Bacteroides edulis S13-F8 and application thereof in preparation of medicine for improving / preventing / treating chemotherapy-related diarrhea

Abstract

The invention relates to the technical field of microorganisms for treating diarrhea, and discloses bacteroides angustifolia S13-F8 and application of the bacteroides angustifolia S13-F8 in preparation of drugs for improving / preventing / treating chemotherapy-related diarrhea, the bacteroides angustifolia S13-F8 is preserved in Guangdong Microbial Culture Collection Center, and the preservation number is CDMCC No: 64685. The bacteroides edulis S13-F8 can inhibit the expression of intestinal proinflammatory factors and chemotactic factors and relieve the intestinal inflammatory response; the survival rate of mice subjected to chemotherapy is increased, and the safety is relatively good; the total score index of diarrhea is remarkably improved compared with that of model group animals, and the requirement of tumor patients for long-term taking can be met.

Description

Technical Field

[0001] The present invention relates to the technical field of microorganisms for treating diarrhea, and in particular to a strain of Bacteroides elsdenii S13-F8 and application thereof in preparing a medicine for improving / preventing / treating chemotherapy-associated diarrhea. Background Art

[0002] The statements in this section merely provide background information related to the present disclosure and may not constitute prior art.

[0003] The intestinal microbiota is a community of microorganisms that live in the human digestive tract, including bacteria, viruses, fungi, and protists. The intestinal microbiota plays a vital role in maintaining host health. They are involved in digesting and metabolizing food, producing essential vitamins and short-chain fatty acids, maintaining intestinal barrier function, regulating the immune system, and interacting with the host to affect the occurrence and development of diseases. More and more studies have shown that the intestinal microbiota is closely related to a variety of diseases, such as obesity, diabetes, cardiovascular disease, autoimmune diseases, and cancer. For example, the diversity of intestinal flora in obese patients is reduced, while the abundance of certain butyrate-producing bacteria increases, which may be related to the occurrence of obesity. In addition, metabolites produced by certain intestinal flora can promote the growth and metastasis of tumor cells. The regulation and therapeutic potential of the intestinal microbiome has also attracted widespread attention. The composition of the intestinal flora can be changed through dietary adjustment, probiotic supplementation, fecal transplantation, etc., thereby improving the health of the host.

[0004] Chemotherapy-induced diarrhea (CID) is a common gastrointestinal toxicity caused by chemotherapy in cancer patients. The incidence of CID in patients receiving chemotherapy drugs is as high as 50-80%, among which 5-fluorouracil (5-FU) and irinotecan (CPT-11) cause the highest incidence of diarrhea, up to 80%. CID is a major factor leading to chemotherapy adjustments, delays, or even cessation, seriously affecting patients' survival and quality of life.

[0005] The pathophysiology of CID is complex. It is currently believed that chemotherapy-related mucositis is the dominant factor in the occurrence of CID. Chemotherapy-related mucositis leads to intestinal flora imbalance, intestinal mucosal barrier damage (destruction of the intestinal mucosal layer and intestinal epithelial shedding), damage to the reabsorption function of microvilli cells, and diarrhea. Drugs that can cause CID include the following types: fluoropyrimidines (e.g., 5-fluorouracil and the highly active compound capecitabine), topoisomerase inhibitors (such as irinotecan, topotecan) and other types (e.g., oxaliplatin, paclitaxel, cisplatin, cytarabine), among which itilican (CPT-11) and 5-fluorouracil (5-FU) are the most common; in addition, similar symptoms also exist in emerging targeted small molecule drugs. Taking epidermal growth factor receptor (EGFR) targeted inhibitors (gefitinib, afatinib, etc.) as an example, side effects range from rash to mucositis. Depending on the drug, the time when the intestinal mucosal barrier function is damaged also varies. Hydroxycamptothecin, capecitabine, etc. can also cause CID.

[0006] At present, the treatment guidelines for CID mainly focus on symptomatic treatment. Conventional drugs for the treatment of CID include nonspecific morphine analgesics, opioid receptor inhibitor loperamide, somatostatin analog octreotide, and other antidiarrheals, such as montmorillonite powder; among them, loperamide is the first-line drug, and octreotide is used to treat complicated diarrhea and loperamide-refractory diarrhea. However, both loperamide and octreotide have significant side effects. The side effects of loperamide include megacolon, constipation, abdominal pain, dizziness, rash, abdominal distension, nausea and vomiting, etc. The side effects of octreotide include arrhythmia, constipation, stomach pain, goiter, headache and dizziness, nausea and vomiting, etc., while montmorillonite powder has little effect on severe diarrhea.

[0007] Symbiotic bacteria play an important role in intestinal homeostasis and have a certain protective effect on intestinal integrity. Their advantage is that they are relatively safe, but there is still a lack of probiotic products that can effectively prevent / treat chemotherapy-related diarrhea.

[0008] To date, there have been several prospective randomized controlled studies and meta-analyses exploring the efficacy of different types of probiotics on CID. Probiotics can reduce the risk of grade 2 or higher diarrhea after chemotherapy by about 70%, and can reduce the use of antidiarrheal drugs such as loperamide. Among them, the more studied probiotics are Bifidobacterium and Lactobacillus. Bacteroides is an important component of the intestinal microbiota, and they play a key role in maintaining intestinal health. Some members of the genus Bacteroides are able to produce short-chain fatty acids (SCFAs), such as acetate, propionate, and butyrate, by fermenting dietary fiber. These SCFAs are essential for intestinal health. They can serve as an energy source for intestinal epithelial cells, help maintain the integrity of the intestinal barrier, and have positive effects on immunomodulation and anti-inflammatory effects. However, some strains of the genus Bacteroides may be associated with adverse health outcomes. For example, some strains of the genus Bacteroides may play a role in intestinal inflammatory diseases or have a negative impact on health when the intestinal microbiota is unbalanced.

[0009] At present, the mechanism by which Bacteroides produces diverse effects on intestinal health has not been fully understood. It mainly produces SCFAs as an important energy source for intestinal epithelial cells, affects the activity of immune cells and inflammatory responses, etc. It is still necessary to clarify the roles and related mechanisms of more specific strains of Bacteroides to provide more optional probiotic strains for intestinal health treatment. Summary of the invention

[0010] The purpose of the present invention is to address the problem that there are few probiotic strains for treating diarrhea at present, and to provide a strain of Bacteroides elsdenii S13-F8 and its use in the preparation of a drug for improving / preventing / treating chemotherapy-related diarrhea, which can alleviate the diarrhea symptoms of model group mice and meet the needs of tumor patients for long-term use.

[0011] The technical solution of the present invention is as follows:

[0012] The invention provides a strain of Bacteroides elsdenii S13-F8, which is preserved in Guangdong Province Microbial Culture Collection Center with a preservation number of CDMCC No: 64685.

[0013] On the other hand, the present invention provides a use of a strain of Bacteroides elsdenii S13-F8 in the preparation of a medicament for improving / preventing / treating chemotherapy-associated diarrhea. The Bacteroides elsdenii S13-F8 is deposited in the Guangdong Provincial Microbial Culture Collection Center with a deposit number of CDMCC No: 64685 and a deposit date of May 27, 2024.

[0014] According to a preferred embodiment, the 16S rDNA sequence of the Bacteroides elsdenii S13-F8 is shown as SEQ ID NO.1.

[0015] Another aspect of the present invention provides a pharmaceutical composition for improving / preventing / treating chemotherapy-associated diarrhea, wherein the pharmaceutical composition comprises the Bacteroides elsdenii S13-F8 as described above.

[0016] According to a preferred embodiment, a single preparation of the composition contains 10 2 -10 15 CFU of Bacteroides elsdenii S13-F8 strain.

[0017] Preferably, a single preparation of the composition contains 10 7 -10 15 CFU of Bacteroides elsdenii S13-F8 strain.

[0018] Preferably, a single preparation of the composition contains 10 7 -10 12 CFU of Bacteroides elsdenii S13-F8 strain.

[0019] Preferably, a single preparation of the composition contains 10 8 -10 12 CFU of Bacteroides elsdenii S13-F8 strain.

[0020] Preferably, a single preparation of the composition contains 10 9 -10 12 CFU of Bacteroides elsdenii S13-F8 strain.

[0021] According to a preferred embodiment, the Bacteroides elsdenii is a live bacterium or a freeze-dried live bacterial powder.

[0022] According to a preferred embodiment, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier and / or excipient.

[0023] According to a preferred embodiment, the pharmaceutical composition is administered orally or by enema.

[0024] According to a preferred embodiment, the chemotherapy-related diarrhea is diarrhea caused by taking cytotoxic, taxane, platinum, fluorouracil, camptothecin chemotherapy drugs and / or targeted drugs.

[0025] According to a preferred embodiment, the chemotherapy drug specifically includes:

[0026] One or more of docetaxel, oxaliplatin, cisplatin, fluorouracil, capecitabine, and irinotecan;

[0027] The targeted drug is selected from one or more of Anti-EGFR, Anti-HER-2, Anti-BRAF, Anti-MEK, Anti-EML4 / ALK, Anti-VEGF, Multi-targeted TKI, Anti-mTOR, Anti-CDK4 / 6, and Anti-PARP.

[0028] According to a preferred embodiment, the targeted drug can also be selected from: one or more of afatinib, osimertinib, neratinib, vemurafenib, dabrafenib, cobimetinib, trametinib, crizotinib, aflibercept, lapatinib, pyrotinib, imatinib, pazopanib, everolimus, sirolimus, palbociclib, ribociclib, olaparib, and rucaparib.

[0029] Compared with the prior art, the present invention has the following beneficial effects:

[0030] 1. The present application provides a new use of a strain of Bacteroides elsdenii S13-F8, and provides its use in the preparation of a drug for improving / preventing / treating chemotherapy-associated diarrhea;

[0031] 2. A strain of Bacteroides elsdenii S13-F8 is used in the preparation of drugs for the treatment of chemotherapy-related diarrhea. It can inhibit the expression of intestinal proinflammatory factors and chemokines, reduce intestinal inflammatory response, improve the survival rate of chemotherapy mice, and has good safety. It has significant improvement in the total diarrhea score compared with the model group animals, and can meet the needs of cancer patients for long-term use.

[0032] The strain preservation information of the present invention is as follows:

[0033] Strain name: Bacteroides eggerthii S13-F8.

[0034] Date of preservation: May 27, 2024.

[0035] Depository: Guangdong Microbial Culture Collection Center (GDMCC), address: Institute of Microbiology, Guangdong Academy of Sciences, Postal Code: 510075, Tel: 020-87137633.

[0036] Deposit number: CDMCC No: 64685. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 This is a colony characteristic diagram of Bacteroides elsdenii S13-F8 of Example 1;

[0038] Figure 2This is a microscopic observation picture of Bacteroides elsdenii S13-F8 after Gram staining in Example 1;

[0039] Figure 3 This is the evolutionary tree of the 16S rRNA sample of Bacteroides elsdenii in Example 1;

[0040] Figure 4 is the weight loss percentage of each experimental group in Example 6 for mice with 5-fluorouracil-induced diarrhea;

[0041] Figure 5 This is a graph showing the diarrhea scores of each experimental group in Example 6 for mice with 5-fluorouracil-induced diarrhea;

[0042] Figure 6 The numbers of white blood cells (A) and platelets (B) of each experimental group at the experimental endpoint of 5-fluorouracil-induced diarrhea mice in Example 6;

[0043] Figure 7 The survival curves of the experimental animals of mice with 5-fluorouracil-induced diarrhea in each experimental group in Example 6;

[0044] Figure 8 100× and 400× pathological images of H&E staining of colon tissues of each experimental group in Example 6;

[0045] Fig. 9 The following are the effects of the experimental groups in Example 7 on the gene expressions of Cc2, Ccl7, Cxcl10 and IL-1α in colon tissue of mice with 5-fluorouracil-induced diarrhea. DETAILED DESCRIPTION

[0046] The specific embodiments listed in the present invention are only examples of the present invention, and the present invention is not limited to the specific embodiments described below. For those skilled in the art, any equivalent modifications and substitutions to the embodiments described below are also within the scope of the present invention. Therefore, the equal transformations and modifications made without departing from the spirit and scope of the present invention should be included in the scope of the present invention. If the specific conditions are not specified in the embodiments, they are carried out according to the conventional conditions or the conditions recommended by the manufacturer. If the manufacturers are not specified for all reagents or instruments, they are all conventional products that can be purchased commercially. In order to better illustrate the present invention, numerous specific details are given in the specific embodiments below. It should be understood by those skilled in the art that the present invention can also be implemented without certain specific details. In other embodiments, the methods, means, equipment and steps well known to those skilled in the art are not described in detail in order to highlight the purport of the present invention.

[0047] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art. Unless otherwise specified, the units used in this specification are all international standard units, and the numerical values ​​and numerical ranges appearing in the present invention should be understood to include the inevitable systematic errors in industrial production.

[0048] Definition and explanation: For the strain claimed for protection in the present invention (Bacteroides elsdenii strain with a microbial deposit number of CDMCC No: 64685, S13-F8), the S13-F8 strain that has no mutation, has a completely identical genome, or has accumulated minor mutations during passage, but has no substantial changes in toxicity, immunogenicity and biological activity should be regarded as the S13-F8 strain that has been preserved by microorganisms. And the strain claimed for protection in the present invention includes live bacteria and freeze-dried bacterial powder, complete bacterial bodies or their lysates or their fermentation products and other derivatives.

[0049] S13-F8 strain inevitably introduces minor mutations after passage and application, and the passage strains or mutant strains with no substantial changes in toxicity, immunogenicity and biological activity should belong to the scope of contribution of the present invention. Toxicity, immunogenicity and biological activity have no substantial changes, including but not limited to, within the limits of detection technology such as detection sensitivity and detection limit and acceptable or unavoidable errors, the toxicity, immunogenicity and biological activity are considered to be the same.

[0050] It is often necessary to use animals to measure the toxicity, immunogenicity and bioactivity of the offspring of the S13-F8 strain. Due to differences in animal breed, age, gender, health status, and predictable or unavoidable systematic errors, there is no substantial change in the toxicity, immunogenicity and bioactivity of the offspring of the S13-F8 strain.

[0051] After multiple generations of passaging, the S13-F8 strain inevitably introduces minor mutations. When the mutation occurs in the non-coding sequence region or a synonymous mutation in the coding region, or a mutation that does not affect the toxicity, immunogenicity and biological activity of the strain (for example, it may be a connecting amino acid residue between two domains, or a residue located inside the higher-order structure of the protein that does not contact immune cells and does not affect toxicity, immunogenicity and biological activity), it can be reasonably expected that when these minor changes do not significantly affect the toxicity, immunogenicity and biological activity of the offspring strains, they are still within the scope of the substantial technical contribution of the present invention, and these minor mutations are still non-substantial mutations and should be regarded as mutant strains with no changes in toxicity, immunogenicity and biological activity.

[0052] It can be reasonably expected that the culture medium-cultured subculture strains of the S13-F8 strain of the present invention, like other bacteria, will inevitably introduce minor mutations. When their toxicity, immunogenicity and biological activity do not change substantially, they belong to subculture strains or mutant strains whose toxicity, immunogenicity and biological activity do not change substantially.

[0053] The S13-F8 strain comes from human feces, and it is certain that homologous strains that have a common ancestor with the S13-F8 strain and have obvious physiological and genetic differences with other known Bacteroides strains may be isolated and identified in different human bodies or environments after the filing date of the present invention. Their genomes may be completely the same as the S13-F8 strain, or there may be slight differences. When the degree of difference between these homologous strains and the S13-F8 strain is equivalent to the degree of difference between the S13-F8 strain and the passage strain or mutant strain with no substantial change in toxicity, immunogenicity and biological activity, these homologous strains are the same as the S13-F8 strain or are considered to have no difference in toxicity, immunogenicity and biological activity, and these homologous strains are strains that are substantially the same as the S13-F8 strain.

[0054] The composition of the present invention contains the active ingredient Bacteroides elsdenii S13-F8, and other ingredients, such as auxiliary ingredients without physiological effects, or other functional ingredients. Functional ingredients include but are not limited to other functional strains, or nutrients, dietary fibers, prebiotic ingredients, postbiotic ingredients, etc. with nutritional and dietary supplement effects.

[0055] Bacteroides elsdenii S13-F8 has the effects of improving diarrhea symptoms and anti-inflammatory effects on subjects, so the Bacteroides elsdenii S13-F8 of the present invention or a composition containing the strain can be used to prepare medicines, foods or health products to improve the intestinal health of subjects. In particular, it plays a role in severe damage and diarrhea caused by chemotherapy drugs, so the Bacteroides elsdenii S13-F8 of the present invention or a composition containing the strain can be used to prepare medicines to prevent / improve / treat chemotherapy-related diarrhea.

[0056] The composition of the present invention can be prepared into any form that is convenient for use, such as powders, tablets, granules, gels, capsules or liquids commonly used in clinics or foods.

[0057] Diarrhea in the present invention refers to a clinical symptom in which the frequency of bowel movements significantly exceeds the usual habit (>3 times / d), the feces are thin, the water content is increased (>85%), and the stool may be accompanied by mucus, pus, blood, or undigested food. Diarrhea refers to a clinical symptom in which the frequency of bowel movements significantly exceeds the usual habit (>3 times / d), the feces are thin, the water content is increased (>85%), and the stool may be accompanied by mucus, pus, blood, or undigested food. In the present invention, its meaning covers antibiotic-related diarrhea, chemotherapy-related diarrhea, functional diarrhea, infectious diarrhea, etc.

[0058] The auxiliary material composition includes a pharmaceutical carrier and an excipient. A pharmaceutical carrier refers to a pharmaceutical carrier that does not cause significant stimulation to a subject and does not eliminate the biological activity and characteristics of the probiotics administered. A pharmaceutically acceptable carrier can enhance or stabilize the composition, or can be used to promote the preparation of the composition. A pharmaceutically acceptable carrier can include a solvent, a dispersion medium, a coating, a surfactant, an antioxidant, an isotonic agent, an absorption delay agent, a salt, a drug stabilizer, a binding agent, an excipient, a disintegrant, a lubricant, a sweetener, a flavoring agent, a dye, etc. and a combination thereof, as known to those skilled in the art (see, for example, Remington's Pharmaceutical Sciences, the 18th edition Mack Printing Company, 1990, pages 1289-1329). Unless a conventional carrier is incompatible with an active ingredient, it is considered to be used in a therapeutic or pharmaceutical composition. The carrier can be selected to minimize the adverse side effects of the subject and / or minimize the inactivation of the active ingredient.

[0059] Excipients refer to substances added to a pharmaceutical composition to give the drug a certain shape or concentration, such as sterile water, physiological saline, polyalkylene glycols (such as polyethylene glycol), vegetable oils or hydrogenated naphthalene, calcium bicarbonate, calcium phosphate, various sugars, various types of starch, cellulose derivatives, gelatin, etc.

[0060] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0061] The technical solutions in the embodiments of the present invention will be described clearly and completely in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative work should fall within the scope of protection of the present invention.

[0062] The culture medium preparation method used in the following examples is as follows:

[0063] Anaerobic screening medium for anaerobic Bacteroides: The preparation of BBE (Bacteroides-bile-esculin agar, Qingdao Haibo Biotechnology Co., Ltd., HB7028) medium was selected and weighed and dissolved according to the instructions, and agar was added to 2%. Sterilized at 121℃ for 30min, poured into a 90mm plate after sterilization, and placed in an anaerobic tank for gas replacement after cooling for use.

[0064] Preparation of anaerobic GAM liquid culture medium (1L): GAM (modified GAM culture medium, Qingdao Haibo Biotechnology Co., Ltd., HB8518-3) culture medium was prepared according to the instructions. 0.5 g of L-ascorbic acid and 100 μL of 1% resazurin were added, stirred evenly and heated to dissolve in 1000 mL of distilled water. The powder was heated until it was completely melted and most of the oxygen could be quickly removed. The culture medium was then divided into anaerobic bottles, 200 mL per bottle. The culture medium was boiled to further release molecular oxygen. After the control culture medium was boiled to light red, it was nitrogen-blown. After blowing until it was colorless, the cover was pressed and sterilized at 121°C for 15 minutes. The culture medium was cooled to room temperature. 1 mL of sterile 0.1% vitamin K1 solution and 2 mg of sterile hemin were added to each 200 mL of culture medium, mixed and set aside.

[0065] Preparation of 0.1% vitamin K1 solution: add 1g vitamin K to 99mL anhydrous ethanol to dissolve, filter and sterilize, and add it when the sterilized culture medium cools to below 50°C. The prepared vitamin K1 solution can be sealed and refrigerated at 2-8°C.

[0066] Preparation of anaerobic PBS: Weigh 0.27 g of potassium dihydrogen phosphate, 1.42 g of disodium hydrogen phosphate, 8 g of sodium chloride, 0.2 g of potassium chloride, and 100 μL of 1% resazurin, dissolve in 1 L of distilled water, heat to boil, cool to room temperature, add 0.5 g of L-cysteine ​​hydrochloride and 0.5 g of L-ascorbic acid, stir to dissolve, adjust the pH to 6.5, and then divide it into anaerobic bottles, 200 mL per bottle, heat to boiling, keep it at a slight boiling state for 30 minutes, further release molecular oxygen, blow it with nitrogen, blow it until it is colorless, then press the cap, sterilize it at 121°C under high pressure for 30 minutes, store it in a cool and dry place for later use.

[0067] Original sample protective agent configuration (1L): Weigh 0.27g potassium dihydrogen phosphate, 1.42g disodium hydrogen phosphate, 8g sodium chloride, 0.2g potassium chloride, add appropriate amount of distilled water to fully dissolve, add 200mL propylene glycol, heat to boil, and cool to room temperature with N2. Then add 0.5g cysteine ​​salt and 100μL of 1% resazurin, adjust the pH to neutral with 5M NaOH solution after fully dissolving, boil twice until the protective agent returns to colorless state, continue to heat for more than 20min, cool to room temperature with N2, and then package, sterilize at 121℃ high temperature and wet heat for 30min, and store in a cool and dry place.

[0068] Example 1 Isolation and Identification of Bacteroides elsdenii

[0069] The screening and separation method of Bacteroides is as follows:

[0070] (1) Collect fresh fecal samples from healthy volunteers, weigh 1-2g of the sample into a 50mL centrifuge tube, add the original sample protective agent at a ratio of 1:10 to form a 10% w / v suspension, vortex vigorously, and then centrifuge at 300×g for 5 minutes to collect the supernatant into a 50mL centrifuge tube, and then transfer it into the anaerobic glove box for packaging. Use 2mL cryotubes for packaging, each containing 1mL, label and vacuum bag after packaging, and store in a -80℃ refrigerator for future use.

[0071] (2) Take one frozen sample tube and transfer it to the glove box for thawing. After the sample is thawed, use a pipette to take 1 mL of bacterial suspension and oscillate in 9 mL of anaerobic PBS to mix well. Then dilute to 10 -6 , take 10 -3 , 10 -4 , 10 -5 , 10 -6 Four gradients were applied on BBE (Bacteroides-Bile-Aesculin Agar) medium, and the medium was placed in an anaerobic incubator for 24-48 hours. After the bacteria grew out, a monoclonal colony was picked up with a sterile Tip head and placed in a 96-deep well plate in anaerobic GAM liquid medium for 24-48 hours. 2 μL of bacterial culture solution was amplified by polymerase chain reaction using bacterial 16S-rDNA universal primers (27FAGAGTTTGATCCTGGCTCAG and 1492R TACGGCTACCTTGTTACGACTT), and 1% agarose gel electrophoresis was used to detect whether the amplification reaction was successful. DNA was extracted from unsuccessful strains and then polymerase chain reaction and agarose gel electrophoresis were performed, and sent to the Chengdu branch of Beijing Qingke Biotechnology Co., Ltd. for sequencing. The remaining bacterial solution was mixed evenly with a protective agent and temporarily stored for use after the PCR results were confirmed.

[0072] (3) The 16S rDNA sequencing results were analyzed and compared with the NCBI nt library. A total of 12 strains of Bacteroides were screened.

[0073] Example 2 Evaluation of the therapeutic effect of Bacteroides on 5-FU-induced diarrhea in mice

[0074] (1) Experimental method: Six strains with no toxicity reported were selected from the 12 strains of Bacteroidetes screened in Example 1 for animal experiments. The animal experiment protocol was approved by the Experimental Animal Welfare Ethics Committee of Chengdu Medical College (approval number: Chengdu Medical Animal Ethics

[2023] No. 066).

[0075] 40 SPF male Balb / c mice, weighing 18-22 g, were purchased from Chengdu Dashuo Experimental Animal Co., Ltd. and kept in an SPF animal room. After the quarantine period, they were randomly divided into A, blank group, B, model group, C, S13-B4 live bacterial solution (10 9 CFU / mL), D, S13-D4 live bacteria solution (10 9 CFU / mL), E, ​​S13-F4 live bacteria liquid (10 9 CFU / mL), F, S13-F8 live bacteria liquid (10 9 CFU / mL), G, S13-H2 live bacteria solution (10 9 CFU / mL), H, S13-G8 live bacteria liquid (10 9 CFU / mL), 8 groups in total, 5 mice in each group. From 1 to 5 days of the experiment, except for the blank group, the rest of the mice were intraperitoneally injected with 35 mg / kg fluorouracil solution (purchased from Shanghai Aladdin Biochemical Technology Co., Ltd., 5 mL / kg) once a day to establish a diarrhea model. From 1 to 9 days, each group of mice was treated with drugs according to the set dose and administration method, once a day; groups A and B were orally administered with 10 mL / kg of normal saline as a control. The experiment was ended on day 10, and the mice in each group were fasted for more than 12 hours in advance and killed by cervical dislocation. The weight of the mice, diarrhea and death of the experimental mice were monitored every day to evaluate the toxicity of the strain.

[0076] The mice were weighed every day from the modeling period. Calculation: Weight loss percentage = body weight on the day / body weight on the first day of modeling × 100%. 0 points: 0 weight loss percentage; 1 point: 1-5% weight loss percentage; 2 points: 5-10% weight loss percentage; 3 points: 10-20% weight loss percentage; 4 points: >20% weight loss percentage.

[0077] Diarrhea record and scoring criteria: The diarrhea of ​​each experimental mouse was recorded every day. The scoring criteria for diarrhea refer to the diarrhea scoring method in the study of Kurita A et al. 0 points: normal or no stool; 1 point: mild diarrhea, the stool is slightly wet and soft; 2 points: moderate diarrhea, the stool is wet and unformed, and there is mild perianal coloration; 3 points: severe diarrhea, watery stool accompanied by severe perianal coloration.

[0078] Table 1 The percentage of weight loss in mice given oral administration of 6 Bacteroides strains

[0079]

[0080]

[0081] Note: Compared with the model group, * :P<0.05, ** :P<0.01.

[0082] Results of weight loss percentage: Compared with the blank group, the weight loss percentage of the model group from day 3 to day 7 was significantly decreased (P<0.01). 9 CFU / mL) group was significantly improved in terms of the percentage of body weight loss (P<0.05).

[0083] Table 2 Effects of 6 Bacteroides strains on diarrhea scores in mice

[0084]

[0085] Note: Compared with the model group, * :P<0.05, ** :P<0.01.

[0086] Diarrhea score results: Compared with the blank group, the diarrhea score of the model group increased significantly from 5 to 9 days (P<0.01). 9 CFU / mL) group had a significant decrease in diarrhea score (P<0.05).

[0087] Table 3 Mortality of mice fed with 6 strains of Bacteroides during the experiment (%)

[0088]

[0089] Mortality results: Compared with the blank group, the model group began to die on the ninth day, among which only group C: S13-B4 live bacteria solution (10 9 CFU / mL), Group F: S13-F8 live bacteria solution (10 9 CFU / mL) without death of experimental mice, the two strains were non-toxic and could improve the survival rate of 5-FU treatment.

[0090] Example 3 Whole genome analysis of Bacteroides elsdenii S13-F8

[0091] The 16S rDNA sequencing results of the dominant strain S13-F8 in Example 2 were analyzed and compared with the NCBI nt library. Figure 3 As shown, S13-F8 was preliminarily identified as Bacteroides eggerthii and named S13-F8.

[0092] Inoculate 2% of Escherichia coli S13-F8 into 5 mL of anaerobic GAM liquid culture medium, culture until the late logarithmic growth period, and extract the whole genome DNA of the strain. The whole genome was completed using the second-generation + third-generation sequencing method of Illumina + PacBio. After assembly and annotation, the protein sequence was entered into the Virulence Factor Databases (VFDB) for virulence factor analysis, and the protein sequence was entered into the Comprehensive Antibiotic Resistance Database (http: / / arpcard.Mcmaster.ca, Version 1.1.3); the results showed that the bacteria did not have virulence factors and complete antibiotic resistance genes, and were safe at the genome level.

[0093] Example 4 Preparation of live bacterial liquid sample of Bacteroides elsdenii

[0094] The anti-chemotherapy-related diarrhea effect of Bacteroides eggerthii S13-F8 was further verified.

[0095] Fermentation culture of Bacteroides elsdenii: Inoculate the strain S13-F8 of Bacteroides elsdenii on a plate and culture it anaerobically for 48 hours. Observe the morphological characteristics, staining characteristics, size, club shape and distribution of the colonies.

[0096] 1) Streak the bacteria onto a plate and incubate anaerobically at 37°C for 48 hours.

[0097] Colony characteristics: After 48 hours of culture on a plate, Bacteroides elsdenii S13-F8 appears round, slightly convex, translucent, white, and smooth on the surface. The diameter of the colony is 1-3 mm. Figure 1 . The strain was deposited in Guangdong Provincial Microbiological Culture Collection Center (GDMCC) on May 27, 2024, and the strain collection number is: CDMCC No: 64685.

[0098] Microscopic morphology: Gram staining of Bacteroides elsdenii S13-F8 showed that it was a Gram-negative bacterium with a typical rod shape and blunt and darkly stained ends. Figure 2 .

[0099] 2) Enrichment: Select a single colony from step 1) and inoculate it into a GAM liquid culture medium for enrichment, and store the resulting bacterial solution for later use.

[0100] 3) Live bacterial solution of Bacteroides elsdenii: The bacterial solution prepared in step 1) was diluted to 10% with physiological saline. 9 CFU / ml, save for future use.

[0101] Example 5 Preparation of freeze-dried Bacteroides elsdenii powder

[0102] 1) taking the live bacterial liquid of Bacillus elsdenii obtained in Example 5, centrifuging the fermentation liquid, collecting wet bacteria, adding physiological saline at a ratio of bacteria: physiological saline = 1: (10-30) (m:v) to resuspend and wash the bacterial sludge, and centrifuging again to collect the washed bacteria;

[0103] 2) Add 6.25% of The excipient was prepared by adjusting the pH of S100+10% mannitol+0.9% sodium chloride to 7.6, and then added at a ratio of bacteria: excipient = 1: (5-15) (m:m), stirred and dispersed, and then collected by centrifugation.

[0104] 3) The bacterial solution obtained in step (2) is subjected to vacuum freeze drying, pre-frozen at -40±2°C for 1 to 3 hours, pre-frozen at -20±2°C for 0.5 to 1 hour, and finally pre-frozen at -40±2°C for 0.5 to 2 hours, and then subjected to primary drying (-5±2°C and 0±2°C) and analytical drying (4±2°C) under a vacuum degree of 0.25 mbar to prepare freeze-dried live bacterial powder, wherein the bacterial count of the bacterial powder reaches 1×10 11 CFU / g or more. Before administration, 1×10 9 CFU bacterial powder is prepared into bacterial suspension.

[0105] Example 6 Effect of Bacteroides elsdenii S13-F8 on 5-fluorouracil-induced diarrhea in mice

[0106] (1) Test method

[0107] 40 SPF male Balb / c mice, weighing 18-22 g, were purchased from Chengdu Dashuo Experimental Animal Co., Ltd. and kept in an SPF animal room. After the quarantine period, they were randomly divided into the following groups according to their body weight: A, blank group; B, model group; C, S13-F8 live bacterial solution (10 9 CFU / mL), D, S13-F8 lyophilized powder (10 9CFU / mL), a total of 4 groups, 8 mice in each group. From 1 to 5 days of the experiment, except for the blank group, the rest of the mice were intraperitoneally injected with 5-fluorouracil solution (purchased from Shanghai Aladdin Biochemical Technology Co., Ltd., 5mL / kg) at a dose of 35mg / kg, once a day to establish a diarrhea model. From 1 to 9 days, each group of mice was treated with drugs according to the set dose and administration method, once a day; groups A and B were orally administered with 10mL / kg of normal saline as a control. The experiment ended on the 10th day, and fasted for more than 12h in advance. 200μL of eyeball blood was collected with an EDTA anticoagulant tube for subsequent blood routine testing. The mice in each group were killed by cervical dislocation, and the weight, diarrhea and death of the mice were monitored every day to evaluate the toxicity of the strain. The animal experiment plan was approved by the Experimental Animal Welfare Ethics Committee of Chengdu Medical College (Approval No.: Chengyi Donglun

[2023] No. 066).

[0108] The mice were weighed every day from the modeling period. Calculation: Weight loss percentage = body weight on the day / body weight on the first day of modeling × 100%. 0 points: 0 weight loss percentage; 1 point: 1-5% weight loss percentage; 2 points: 5-10% weight loss percentage; 3 points: 10-20% weight loss percentage; 4 points: >20% weight loss percentage.

[0109] Diarrhea record and scoring criteria: The diarrhea of ​​each experimental mouse was recorded every day. The scoring criteria for diarrhea refer to the diarrhea scoring method in the study of Kurita A et al. 0 points: normal or no stool; 1 point: mild diarrhea, the stool is slightly wet and soft; 2 points: moderate diarrhea, the stool is wet and unformed, and there is mild perianal coloration; 3 points: severe diarrhea, watery stool accompanied by severe perianal coloration.

[0110] Routine blood test: At the end of the experiment, about 200 μL of blood was collected from the orbital venous plexus of all surviving animals after isoflurane anesthesia, and the blood was collected in an EDTA anticoagulant tube for routine blood test.

[0111] Intestinal tissue pathological examination: All surviving animals were euthanized and the entire intestine was taken out and fixed with 10% formaldehyde solution. Pathological tissue sections were prepared and stained with HE for intestinal tissue pathological examination under a microscope.

[0112] The experimental results are as follows Figure 4 As shown: Compared with the model group, the weight loss percentage of the S13-F8 live bacteria liquid administration group was significantly improved on the second and eighth days of administration (P<0.05) ( Figure 4 ), the S13-F8 lyophilized powder group showed significant improvement on the seventh, eighth, and tenth days compared with the model group (P<0.05) ( Figure 4); Compared with the model group, the diarrhea scores of the S13-F8 live bacteria liquid group were significantly lower on the fifth day (P<0.05), seventh day (P<0.01), and eighth day (P<0.05) than those of the model group ( Figure 5 ), the diarrhea scores of the S13-F8 freeze-dried powder group were significantly lower than those of the model group on the fifth day (P<0.001), sixth day (P<0.05), and seventh day (P<0.001). Figure 5 ); Compared with the model group, the number of white blood cells in the S13-F8 live bacteria liquid group increased significantly (P<0.0001) ( Figure 6 A), the number of white blood cells in the S13-F8 freeze-dried powder group increased significantly (P<0.0001) ( Figure 6 A); Compared with the model group, the platelet count in the S13-F8 live bacteria liquid group increased significantly (P<0.0001) ( Figure 6 B), the platelet count in the S13-F8 freeze-dried powder group increased significantly (P<0.01) ( Figure 6 B); Compared with the model group, the S13-F8 live bacteria liquid administration group increased the survival rate of mice ( Figure 7 ); Compared with the blank group, the model group had increased ulcer foci, decreased goblet cells, dilated intestinal glands, and increased lymphocytes, while the ulcer foci and goblet cells in the S13-F8 live bacteria administration group were significantly restored ( Figure 8 ). Note: Compared with the model group, *: P < 0.05, **: P < 0.01, ***: P < 0.001, ****: P < 0.0001.

[0113] The results show that the Bacteroides elsdenii S13-F8 of the present invention can significantly improve the diarrhea symptoms caused by the chemotherapy drug 5-FU and increase the survival rate of mice.

[0114] Example 7 Effects of Bacteroides elsdenii S13-F8 on inflammatory factors and chemokines in colon tissue of mice with 5-FU-induced diarrhea

[0115] After the animal experiment in Example 6 was completed, the mid-colon of the mice was collected, quick-frozen in liquid nitrogen for 15 minutes, and then stored in a -80°C refrigerator for transcriptome sequencing.

[0116] Extract total RNA: Extract total RNA from tissue samples, use Nanodrop 2000 to detect the concentration and purity of the extracted RNA, agarose gel electrophoresis to detect RNA integrity, and Agilent 5300 to determine the RQN value. A single library construction requires a total RNA amount of 1 μg, a concentration of ≥30 ng / μL, RQN>6.5, and OD260 / 280 between 1.8-2.2.

[0117] Oligo dT enrichment of mRNA: The 3' end of eukaryotic mRNA has a ployA tail structure. By using magnetic beads with Oligo (dT) to perform AT base pairing with ployA, mRNA can be separated from total RNA for analysis of transcriptome information.

[0118] Fragmented mRNA: The second-generation high-throughput sequencing platform sequences short sequence fragments. The enriched mRNA is a complete RNA sequence with an average length of several kb, so it needs to be randomly interrupted. Adding fragmentation buffer and selecting appropriate conditions can randomly break the mRNA into small fragments of about 300 bp.

[0119] Reverse synthesis of cDNA: Under the action of reverse transcriptase, random primers are used to reverse synthesize one-strand cDNA with mRNA as a template, followed by second-strand synthesis to form a stable double-stranded structure.

[0120] Connecting adapter: The double-stranded cDNA structure has sticky ends. Add End Repair Mix to make it blunt-ended, and then add an A base to the 3' end to facilitate the subsequent addition of the adapter sequence.

[0121] Fragment screening and library enrichment: The products connected to the adapter are purified and fragments are sorted, and the sorted products are used for PCR amplification and purification to obtain the final library.

[0122] NovaSeq X Plus platform sequencing (selected according to actual situation): Qubit 4.0 quantification, mixing according to data ratio, amplification by bridge PCR on cBot, generating clusters, sequencing on the machine. Fig. 9 Compared with the blank group, the relative transcription levels of Ccl 2, Ccl 7, Cxcl 10, and IL-1α mRNA in the model group were significantly increased (P<0.01); administration of S13-F8 live bacteria solution could significantly reduce the relative transcription levels of Ccl 2, Ccl 7, Cxcl 10, and IL-1α mRNA (P<0.01).

[0123] It can be seen that the Bacteroides elsdenii S13-F8 of the present invention can improve the symptoms of chemotherapy-related diarrhea and has a significant therapeutic effect on chemotherapy-related diarrhea.

[0124] sequence:

[0125] SEQ ID NO.1

[0126] Length: 1430

[0127] Molecule type: DNA

[0128] Feature Position / Qualifier:

[0129] -source,1...1430

[0130] >mol_type,genomic DNA

[0131] >organism,Bacteroides eggerthii

[0132] Base:

[0133]

Claims

1. A strain of Bacteroides elsdenii S13-F8, characterized in that It is deposited in Guangdong Microbiological Culture Collection Center with the deposit number CDMCC No: 64685.

2. Use of a strain of Bacteroides elsdenii S13-F8 in the preparation of a drug for improving / preventing / treating chemotherapy-associated diarrhea, characterized in that: The Bacteroides elsdenii S13-F8 is deposited in Guangdong Microbial Culture Collection Center with a deposit number of CDMCC No: 64685.

3. Use of a strain of Bacteroides elsdenii S13-F8 according to claim 2 in the preparation of a drug for improving / preventing / treating chemotherapy-associated diarrhea, characterized in that: The 16SrDNA sequence of the Bacteroides elsdenii S13-F8 is shown in SEQ ID NO.

1.

4. A pharmaceutical composition for improving / preventing / treating chemotherapy-related diarrhea, characterized in that: The pharmaceutical composition comprises the Bacteroides elsdenii S13-F8 as described in claim 1.

5. A pharmaceutical composition for improving / preventing / treating chemotherapy-related diarrhea according to claim 4, characterized in that: A single preparation of the composition contains 10 2 -10 15 CFU of Bacteroides elsdenii S13-F8 strain.

6. A pharmaceutical composition for improving / preventing / treating chemotherapy-related diarrhea according to claim 5, characterized in that: The Bacteroides elsdenii is a live bacterium or live bacterial powder prepared by freeze-drying.

7. A pharmaceutical composition for improving / preventing / treating chemotherapy-related diarrhea according to claim 6, characterized in that: The pharmaceutical composition further comprises a pharmaceutically acceptable carrier and / or excipient.

8. A pharmaceutical composition for improving / preventing / treating chemotherapy-related diarrhea according to claim 7, characterized in that: The pharmaceutical composition is administered orally or by enema.

9. The pharmaceutical composition for improving / preventing / treating chemotherapy-related diarrhea according to claim 8, characterized in that: The chemotherapy-related diarrhea is diarrhea caused by taking cytotoxic, taxane, platinum, fluorouracil, camptothecin chemotherapy drugs and / or targeted drugs.

10. A pharmaceutical composition for improving / preventing / treating chemotherapy-related diarrhea according to claim 9, characterized in that: Chemotherapy drugs include: One or more of docetaxel, oxaliplatin, cisplatin, fluorouracil, capecitabine, and irinotecan; The targeted drug is selected from one or more of Anti-EGFR, Anti-HER-2, Anti-BRAF, Anti-MEK, Anti-EML4 / ALK, Anti-VEGF, Multi-targeted TKI, Anti-mTOR, Anti-CDK4 / 6, Anti-PARP, afatinib, osimertinib, neratinib, vemurafenib, dabrafenib, cobimetinib, trametinib, crizotinib, aflibercept, lapatinib, pyrotinib, imatinib, pazopanib, everolimus, sirolimus, palbociclib, ribociclib, olaparib, and rucaparib.

Images