Molecular marker related to activity of diploid and tetraploid Chinese cabbage seeds and application of molecular marker

Abstract

The invention discloses a molecular marker related to the activity of diploid and tetraploid Chinese cabbage seeds and application of the molecular marker, and belongs to the field of cruciferae seed activity detection. Analysis is carried out in three aspects of transcriptome, non-targeted metabolome and whole genome methylation sequencing, and finally the molecular marker BraPYL for rapidly distinguishing the activity of the diploid Chinese cabbage seed and the tetraploid Chinese cabbage seed is obtained. Through experimental verification, a specific primer pair is designed to perform PCR amplification molecular marking, and the vigor strength of the Chinese cabbage seeds can be judged according to whether an electrophoretic band only appears at 323bp or not. The molecular marker disclosed by the invention can be used for rapidly and accurately detecting high-activity Chinese cabbage seeds at low cost, and a new method is provided for assisting Chinese cabbage breeding.

Description

Technical Field

[0001] The invention relates to the field of crucifer seed vigor detection, in particular to a molecular marker related to the vigor of diploid and tetraploid Chinese cabbage seeds and an application thereof. Background Art

[0002] Chinese cabbage (Brassica rapa ssp.pekinensis, AA, 2n=2x=20) is an important vegetable crop of the genus Brassica in the family Cruciferae and is the most commonly consumed vegetable in northern China. Seed vigor is an important indicator for measuring seed quality. Seed vigor is the sum of germination rate, seedling growth potential, plant resistance and production potential. Seeds are the most basic agricultural production materials. Improving seed quality is an important measure to ensure high efficiency and high yield in agricultural production, and is of great significance to the development of agriculture and other related industries. High-vigor seeds are characterized by full maturity, full grains and good storage stability. After sowing, they have strong stress resistance, fast and uniform germination, and uniform and rapid growth, and can cultivate high-quality seedlings and plants. Therefore, high-vigor seeds have significant advantages in growth and high-yield potential, and are the primary prerequisite for modern agriculture to achieve high efficiency and high yield. At present, seed vigor has become a comprehensive indicator for testing seed quality.

[0003] Seed germination test and comprehensive analysis method can accurately determine seed vitality, but the workload is large and the cycle is long; conductivity measurement method and TTC quantitative method can quickly determine seed vitality, but the results are greatly affected by the environment and will cause seed damage. Near-infrared spectroscopy technology is in the early stage of the experiment to determine seed vitality, and the main database of seed morphological characteristics has not yet been established, so it is impossible to quickly determine the characteristic information of seeds; laser scattering technology has low stability and shallow penetration depth, but it has limitations in physical properties, chemical composition and internal sample quality, and its scope of application and effect are subject to certain restrictions. Infrared thermal imaging technology is difficult to evaluate all seeds based on specific seed parameters obtained in the experiment due to the wide variety of seeds, different structures and shapes. Traditional seed vitality determination methods mostly rely on manual operation, the process is complicated and time-consuming, and it will cause damage to the seeds, making the analyzed seeds unusable for production. PCR detection technology is a method for determining seed vitality with strong sensitivity and high specificity. Compared with traditional methods, it has the characteristics of fast speed, high accuracy, short detection cycle and low cost. At present, there is no report on the method and molecular marker for detecting the vitality of Chinese cabbage seeds using PCR technology. Summary of the invention

[0004] The purpose of the present invention is to provide a molecular marker related to the vitality of diploid and tetraploid Chinese cabbage seeds and its application to solve the problems existing in the above-mentioned prior art. The molecular marker can simply, quickly and accurately distinguish the strength of the vitality of Chinese cabbage seeds.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] The present invention provides an application of a molecular marker related to seed vitality of diploid and tetraploid Chinese cabbage in any of the following items:

[0007] (1) Application in rapid identification of diploid and tetraploid Chinese cabbage seed vigor;

[0008] (2) Application in the preparation of a kit for rapid identification of diploid and tetraploid Chinese cabbage seed vitality;

[0009] (3) Application in assisting Chinese cabbage breeding;

[0010] The nucleotide sequence of the molecular marker is shown in SEQ ID NO:1.

[0011] The invention also provides a primer pair for rapidly identifying the vigor of diploid and tetraploid Chinese cabbage seeds. The nucleotide sequence of the primer pair is shown in SEQ ID NO: 2-3. The primer pair shown in SEQ ID NO: 2-3 is used to amplify the molecular marker.

[0012] The invention also provides a kit for rapidly identifying the vigor of diploid and tetraploid Chinese cabbage seeds, which contains the primer pair.

[0013] The present invention also provides the use of the primer pair or the kit in any of the following:

[0014] (1) Application in rapid identification of diploid and tetraploid Chinese cabbage seed vigor;

[0015] (2) Application in the preparation of a kit for rapid identification of diploid and tetraploid Chinese cabbage seed vitality;

[0016] (3) Application in assisting Chinese cabbage breeding.

[0017] The present invention also provides a method for rapidly identifying the vigor of diploid and tetraploid Chinese cabbage seeds, comprising the following steps:

[0018] The genomic DNA of the Chinese cabbage seeds to be tested is obtained, and PCR amplification is performed using a primer pair. The obtained amplification product is subjected to electrophoresis, and the strength of the activity of diploid and tetraploid Chinese cabbage seeds is determined according to the electrophoresis results; the nucleotide sequence of the primer pair is shown in SEQ ID NO: 2-3.

[0019] Preferably, the reaction system of the PCR amplification is: 5 μL of 2×Taq Master Mix, 1 μL of primer pair, 1 μL of genomic template DNA and 3 μL of sterile ultrapure water.

[0020] Preferably, the reaction procedure of the PCR amplification is: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 30 s, 40 cycles; 72°C for 5 min; and storage at 4°C.

[0021] Preferably, the judgment method is: when the electrophoresis result shows only one band at 323 bp, the vitality of the Chinese cabbage seeds to be tested is strong; when the electrophoresis result shows no band at 323 bp, the vitality of the Chinese cabbage seeds to be tested is weak.

[0022] The present invention also provides a method for detecting high-vigor seeds of diploid and tetraploid Chinese cabbage seeds, comprising the steps of amplifying genomic DNA of the Chinese cabbage seeds to be tested using a primer pair, and retaining the Chinese cabbage seeds in which only one band appears at 323 bp during electrophoresis of the amplified product; the nucleotide sequence of the primer pair is shown in SEQ ID NO: 2-3.

[0023] The present invention discloses the following technical effects:

[0024] The molecular marker BraPYL for identifying the vitality of Chinese cabbage seeds provided by the present invention can be used to observe the presence or absence of the electrophoresis band at 323 bp by PCR amplification, and can judge the strength of the vitality of Chinese cabbage seeds. The molecular marker provided by the present invention can be applied to molecular marker-assisted breeding of Chinese cabbage seed vitality, and can conveniently and efficiently screen out Chinese cabbage varieties with strong seed vitality, save costs and increase efficiency, and promote the breeding process of Chinese cabbage, which has important theoretical and practical significance for cultivating new varieties of Chinese cabbage with strong seed vitality. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0026] Figure 1 The results of BraPYL molecular marker gel electrophoresis for diploid and tetraploid Chinese cabbage seed vigor; 1: Marker500, 2: 2019 Multivitamin 462, 3: 2023 Multivitamin 462, 4: 2019 Jibai No. 6, 5: 2023 Jibai No. 6, 6: 2015 Jibai No. 55, 7: 2023 Jibai No. 55;

[0027] Figure 2These are the results of BraPYL fluorescence quantitative analysis of diploid and tetraploid Chinese cabbage seed vitality; 22-year JB4F: indicates germinated seeds of Jibai No. 4 in 2022, 14-year JB4F: indicates germinated seeds of Jibai No. 4 in 2014, 14-year JB4W: indicates non-germinated seeds of Jibai No. 4 in 2014, 19-year 462F: indicates germinated seeds of Duowei 462 in 2019, 19-year 462W: indicates non-germinated seeds of Duowei 462 in 2019, 23-year 462F: germinated seeds of Duowei 462 in 2023, 23-year 462W: non-germinated seeds of Duowei 462 in 2023. DETAILED DESCRIPTION

[0028] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0029] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0030] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0031] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0032] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0033] The samples used in the experiment of the present invention are 2019 Multivitamin 462, 2023 Multivitamin 462, 2019 Jibai No. 6, 2023 Jibai No. 6, 2015 Jibai 55, 2023 Jibai 55, 2014 Jibai No. 4, and 2022 Jibai No. 4, which are provided by the Leafy Vegetable Research Laboratory, Institute of Economic Crops, Hebei Academy of Agricultural and Forestry Sciences. The above varieties are used to determine seed vigor.

[0034] Example 1

[0035] 1. Test materials

[0036] The experimental materials are 2019 Multidimensional 462, 2023 Multidimensional 462, 2019 Jibai No. 6, 2023 Jibai No. 6, 2015 Jibai 55 and 2023 Jibai 55.

[0037] 2. Seed vitality identification

[0038] 200 seeds of the Chinese cabbage seeds were randomly selected and placed in a culture dish filled with filter paper. The filter paper was soaked with water and placed in a 25°C incubator. The germination rate was counted after 48 hours. During this period, the filter paper was kept moist to avoid affecting the test results.

[0039] Table 1 Statistical results of germination rate of diploid and tetraploid Chinese cabbage

[0040]

[0041] 3. Plant DNA extraction

[0042] DNA from Chinese cabbage seedling samples of 2019 Duowei 462, 2023 Duowei 462, 2019 Jibai 6, 2023 Jibai 6, 2015 Jibai 55 and 2023 Jibai 55 were extracted using the CTAB method.

[0043] 4. Identification of molecular markers for seed vitality of diploid and tetraploid Chinese cabbage

[0044] 200 seeds of the above varieties were randomly selected and placed in a culture dish with filter paper. The filter paper was soaked with water and placed in a 25℃ incubator. After 48 hours, the germination rate was counted, and the germinated and ungerminated seeds were classified for second-generation sequencing. The analysis was carried out through transcriptome, non-targeted metabolome and whole genome methylation sequencing (WGBS). In particular, ABA-related genes, including 7 ABF genes, 18 PYR / PYL genes, 6 SRK genes and 2 PP2C genes, were studied in depth. Primer pairs were designed for these 33 genes using primer 5, and 6 pairs of related primers were designed for each gene, for a total of 198 pairs. Finally, the differential gene BraPYL (accession number: XM009103240), a molecular marker for seed vitality of diploid and tetraploid Chinese cabbage, was screened out.

[0045] Amplified 323 bp sequence (SEQ ID NO: 1):

[0046] TCGCCCAACGCATCCAGTCCCCTCCGGAGACCGTCTGGTCCGTCGTGAGACGCTTCGAC

[0047] CGTCCCCAGATTTACAAACACTTCATCAAAAGATGCTCCGTCGAAGAAGGCTTCGAGAT

[0048] GCGAGCAGGGTGCACGCGCTACGTGGACGTGATCAGCGGCCTTCCGGCGAACACGTCG

[0049] AGGGAGAGGCTCGATCTCCTCGACGACGAGCGGAGAGTGACGGGGTTTAGCATCACCG

[0050] GAGGCGAGCACAGGCTGAGGAATTACAAGTCGGTGACGACGGTTCATGGGTTCGAGAGAGATGGACGGATCTGGACCGTTGTTCTTGAA.

[0051] Then, using BraPYL as a molecular marker, PCR amplification was used to detect the vigor of diploid and Chinese cabbage seeds as follows:

[0052] Using the Chinese cabbage seedling sample DNA as a template, a PCR amplification reaction was performed using the specific primer pair shown to obtain a PCR amplification product; the sequence of the specific primer pair is as follows:

[0053] BraPYL-1-F: 5'-TCGCCCAACGCATCCAGT-3' (SEQ ID NO: 2);

[0054] BraPYL-1-R: 5'-TTCAAGAACAACGGTCCAG-3' (SEQ ID NO: 3).

[0055] The reaction system for PCR amplification was (10 μL): 5 μL of 2× Taq Master Mix, 0.5 μL of each specific primer pair, 1 μL of 300-500 ng / μL Chinese cabbage genomic template DNA, and 3 μL of sterilized ultrapure water;

[0056] The reaction program of PCR amplification was as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 30 s, 40 cycles; 72°C for 5 min; and storage at 4°C for future use.

[0057] The specific method for determining vitality is: when the electrophoresis result shows only one band at 323 bp, and the band is clear and bright without any other bands, the vitality of the Chinese cabbage seed material is strong; when the electrophoresis result shows no band at 323 bp, the vitality of the Chinese cabbage seed material is weak (see Figure 1 ).

[0058] The above results are consistent with the results of direct determination of seed germination rate in Table 1, indicating that BraPYL can be used as a molecular marker to identify the vigor of diploid and tetraploid Chinese cabbage seeds.

[0059] According to the electrophoresis results, cabbage seeds with only one band at 323bp can be selected to obtain cabbage seeds with high vitality, which is of great significance for assisting the breeding of new cabbage varieties.

[0060] Example 2

[0061] 1. Test materials

[0062] 2019 Multidimensional 462, 2023 Multidimensional 462, 2014 Jibai No. 4, 2022 Jibai No. 4.

[0063] 2. Seed vitality identification

[0064] Randomly select 200 of the above-mentioned Chinese cabbage seeds and place them in a culture dish filled with filter paper. Soak the filter paper with water and count the germination rate after 48 hours. During this period, keep the filter paper moist to avoid affecting the test results.

[0065] Table 2 Statistical results of germination rate of Duowei 462 and Jibai 4 in different years

[0066]

[0067]

[0068] 3. Plant RNA extraction

[0069] The samples were collected according to the names of the Chinese cabbage samples in Table 2 above, with 3 replicates for each sample and 3 replicates for each replicate. Plant RNAKit Extraction.

[0070] 4. Identification of the vitality of tetraploid Chinese cabbage seeds by fluorescence quantitative PCR

[0071] Fluorescence quantitative PCR specific primers for identifying the molecular marker BraPYL2 for seed vigor of diploid and tetraploid Chinese cabbage, the upstream primer sequence of the specific primer pair is as follows:

[0072] BraPYL-2-F: 5'-GCACAGGCTGAGGAATTACAAGTC-3' (SEQ ID NO: 4);

[0073] BraPYL-2-R: 5'-CGATTCAAGAACAACGGTCCAGATC-3' (SEQ ID NO: 5).

[0074] Omega EZNA plant RNAKit extraction; using cabbage seedling sample RNA as template and One-Step gDNA Removal and CDNA Synthesis Super Mix Kit was used to reverse the process and obtain cDNA.

[0075] Using the CDNA of Chinese cabbage seedling samples as template, the specific primer pairs shown were used to perform fluorescence quantitative PCR amplification reaction to obtain PCR amplification products;

[0076] The reaction system for PCR amplification (20 μL) included 10 μL of 2×SYBR Green qPCR Master Mix, 1 μL of 1×ROX, 0.5 μL of each specific primer pair, 1 μL of Chinese cabbage genomic template cDNA (<100 ng / μL), and 7 μL of sterilized ultrapure water.

[0077] The reaction procedure of the PCR amplification is: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 10 s, annealing at 60°C for 30 s, 40 cycles; storage at 4°C for future use. The cabbage ACT gene was used as the internal reference gene, and three biological replicates were set for each sample. -ΔΔCt The relative expression level of the target gene was calculated by the method. The reference gene of Chinese cabbage is:

[0078] BrActin-F: 5'-CATGGAGATAGACGAGTG-3' (SEQ ID NO: 6);

[0079] Actin-R: 5'-CCTCTCTCATCATCATCATC-3' (SEQ ID NO: 7);

[0080] The results were analyzed using Excel and Origin.

[0081] This example measured the relative expression of the BraPYL gene in material strains of different years, including 2022 Jibai No. 4 (wild type), 2014 Jibai No. 4, 2019 Multidimensional 462, and 2023 Multidimensional 462. According to the Ct results detected by the real-time fluorescence quantitative PCR instrument, 2 -ΔΔCt Values, such as Figure 2 shown.

[0082] The results showed that the BraPYL gene expression level in JB4F in 22 years, JB4F in 14 years and 462F in 23 years was significant a, and the expression levels of the remaining genes were significant b. In Chinese cabbage of different years, the expression level of the target gene in the germinated seeds was significantly higher than that in the ungerminated seeds.

[0083] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. Use of a molecular marker related to seed vigor of diploid and tetraploid Chinese cabbage in any of the following: (1) Application in rapid identification of diploid and tetraploid Chinese cabbage seed vigor; (2) Application in the preparation of a kit for rapid identification of diploid and tetraploid Chinese cabbage seed vitality; (3) Application in assisting Chinese cabbage breeding; The nucleotide sequence of the molecular marker is shown in SEQ ID NO:

1.

2. A primer pair for rapid identification of diploid and tetraploid Chinese cabbage seed vigor, characterized in that: The nucleotide sequence of the primer pair is shown in SEQ ID NO: 2-3. The primer pair shown in SEQ ID NO: 2-3 is used to amplify the molecular marker according to claim 1.

3. A kit for rapidly identifying the vigor of diploid and tetraploid Chinese cabbage seeds, characterized in that: Containing the primer pair according to claim 2.

4. Use of the primer pair according to claim 2 or the kit according to claim 3 in any of the following: (1) Application in rapid identification of diploid and tetraploid Chinese cabbage seed vigor; (2) Application in the preparation of a kit for rapid identification of diploid and tetraploid Chinese cabbage seed vitality; (3) Application in assisting Chinese cabbage breeding.

5. A method for rapidly identifying the vigor of diploid and tetraploid Chinese cabbage seeds, characterized in that: The following steps are involved: The genomic DNA of the Chinese cabbage seeds to be tested is obtained, and PCR amplification is performed using a primer pair. The obtained amplification product is subjected to electrophoresis, and the strength of the activity of diploid and tetraploid Chinese cabbage seeds is determined according to the electrophoresis results; the nucleotide sequence of the primer pair is shown in SEQ ID NO: 2-3.

6. The method according to claim 5, characterized in that The reaction system of the PCR amplification is: 5 μL of 2×Taq MasterMix, 1 μL of primer pair, 1 μL of genomic template DNA and 3 μL of sterile ultrapure water.

7. The method according to claim 5, characterized in that The reaction procedure of the PCR amplification is: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 30 s, 40 cycles; 72°C for 5 min; and storage at 4°C.

8. The method according to claim 5, characterized in that The judgment method is: when the electrophoresis result shows only one band at 323 bp, the vitality of the Chinese cabbage seeds to be tested is strong; when the electrophoresis result shows no band at 323 bp, the vitality of the Chinese cabbage seeds to be tested is weak.

9. A method for detecting high-vigor seeds of diploid and tetraploid Chinese cabbage seeds, characterized in that: The method comprises the steps of using a primer pair to amplify the genomic DNA of the Chinese cabbage seeds to be tested, and retaining the Chinese cabbage seeds with only one band at 323 bp in the electrophoresis of the amplified product; the nucleotide sequence of the primer pair is shown in SEQ ID NO: 2-3.

Images