the Top31 sites were located on chromosome 16, with a range of 2.47Mb-2.64Mb, and the 30 sites were highly linked to each other. Figure 4 ).
[0044] Table 1: 30 sites on chr16 in Top31 and their annotation information
[0045]
[0046]
[0047] Among them, the Top1 site chr16:2602463 (located at 2602463bp on chromosome 16, rs740363964, reference genome GRCg6a) can be a Tag SNP of the 30 sites, which is a missense mutation, and multiple proteins involved in the 30 sites are enriched in various amino acid synthesis and metabolism, ATP transport, endocytosis, and cell aging-related KEGG pathways. Figure 5 Therefore, chr16:2602463 was determined as a candidate site.
[0048] 4) Determination of the relationship between the genotype of the genetic marker and egg production
[0049] In this population, there are three genotypes at this locus: A / A, G / A, G / G, the frequency of A is 0.61, and the frequency of G is 0.39. The average total egg production of A / A individuals is 422, the average total egg production of G / A individuals is 412, and the average total egg production of G / G individuals is 381, and there is a statistically significant difference between groups Figure 6 ). Therefore, it is determined that the A / A genotype at this locus has a high egg production trait and should be selected; it is determined that the G / A and G / G genotypes at this locus have medium and low egg production traits and can be eliminated. Among them, the definition of high, medium and low egg production is based on the median level of population egg production. Statistically significantly higher than the median level is defined as high production, significantly lower than the median level is defined as low production, and no difference from the median level is defined as medium production.
[0050] Example 2 Detection method of the genetic marker
[0051] 1) Blood collection: Using a blood collection needle and an anticoagulant EDTA vacuum blood collection tube, 0.1-0.3 mL of blood was collected from the subclavian vein of each test chicken from 96 hens, which was used for subsequent detection.
[0052] 2) Blood DNA extraction: The blood DNA extraction kit (Tiangen, DP348) was used to extract DNA from the blood sample according to the operation procedure, the DNA concentration was determined, and the DNA concentration was controlled at about 100 ng / μL for subsequent PCR.
[0053] 3) PCR: The specific primers designed for the molecular genetic marker (chr16:2602463) were used for PCR amplification with the extracted DNA (the reagents contained are shown in Table 2). A 20 μL reaction system was used, and the reaction system composition and reaction program are shown in Tables 3 and 4. The amplification product was used for subsequent.
[0054] Table 2
[0055]
[0056]
[0057] Table 3
[0058]
[0059] Table 4
[0060]
[0061] 4) Amplification product quality inspection and sequencing: Take 1 μL of the amplification product, mix 1 μL of nucleic acid dye, and cooperate with DNA marker, and perform 1.5% agarose gel electrophoresis in batches. After electrophoresis, if a single band of 340 bp size is presented, it indicates that the quality inspection is passed and can be used for subsequent sequencing. The sequence of the amplification product is: 5'-TGGGTTTGGGGGTCTCTGT CCATATCTGGGGGTCCTCTGATGGGTTCTGGGCACTCCACTGACCCTTTGTGATTGTCTGAAGGGTTCTGGGCTCTCCATTGACCCTTTGTGATTGTCTGAAGGGTTCTGGGCTCTCCATTGACCCCTGATGGGTTTTGGAGTCGCCCCCCCAATTCCTTCCCAGCTCGCTGTTTGCCGGCTGCCGCGGTGGCCTCTTCACCTTCATCAGGTTCCGCTTC(G / A)TCT TGCGCACCCGCGACCAGCTCTTCTCCAGCCTGGTGTACCGGGACCTCGCCTTCTTCCAGAAGACCACAGCAGGTACAGACTGGGGGCACTTTTGTCC-3'.
[0062] 5) For the amplification product passed the quality inspection, Sanger sequencing is used to obtain sequencing data, and the base information at the 240th bp is read.
[0063] 6) Result determination: if A / A homozygous type is shown at this site, it is a high egg production trait individual; if G / A heterozygous type or G / G homozygous type is shown, it is a medium or low egg production trait individual. The results show that among the 96 chickens, there are 43 A / A type, 31 G / A type, and 22 G / G type. According to the result determination standard, A / A type individuals are retained, and G / A and G / G type individuals are eliminated. The egg production of the 43 A / A type individuals retained is tracked, of which 39 have higher egg production than the average of the group, belonging to high production individuals, and the accuracy rate can reach more than 90%.
Claims
1. The application of the molecular genetic marker YZU-LAYER-MGM-1 in determining the egg production trait of Luodao Red Chicken is characterized by: The molecular genetic marker YZU-LAYER-MGM-1 is located at 2602463bp on chromosome 16, rs740363964, and the reference genome is GRCg6a; the genotype of the molecular genetic marker YZU-LAYER-MGM-1 is A / A, G / A or G / G.
2. The application according to claim 1, characterized in that When the genotype is A / A, the egg production trait is a high egg production trait; when the genotype is G / A, the egg production trait is a medium egg production trait; when the genotype is G / G, the egg production trait is a low egg production trait.
3. The application of the molecular genetic marker YZU-LAYER-MGM-1 in identifying high-egg-producing Luodao Red chickens is characterized by: The molecular genetic marker YZU-LAYER-MGM-1 is located at 2602463bp on chromosome 16, rs740363964, and the reference genome is GRCg6a.
4. The application according to claim 3, characterized in that The genotype of the molecular genetic marker YZU-LAYER-MGM-1 is A / A, G / A or G / G.
5. The application according to claim 3, characterized in that: When the genotype is A / A, the chicken to be tested is a high-yielding laying hen.
6. Use of a specific primer pair for detecting the molecular genetic marker YZU-LAYER-MGM-1 according to claim 1 or a kit containing the specific primer pair in determining the egg production trait of Luodao Red chicken, characterized in that: The nucleotide sequences of the specific primer pair are shown in SEQ ID NO.1 and SEQ ID NO.
2.
7. The application according to claim 6, characterized in that The following steps are involved: The specific primer pair is used to perform PCR amplification using the DNA of the chicken to be tested as a template; when the 240 bp position of the amplified product sequence shows an A / A homozygous type, the chicken to be tested has a high egg production trait; when the 240 bp position of the amplified product sequence shows a G / A heterozygous type, the chicken to be tested has a medium egg production trait; when the 240 bp position of the amplified product sequence shows a G / G homozygous type, the chicken to be tested has a low egg production trait.
8. Use of a specific primer pair for detecting the molecular genetic marker YZU-LAYER-MGM-1 according to claim 1 or a kit containing the specific primer pair in identifying high-laying Luodao Red chickens, characterized in that: The nucleotide sequences of the specific primer pair are shown in SEQ ID NO.1 and SEQ ID NO.
2.
9. The application according to claim 8, characterized in that: The following steps are involved: The DNA of the chicken to be tested is used as a template and PCR amplification is performed using the specific primer pair; when the 240 bp position of the amplified product sequence shows an A / A homozygous type, the chicken to be tested is a high-yielding laying hen.
Citation Information
Patent Citations
SNP (Single Nucleotide Polymorphism) molecular marker for selecting egg weight of hen
CN115341035A
SNP (Single Nucleotide Polymorphism) genetic marker for influencing later laying number of chickens and application thereof
CN116083597A