InDel molecular marker tightly linked to peanut oil content trait, primer pair for detecting the molecular marker and its application

Abstract

The present invention discloses an InDel molecular marker closely linked to the oil content trait of peanuts, a primer pair for detecting the molecular marker and an application thereof, and belongs to the technical field of molecular marker-assisted breeding. The InDel marker of the present invention is Arahy36753720; the nucleic acid sequence of the Arahy36753720 molecular marker is shown in SEQ ID NO: 1. The method for predicting the oil content of peanuts by detecting the molecular marker of the present invention is fast and simple, has high selection efficiency, can be directly realized by PCR amplification and electrophoresis, and has important application value in predicting the oil content of peanuts and breeding high-oil-content peanuts.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular marker-assisted breeding, and in particular relates to an InDel molecular marker closely linked to a peanut oil content trait, a primer pair for detecting the molecular marker and an application thereof. Background Art

[0002] As one of the important oil crops, peanut oil content is an important indicator for evaluating high-oil germplasm. Peanut oil content is a quantitative trait, and phenotypic variation is continuous and controlled by multiple genes. When detected by near-infrared instruments, there are errors in the detection process due to the gaps between peanut kernels. Secondly, the oil composition in peanuts will also change over time. Only physical detection methods cannot truly analyze its control mechanism of oil synthesis. Therefore, exploring its high-oil-related molecular markers is of great theoretical significance for mining excellent genetic loci of peanuts and breeding new high-oil peanut varieties. So far, many molecular markers related to peanut quality traits have been cloned, including amino acids, oleic acid, and sucrose; but there are few studies on the positioning of high-oil related genes in peanuts. Based on the development and improvement of peanut genome data platform and high-throughput sequencing, the whole genome data of tetraploid wild species and tetraploid cultivated species can also be publicly available, which makes researchers' grasp of peanut genome data more and more perfect, making the fine positioning and map cloning of genes possible. Summary of the invention

[0003] In view of the problems existing in the prior art, the purpose of the present invention is to provide an InDel molecular marker tightly linked to the peanut oil content trait, a primer pair for detecting the molecular marker and its application.

[0004] In order to achieve the above object, the present invention adopts the following technical solution:

[0005] An InDel molecular marker tightly linked to the peanut oil content trait, the molecular marker is Arahy36753720; its nucleic acid sequence is shown in SEQ ID NO: 1.

[0006] The application of the above-mentioned InDel molecular markers tightly linked to the peanut oil content trait is at least one of ac;

[0007] a. for preparing a reagent for predicting the oil content of peanuts;

[0008] b. Used to predict the oil content of peanuts;

[0009] c. Used for breeding high oil content peanuts.

[0010] Based on the above scheme, the reagent for predicting peanut oil content comprises a primer pair for detecting the molecular marker Arahy36753720.

[0011] Based on the above scheme, the primer pair for detecting the Arahy36753720 molecular marker is shown as SEQ ID NO:2 and SEQ ID NO:3.

[0012] On the basis of the above scheme, when used to predict the oil content of peanuts, the genomic DNA of the peanut to be tested is used as a template, and the primer pair shown in SEQ ID NO: 2 and SEQ ID NO: 3 is used to perform PCR amplification, and the amplified product is detected;

[0013] When the amplified product is a single band of 274 bp, the peanut sample to be tested is a low-oil peanut variety;

[0014] When the amplified product is a single band of 252 bp, or two bands of 274 bp and 252 bp, the peanut sample to be tested is a high-oil content peanut variety.

[0015] On the basis of the above scheme, the method for breeding high-oil peanuts is to use the Arahy36753720 molecular marker to identify or screen high-oil peanut varieties in a population during the breeding process.

[0016] On the basis of the above scheme, the high oil content peanut breeding method is as follows:

[0017] High-oil and low-oil peanut varieties are used as parents for hybridization, and peanut materials with an oil content of ≥54% in the F1 generation hybrid are screened by near-infrared spectroscopy; the screened F1 with high-oil traits are self-pollinated to obtain F2; F2 is continuously self-pollinated to construct a recombinant inbred line population through the single-seed transmission method, and after each self-pollination, individual plants with good comprehensive traits are selected, and the oil phenotype is identified by the Arahy36753720 molecular marker to screen peanut lines with good comprehensive traits and stable high-oil traits in the population for use as propagation materials.

[0018] On the basis of the above scheme, when the Arahy36753720 molecular marker is used to identify or screen high-oil peanut varieties in a population during breeding, the genomic DNA of the peanut to be tested is used as a template, and the primer pair shown in SEQ ID NO: 2 and SEQ ID NO: 3 is used to perform PCR amplification, and the amplified product is detected;

[0019] When the amplified product is a single band of 274 bp, the peanut sample to be tested is a low-oil peanut variety;

[0020] When the amplified product is a single band of 252 bp, or two bands of 274 bp and 252 bp, the peanut sample to be tested is a high-oil content peanut variety.

[0021] A primer pair for detecting the above-mentioned InDel molecular marker closely linked to the peanut oil content trait, detecting

[0022] The primer pair for the Arahy36753720 molecular marker is shown in SEQ ID NO:2 and SEQ ID NO:3.

[0023] Advantages of the technical solution of the present invention

[0024] (1) The present invention develops a peanut high and low oil gene related locus and provides a molecular marker Arahy36753720 linked to the high and low oil content of peanut.

[0025] (2) The method for predicting peanut oil content by detecting the molecular markers of the present invention is fast and simple, with high selection efficiency. It can be directly realized by PCR amplification and electrophoresis. It only needs to detect the size of the amplified bands of these markers. The technical requirements are simple and can be operated using conventional instruments. It has the characteristics of being fast, efficient and low cost. The purposeful screening of high-oil peanut varieties or strains is helpful for the precise positioning and cloning of genes on the one hand, and has important application value for peanut molecular breeding and accelerating the breeding process of high-oil peanut strains on the other hand.

[0026] (3) Assisted breeding selection has clear goals and saves costs. By marking and detecting high-oil gene loci in peanuts, individual plants with high oil content can be identified after the seeds are harvested, and then selected and retained while other individual plants are eliminated. This can effectively control the breeding scale and improve the progress and efficiency of high-oil variety selection breeding.

[0027] In summary, the method for predicting the oil content of peanuts by detecting the molecular markers of the present invention is rapid and simple, has high selection efficiency, can be achieved directly through PCR amplification and electrophoresis, and has important application value in predicting the oil content of peanuts and breeding high-oil content peanuts. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 It is the phenotype of high-oil peanut variety YH14, where (a) is the appearance of Yuhua 14, and (b) is the detection picture of oil content in Yuhua 14 cells;

[0029] Figure 2 The phenotype of the low-oil peanut variety AT215, wherein (a) is the appearance of AT215, and (b) is the detection diagram of the oil content of AT215 cells;

[0030] Figure 3 Detection results of molecular marker Arahy36753720 in some offspring materials. DETAILED DESCRIPTION

[0031] The terms used in the present invention, unless otherwise specified, generally have the meanings commonly understood by those of ordinary skill in the art. The present invention will be further described in detail below in conjunction with specific examples and with reference to data. The following examples are intended to illustrate the present invention and are not intended to limit the scope of the present invention in any way.

[0032] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The experimental materials, reagents, drugs, etc. used in the following examples, unless otherwise specified, can all be purchased through general channels.

[0033] In the following examples, the molecular marker Arahy36753720 was obtained by the following method:

[0034] The high-oil parent Yuhua 14 and the low-oil parent AT215 of peanut were selected for hybridization to obtain F1 hybrids. The F1 hybrids were planted and the individual plants in the F2 generation population were self-pollinated for multiple generations to obtain a recombinant inbred line population for the location of high and low oil genes in peanut.

[0035] 29 high-oil and low-oil peanuts were selected from the recombinant inbred line population, young leaves of peanuts were selected during the growth period of peanuts, and the two extreme parents were selected and mixed with 29 high-oil and low-oil families in the RIL population in equal amounts to construct 4 high-oil and low-oil and high-low-oil parent extreme mixed pools, and the parents Yuhua 14 and AT215 and the two extreme mixed pools were sent to the company for genome resequencing. By calculating the △SNP-index value and ED value of the two extreme individual mixed pools, 95% and 99% confidence levels were selected as the most screening thresholds, and finally the high-oil and low-oil genes were initially located between 31572856bp and 452738888bp on chromosome 8, with a total length of about 13.70Mb.

[0036] Based on the possible polymorphic markers between the parents of BSA-seq, molecular markers were further developed in the candidate interval. 60 InDel markers were developed based on the genome resequencing results between the two parents. Seven pairs of InDel markers with possible polymorphism were obtained through polymorphism analysis. Genotype detection was performed on the segregated population. The phenotypic results were statistically analyzed based on the high and low oil phenotypes of each plant. The high and low oil related genes were located within a length of about 2.68Mb from 34070439bp to 36753720bp on chromosome 8. According to the one-to-one correspondence between phenotype and genotype, Arahy36753720 was closely linked to the high and low oil phenotypes of peanut.

[0037] Example 1

[0038] A molecular marker tightly linked to peanut oil content-related traits, the molecular marker is Arahy36753720. The nucleic acid sequence of Arahy36753720 is shown in SEQ ID NO:1.

[0039] SEQ ID NO:1(5'→3')

[0040] ACTTATAATTTGTTGTTTATTT

[0041] The nucleic acid sequences of the primers for detecting the above molecular markers are shown in SEQ ID NO:2 and SEQ ID NO:3.

[0042] Arahy36753720-F: 5'-GACAATGTGGTTCAGCGGAT-3' (SEQ ID NO: 2);

[0043] Arahy36753720-R: 5'-TACAGCAAACACTGCGAACG-3' (SEQ ID NO: 3).

[0044] Using peanut genomic DNA as a template and using a primer pair for detecting the Arahy36753720 molecular marker for amplification, if the amplified product is a single band of 274 bp (SEQ ID NO: 4), the peanut sample to be tested is a low-oil peanut variety; if the amplified product is a single band of 252 bp (SEQ ID NO: 5), or two bands of 274 bp (SEQ ID NO: 4) and 252 bp (SEQID NO: 5), the peanut sample to be tested is a high-oil peanut variety.

[0045] SEQ ID NO:4(5'→3')

[0046] GACAATGTGGTTCAGCGGATTATTTTGTTTGTTAGGTAGTTTAATGGGTAATGTTGGAGTGTGGAAGTTAGTTAGAATGGTGTGTGGTATTTTGGGAATATTTGGGATGGCCGGAACTTATAATTTGTTGTTTATTT ACGCGGCGGAGTTGTTTCCTACAGTGGTCAGGAACGCGGCACTTGGGGTGCGCCACGCAAGCGGTGCAAATGGGGGCGATATTGTGCCGGTGGTGGTGGTTTTGGGTGGCTGGTTGCCGTTCGCAGTGTTTGCTGTA

[0047] SEQ ID NO:5(5'→3')

[0048] GACAATGTGGTTCAGCGGATTATTTTGTTTGTTAGGTAGTTTAATGGGTAATGTTGGAGTGTGGAAGTTAGTTAGAATGGTGTGTGGTATTTTGGGAATATTTGGGATGGCCGGAACGCGGCGGAG TTGTTTCCTACAGTGGTCAGGAACGCGGCACTTGGGTGCGCCACGCAAGCGGTGCAAATGGGGGCGATATTGTCGCCGGTGGTGGTGGTTTTGGGTGGCTGGTTGCCGTTCGCAGTGTTTGCTGTA

[0049] Example 2

[0050] Application of Arahy36753720 molecular marker in the prediction of peanut oil content

[0051] (1) Extracting genomic DNA from peanuts to be tested

[0052] Use a surgical blade to cut about 0.12g of cotyledon tissue slices (preferably without affecting seed germination) from the peanut kernel to be tested away from the embryonic root and place them in a 1.5mL centrifuge tube. Use the CTAB method or other existing methods to extract peanut genomic DNA, dissolve it in 50μL sterile water, and use a spectrophotometer and gel electrophoresis to detect the concentration and quality of the DNA.

[0053] (2) Using the genomic DNA extracted as described above as a template, PCR amplification was performed using primers for detecting the Arahy36753720 molecular marker; the nucleic acid sequences of the primers for detecting the Arahy36753720 molecular marker are shown in SEQ ID NO: 2 and SEQ ID NO: 3.

[0054] The PCR amplification reaction system is: 1 μL of DNA template (100-200 ng / μL), 10 μL of 2×SuperTaq StarMix for PAGE (Dye), 1 μL of PCR forward primer, 1 μL of PCR reverse primer, and add water to 20 μL.

[0055] The PCR reaction program was as follows: pre-denaturation at 95°C for 2 min; 35 cycles of 95°C for 15 s, 56°C for 15 s, and 72°C for 15 s; and extension at 72°C for 5 min.

[0056] (3) PCR amplification products were detected by 8% non-denaturing polyacrylamide gel (Acr:Bis=39:1) electrophoresis. After electrophoresis, color development was performed and the detection results were scanned and photographed.

[0057] If the amplified product shows a single band of 274 bp (SEQ ID NO: 4), it is marked as A, and the peanut sample to be tested is a low-oil peanut variety. If the amplified product shows a single band of 252 bp (SEQ ID NO: 5), it is marked as B; or two bands of 274 bp (SEQ ID NO: 4) and 252 bp (SEQ ID NO: 5), it is marked as H, and the peanut sample to be tested marked as B or H is a high-oil peanut variety.

[0058] Example 3

[0059] Correlation between the molecular marker Arahy36753720 and the oil content phenotype of peanut

[0060] 54 peanut varieties were used as samples to be tested, and genomic DNA of the samples to be tested was extracted. The genomic DNA was used as a template, and the Arahy36753720 molecular marker of the peanut varieties to be tested was detected using the method of Example 2 to obtain the genotypes of different peanut samples. If a single band of 274 bp (SEQ ID NO: 4) appeared in the amplification product, it was recorded as A, and the peanut sample to be tested was a low-oil peanut variety. If a single band of 252 bp (SEQ ID NO: 5) appeared in the amplification product, it was recorded as B; or two bands of 274 bp (SEQ ID NO: 4) and 252 bp (SEQ ID NO: 5) appeared, which were recorded as H. The peanut sample to be tested marked as B or H was a high-oil peanut variety.

[0061] The oil content of the peanut varieties was detected by near infrared spectroscopy scanning method. The correlation between genotype and oil content phenotype is shown in Tables 1 and 2 below.

[0062] Table 1 Comparison of Arahy36753720 molecular marker and low-oil peanut genotype and phenotype

[0063]

[0064]

[0065] Table 2 Comparison of Arahy36753720 molecular marker and high oil peanut genotype and phenotype

[0066]

[0067] The results are shown in Tables 1 and 2. The peanuts with genotype A have lower oil content, while the peanuts with genotype B or H have higher oil content, and the oil content of peanuts with genotype B or H is significantly higher than that of peanuts with genotype A. Therefore, the Arahy36753720 molecular marker is significantly correlated with the oil content of peanuts, can effectively predict the oil content of peanuts, and has important applications in the screening of high and low oil content peanuts.

[0068] Example 4

[0069] Method for rapid breeding of new high- and low-oil peanut varieties using molecular marker Arahy36753720

[0070] In practical applications, high-oil peanut varieties and low-oil peanut varieties are hybridized to breed new high-oil peanut varieties. In this embodiment, high-oil peanut variety Yuhua 14 and low-oil peanut variety AT215 are used as parents for hybridization and breeding. This is only for illustrative purposes and does not limit the scope of the present invention in any way. The oil content phenotypes of Yuhua 14 and AT215 are as follows: Figure 1 and Figure 2 shown.

[0071] The specific steps for breeding high-oil peanut varieties are as follows:

[0072] 1. Hybridization

[0073] High-oil and low-oil varieties were selected for hybridization. AT215 was used as the female parent. After the plant bloomed, the flowers were removed before 8 am every day. The pollen of the male parent was collected the next morning and carefully applied to the stigma of the female parent that had been emasculated the day before. The newly grown fruit needles were marked 7 days after pollination, and pollination continued for 15 days. Before and after hybridization, the flowers that had not been pollinated needed to be removed to ensure that the marked fruit needles were developed after hybridization.

[0074] After maturity, the hybrids of the F1 generation were harvested. The oil content phenotype of the F1 generation peanuts was identified by near infrared spectroscopy scanning, and the high oil phenotype peanut varieties of the F1 generation (oil content ≥ 54%) were further self-pollinated to obtain the F2 population. The recombinant inbred line population (RIL population) was obtained by continuous self-pollination of individual plants in the F2 generation population for multiple generations, and the oil content of the RIL population was identified by the molecular marker Arahy36753720.

[0075] 2. Identification of oil content in RIL population

[0076] The harvested RIL population was identified using the molecular marker Arahy36753720. The method is as follows:

[0077] Use a surgical blade to cut about 0.12 g of cotyledon tissue slices away from the embryonic root of the peanut (preferably so as not to affect seed germination) and place them in a 1.5 mL centrifuge tube. Use the CTAB method to extract genomic DNA, dissolve it in 50 μL of sterile water, and use a spectrophotometer and gel electrophoresis to detect the concentration and quality of the DNA.

[0078] PCR reaction and electrophoresis detection: Molecular marker detection was performed on all RIL families using the specific primer pair of InDel molecular marker Arahy36753720. According to the electrophoresis results, high and low oil peanut varieties were identified.

[0079] The specific primer pairs for Arahy36753720 are as follows:

[0080] Arahy36753720-F: 5'-GACAATGTGGTTCAGCGGAT-3' (SEQ ID NO: 2);

[0081] Arahy36753720-R: 5'-TACAGCAAACACTGCGAACG-3' (SEQ ID NO: 3);

[0082] The PCR amplification reaction system was (total volume 20 μL): 1 μL of DNA template (100-200 ng / μL), 10 μL of 2×SuperTaqStarMix for PAGE (Dye), 1 μL of PCR forward primer, 1 μL of PCR reverse primer, and water was added to 20 μL.

[0083] The amplification reaction procedure is: pre-denaturation at 95°C for 2 min; 95°C for 15 s, 56°C for 15 s, 72°C for 15 s, 35 cycles; and extension at 72°C for 5 min.

[0084] The PCR amplification products were detected by 8% non-denaturing polyacrylamide gel electrophoresis (acrylamide Acr: N,N'-methylenebisacrylamide Bis = 39:1).

[0085] (1) Preparation of 8% acrylamide glue solution: 50 mL of 10×TBE, 100 mL of 40% special acrylamide mother solution (acrylamide Acr:N,N'-methylenebisacrylamide Bis=39:1, 390 g acrylamide and 10 g N,N'-methylenebisacrylamide are diluted to 1 L of deionized water), and distilled water is added to make up to 500 mL.

[0086] (2) Electrophoresis gel:

[0087] Preparation of backing glue solution: 150 μL of 10% ammonium persulfate (APS), 15 mL of 8% acrylamide glue solution, and 15 μL of tetramethylethylenediamine.

[0088] Preparation of large plate glue: 350 μL of 10% ammonium persulfate (APS), 35 mL of 8% acrylamide glue solution, and 35 μL of tetramethylethylenediamine (TEMED).

[0089] (3) Electrophoresis: voltage 150 V, current 2000 mA, electrophoresis time 1.5 h.

[0090] (4) Silver staining: For every two plates of gel: 0.3 g of silver nitrate and 300 mL of distilled water, the ratio of the two is 1:1000. Place on a horizontal shaker and shake slowly for 15 min.

[0091] (5) Color development: Preparation of color development solution: 10 g of sodium hydroxide (NaOH) particles, 0.4 g (0.3-0.5 g) of anhydrous sodium carbonate (Na2CO3), 1 mL of formaldehyde solution (CH2O), and 500 mL of distilled water. Use distilled water to wash the gel.

[0092] (6) Finally, scan and take photos.

[0093] 3. Breeding of high-oil peanut materials

[0094] The RIL peanut population was planted in Qingdao and Dongying every year. The whole cycle took about 3 years. The phenotypic value analysis under two environments in three years is shown in Table 3.

[0095] Select individual plants with good comprehensive traits in the population, such as upright plant type, concentrated fruits, plump pods, and good fruit shape. Combined with the results of oil content determination, select peanuts with high oil content. Continue to screen through generations until high-oil peanut lines are screened out. Select lines with stable and obvious phenotypes to provide excellent peanut materials for high-oil breeding.

[0096] The detection results of molecular marker Arahy36753720 in some materials of RIL peanut population are as follows Figure 3 As shown in the figure, the number and length of electrophoresis bands can easily distinguish the genotype of peanuts and make predictions on the oil content.

[0097] Table 3 Analysis of oil content phenotype values ​​under two environments in three years (Pingdu / Dongying)

[0098]

[0099] Based on the above results, by detecting the molecular markers linked to the gene loci related to high oil content in peanuts, the distribution of allele variation controlling high oil content in peanuts can be determined in the breeding offspring, and the molecular marker-assisted selection of the offspring in the improvement of high oil content in peanuts can be achieved, thereby improving the purposefulness and accuracy. In addition, since the oil content of peanuts is a quantitative trait, it is easily affected by the environment. Therefore, there are errors in the detection of oil content by near-infrared spectroscopy scanning of peanuts, and errors in the oil content of peanuts will occur over time. The method for selecting using the markers provided by the present invention can improve breeding efficiency and accelerate breeding progress.

[0100] The above is only a preferred embodiment of the present invention, and does not limit the present invention in other forms. Any technician familiar with the profession may use the above disclosed technical content to change or modify it into an equivalent embodiment with equivalent changes. However, any simple modification, equivalent change and modification made to the above embodiment according to the technical essence of the present invention without departing from the technical solution of the present invention still belongs to the protection scope of the technical solution of the present invention.

Claims

1. An InDel molecular marker tightly linked to the peanut oil content trait, characterized in that: The molecular marker is Arahy36753720; its nucleic acid sequence is shown in SEQ ID NO: 1; in low-oil peanut varieties, the nucleic acid sequence of the molecular marker is shown in SEQ ID NO: 4; in high-oil peanut varieties, the nucleic acid sequence of the molecular marker is shown in SEQ ID NO:

5.

2. An application of the InDel molecular marker tightly linked to the peanut oil content trait according to claim 1, characterized in that: At least one of ab; a. Used to predict the oil content of peanuts; b. Used for breeding high oil content peanuts.

3. The use of the InDel molecular marker tightly linked to the peanut oil content trait according to claim 2, characterized in that: When used to predict the oil content of peanuts, the genomic DNA of the peanut to be tested is used as a template, and the primer pair shown in SEQ ID NO: 2 and SEQ ID NO: 3 is used to perform PCR amplification, and the amplified product is detected; When the amplified product is a single band of 274 bp, the peanut sample to be tested is a low-oil peanut variety; When the amplified product is a single band of 252 bp, or two bands of 274 bp and 252 bp, the peanut sample to be tested is a high-oil content peanut variety.

4. The use of the InDel molecular marker tightly linked to the peanut oil content trait according to claim 2, characterized in that: The method for breeding high-oil peanuts is to use the Arahy36753720 molecular marker to identify or screen high-oil peanut varieties in a population during the breeding process.

5. The use of the InDel molecular marker tightly linked to the peanut oil content trait according to claim 4, characterized in that: The high oil content peanut breeding method is as follows: High-oil and low-oil peanut varieties were used as parents for hybridization, and peanut materials with oil content ≥54% in the F1 generation hybrids were screened by near-infrared spectroscopy; the screened F1 with high-oil traits were self-pollinated to obtain F2; F2 was continuously self-pollinated to construct a recombinant inbred line population through the single-seed transmission method, and individual plants with good comprehensive traits were selected after each self-pollination. The oil phenotype was identified using the Arahy36753720 molecular marker as an auxiliary, and peanut lines with good comprehensive traits and stable high-oil traits in the population were selected for use as propagation materials.

6. The use of the InDel molecular marker tightly linked to the peanut oil content trait according to claim 5, characterized in that: When the Arahy36753720 molecular marker is used to identify or screen high-oil peanut varieties in a population during breeding, PCR amplification is performed using the primer pair shown in SEQ ID NO: 2 and SEQ ID NO: 3 with the peanut genomic DNA to be tested as a template, and the amplified product is detected; When the amplified product is a single band of 274 bp, the peanut sample to be tested is a low-oil peanut variety; When the amplified product is a single band of 252 bp, or two bands of 274 bp and 252 bp, the peanut sample to be tested is a high-oil content peanut variety.

Images