A glycosyltransferase UGT91C1 mutant and its application

Abstract

The invention discloses a glycosyltransferase UGT91C1 mutant and its application, belonging to the field of genetic engineering technology. The glycosyltransferase UGT91C1 mutant is obtained by single-point mutation or multi-point combined mutation of the 380th amino acid, the 204th amino acid and the 208th amino acid of the amino acid sequence shown in SEQ ID NO.1: the 380th amino acid is mutated from G to F; the 204th amino acid is mutated from L to A; the 208th amino acid is mutated from F to A. The glycosyltransferase UGT91C1 mutant provided by the invention improves the catalytic activity of the enzyme, which is 1.1 to 2 times that of the wild-type glycosyltransferase UGT91C1.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to a glycosyltransferase UGT91C1 mutant and an application thereof. Background Art

[0002] Rebaudioside D and Rebaudioside E are a class of compounds found in the natural sweetener Stevia. The sweetness of both is about 200-300 times that of sucrose. Both have good sweetness properties and are widely used in low-calorie beverages, candies, cakes, dairy products and other foods as natural sweeteners to replace sucrose.

[0003] With the increasing requirements for the taste of sweeteners, the demand for products such as rebaudioside D and rebaudioside E is increasing. However, the content of rebaudioside D and rebaudioside E in stevia plants is extremely low, and the cost of separation and extraction is high, which cannot meet the market demand. Glycosyltransferase UGT91C1 can catalyze rebaudioside A and stevioside STV to produce rebaudioside D and rebaudioside E respectively in the presence of uridine diphosphate glucose (UDPG), but the enzyme activity of wild-type glycosyltransferase UGT91C1 is low, which limits the industrial production of rebaudioside D and rebaudioside E. Summary of the invention

[0004] In view of this, the object of the present invention is to provide a glycosyltransferase UGT91C1 mutant and its application, so as to overcome the problem of low enzyme activity of wild-type glycosyltransferase UGT91C1 in the prior art.

[0005] In a first aspect, the present invention provides a glycosyltransferase UGT91C1 mutant, which is obtained by performing single-point mutation or multi-point combined mutation at amino acid position 380, amino acid position 204, and amino acid position 208 of the amino acid sequence shown in SEQ ID NO.1:

[0006] The 380th amino acid mutated from G to D; the 204th amino acid mutated from L to A; and the 208th amino acid mutated from F to A.

[0007] Compared with the wild-type glycosyltransferase UGT91C1 in the prior art, the glycosyltransferase UGT91C1 mutant provided by the present invention has improved enzyme catalytic activity, which is 1.1 to 2 times that of the wild-type glycosyltransferase UGT91C1.

[0008] Furthermore, the amino acid sequence of the glycosyltransferase UGT91C1 mutant is shown in SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4 or SEQ ID NO.5.

[0009] In a second aspect, the present invention provides a coding gene having a nucleotide sequence encoding the above-mentioned glycosyltransferase UGT91C1 mutant.

[0010] The nucleotide sequence encoding the above-mentioned glycosyltransferase UGT91C1 mutant is shown in SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9 or SEQ ID NO.10.

[0011] In a third aspect, the present invention provides a biomaterial, wherein the biomaterial comprises the above-mentioned encoding gene, and the biomaterial is an expression unit, an expression vector or a genetically engineered bacterium.

[0012] In a fourth aspect, the present invention provides a method for preparing a glycosyltransferase UGT91C1 mutant, comprising the following steps:

[0013] The plasmid containing the wild-type glycosyltransferase UGT91C1 encoding gene was used as a template and site-directed mutagenesis primers were used for PCR amplification to obtain a recombinant plasmid containing the glycosyltransferase UGT91C1 mutant encoding gene.

[0014] The recombinant plasmid is transferred into the host cell to obtain a recombinant strain.

[0015] The recombinant strain was induced to ferment and produce enzyme, and the glycosyltransferase UGT91C1 mutant enzyme liquid was obtained.

[0016] In a fifth aspect, the present invention provides the use of the above-mentioned mutants, encoding genes or biological materials in the preparation of rebaudioside D or rebaudioside E.

[0017] The inventors have found through experiments that the glycosyltransferase UGT91C1 mutant of the present invention can catalyze stevioside STV to produce rebaudioside E and catalyze rebaudioside A to produce rebaudioside D, indicating that the glycosyltransferase UGT91C1 mutant has C19 position β-(1,2)-O-glucose glycosylation activity.

[0018] Furthermore, the glycosyltransferase UGT91C1 mutant was used in combination with sucrose synthase to prepare rebaudioside D using rebaudioside A, UDPG and sucrose as substrates.

[0019] The above technical scheme combines the glycosyltransferase UGT91C1 mutant with sucrose synthase. The transferase UGT91C1 mutant catalyzes the production of rebaudioside D and byproduct UDP using rebaudioside A and UDPG as substrates. The sucrose synthase can resynthesize UDPG using byproduct UDP and sucrose as substrates, thereby establishing a UDPG recycling system, avoiding the additional addition of UDPG, and saving production costs.

[0020] Furthermore, the glycosyltransferase UGT91C1 mutant was used in combination with sucrose synthase to prepare rebaudioside D using rebaudioside A, UDPG and sucrose as substrates. The final concentrations of the materials in the reaction system were as follows:

[0021] Sodium phosphate buffer 50-100 mM, glycosyltransferase UGT91C1 mutant enzyme solution 30-50 OD, sucrose synthase enzyme solution 15-20 OD, sucrose 600-700 mM, UDPG 1.5-2 mM, rebaudioside A 40-60 mM; the pH value of the reaction system is 7-7.5, and the reaction temperature is 35-40°C.

[0022] Compared with the prior art, the present invention further improves the conversion rate of rebaudioside A and the yield of rebaudioside D by optimizing the reaction conditions and the material concentration in the reaction system.

[0023] Furthermore, the glycosyltransferase UGT91C1 mutant was used in combination with sucrose synthase to prepare rebaudioside E using stevioside STV, UDPG and sucrose as substrates.

[0024] The above technical scheme combines the glycosyltransferase UGT91C1 mutant with sucrose synthase. The UGT91C1 mutant catalyzes the production of rebaudioside E and byproduct UDP using stevioside STV and UDPG as substrates. The sucrose synthase can resynthesize UDPG using byproduct UDP and sucrose as substrates, thereby establishing a UDPG recycling system, avoiding the additional addition of UDPG, and saving production costs.

[0025] Furthermore, the glycosyltransferase UGT91C1 mutant was used in combination with sucrose synthase to prepare rebaudioside E using stevioside STV, UDPG and sucrose as substrates. The final concentrations of the materials in the reaction system were as follows:

[0026] Sodium phosphate buffer 50-100 mM, glycosyltransferase UGT91C1 mutant enzyme solution 20-50 OD, sucrose synthase enzyme solution 15-20 OD, sucrose 400-700 mM, UDPG 1-2 mM, stevioside STV 30-40 mM; the pH value of the reaction system is 7-7.5, and the reaction temperature is 35-40°C.

[0027] Compared with the prior art, the present invention further improves the conversion rate of stevioside STV and the yield of rebaudioside E by optimizing the reaction conditions and the material concentration in the reaction system. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 This is the enzyme activity determination diagram in Example 3.

[0029] Figure 2 This is a diagram of the reaction results at different pH values ​​in Example 4.

[0030] Figure 3 Graph showing the reaction results at different temperatures in Example 4.

[0031] Figure 4 This is a diagram showing the reaction results of coupling the glycosyltransferase UGT91C1 mutant N4 with sucrose synthase in Example 5.

[0032] Figure 5 This is a graph showing the effect of the enzyme solution concentration of the glycosyltransferase UGT91C1 mutant N4 on the reaction product in Example 6.

[0033] Figure 6 This is a diagram showing the effect of UDPG concentration on the reaction products in Example 7.

[0034] Figure 7 This is a graph showing the effect of sucrose concentration on the reaction products in Example 8. DETAILED DESCRIPTION

[0035] In order to make the technical problems, technical solutions and beneficial effects to be solved by the present invention more clearly understood, the present invention is further described in detail below in conjunction with specific embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0036] It should be understood that the raw materials used in the following examples are all commercially available raw materials unless otherwise specified. Example 1

[0037] Construction of recombinant plasmid containing glycosyltransferase UGT91C1 mutant gene

[0038] Using UGT91C1-F and UGT91C1-R as primers and the cDNA of the wild-type glycosyltransferase UGT91C1 gene (SEQ ID NO.6) from rice as a template, PCR amplification was performed using a high-fidelity DNA polymerase (Wuhan Aibotek Biotechnology Co., Ltd.) to obtain the correct UGT91C1 gene fragment.

[0039] The vector pET21a (+) and the above-mentioned PCR product UGT91C1 gene fragment were double-digested using restriction endonucleases NdeI and XhoI, respectively, and the double-digested products were connected using T4 DNA ligase to obtain a recombinant plasmid containing the UGT91C1 gene. Take 5 μL of the recombinant plasmid containing the UGT91C1 gene and transform it into the competent cells of the host cell, wherein the host cell used in the embodiment of the present invention is E. coli TOP10, to obtain the recombinant strain UGT91C1, which is coated on a solid Luria-Bertani medium containing 100 μg / mL ampicillin and cultured at 37°C for 12 hours. Then pick the monoclonal colonies on the culture medium, perform PCR verification on the colonies, and inoculate the monoclonal colonies with the correct length of the PCR amplification product into a liquid Luria-Bertani medium containing 100 μg / mL ampicillin and continue to culture overnight to extract the recombinant plasmid containing the UGT91C1 gene.

[0040] UGT91C1-F: GAATTCCATATGATGGACTCCGGCTACTCC (SEQ ID NO. 11).

[0041] UGT91C1-R: CCTCGAGTCAATCCTTGTAAGATCTCAATTGC (SEQ ID NO. 12).

[0042] The above recombinant plasmid containing the UGT91C1 gene was used as a template, and F1 and F2 were used as primers for PCR amplification. After the PCR amplification product was digested with DpnI, a recombinant plasmid containing the glycosyltransferase UGT91C1 mutant gene was obtained. The mutation site of the mutant was G380D, named N1. The recombinant plasmid was transformed into E. coli TOP10 competent cells for culture, and the plasmid was extracted for sequencing verification to obtain the correct plasmid pet21a (+) -G380D.

[0043] The amino acid sequence of the glycosyltransferase UGT91C1 mutant N1 is shown in SEQ ID NO.2; the nucleoside sequence of the glycosyltransferase UGT91C1 mutant N1 encoding gene is shown in SEQ ID NO.7.

[0044] F1: GCCGATCTTCGACGACCAGGGACCG (SEQ ID NO. 13).

[0045] F2: CGGTCCCTGGTCGTCGAAGATCGGC (SEQ ID NO. 14).

[0046] The above recombinant plasmid containing the UGT91C1 gene was used as a template, and F5 and F6 were used as primers for PCR amplification. After the PCR amplification product was digested with DpnI, a recombinant plasmid containing the glycosyltransferase UGT91C1 mutant gene was obtained. The mutation site of the mutant was L204A, named N2. The recombinant plasmid was transformed into E. coli TOP10 competent cells for culture, and the plasmid was extracted for sequencing verification to obtain the correct plasmid pet21a (+) -L204A.

[0047] The amino acid sequence of the glycosyltransferase UGT91C1 mutant N2 is shown in SEQ ID NO.3; the nucleoside sequence of the glycosyltransferase UGT91C1 mutant N2 encoding gene is shown in SEQ ID NO.8.

[0048] F5: TCATCGGGAATGTCCGCAGCCGAGCGCTT (SEQ ID NO. 15).

[0049] F6:AAGCGCTCGGCTGCGGACATTCCCGATGA (SEQ ID NO. 16).

[0050] The above recombinant plasmid containing the UGT91C1 gene was used as a template, and F7 and F8 were used as primers for PCR amplification. After the PCR product was digested with DpnI, a recombinant plasmid containing the glycosyltransferase UGT91C1 mutant gene was obtained. The mutation site of the mutant was F208A, named N3. The recombinant plasmid was transformed into E. coli TOP10 competent cells for culture, the plasmid was extracted, and sequencing was performed to obtain the correct plasmid pet21a(+)-F208A.

[0051] The amino acid sequence of the glycosyltransferase UGT91C1 mutant N3 is shown in SEQ ID NO.4; the nucleoside sequence of the glycosyltransferase UGT91C1 mutant N3 encoding gene is shown in SEQ ID NO.9.

[0052] F7:TGTCCTTAGCCGAGCGCGCATCCTTGACGCTCTCGA (SEQ ID NO. 17).

[0053] F8:TCGAGAGCGTCAAGGATGCGCGCTCGGCTAAGGACA (SEQ ID NO. 18).

[0054] Plasmid pet21a(+)-G380D was used as a template, and F3 and F4 were used as primers for PCR amplification. After the PCR product was digested with DpnI, a recombinant plasmid containing the glycosyltransferase UGT91C1 mutant gene was obtained. The mutant also carried three mutation sites: L204A, F208A and G380D, named N4. The recombinant plasmid was transformed into E. coli TOP10 competent cells for culture, and the plasmid was extracted for sequencing verification to obtain the correct plasmid pet21a(+)-L204A / F208A / G380D.

[0055] The amino acid sequence of the glycosyltransferase UGT91C1 mutant N4 is shown in SEQ ID NO.5; the nucleoside sequence of the glycosyltransferase UGT91C1 mutant N4 encoding gene is shown in SEQ ID NO.10.

[0056] F3:AATGTCCGCAGCCGAGCGCGCATCCTTGACGCTCTCG (SEQ ID NO. 19).

[0057] F4: CAAGGATGCGCGCTCGGCTGCGGACATTCCCGATG (SEQ ID NO. 20). Example 2

[0058] Preparation of glycosyltransferase UGT91C1 mutant enzyme solution

[0059] The above-constructed plasmids pet21a(+)-G380D, plasmid pet21a(+)-L204A, plasmid pet21a(+)-F208A, and pet21a(+)-L204A / F208A / G380D were respectively transferred into four groups of BL21 (DE3) competent cells to obtain four competent cells containing the above-mentioned different plasmids, which were then spread on solid Luria-Bertani medium containing 100 mg / L ampicillin and cultured at 37°C for 12 h. Positive clones were selected to obtain recombinant bacteria J1, J2, J3 and J4, respectively.

[0060] The single colonies of the recombinant strains J1, J2, J3, and J4 constructed above were inoculated into LB solid culture medium for culture, and the culture conditions were as follows: cultured at 35°C for 16 hours, and colonies with uniform color, raised colonies, round and smooth surfaces, and colony diameters of 2 to 3 mm were selected, and then inoculated into 5 mL of LB liquid culture medium, which contained 100 mg / L of ampicillin, and placed in a shaker for shaking culture at 37°C and 220 rpm for 7 hours to obtain the first-level seed solution of the recombinant strain J1, the first-level seed solution of the recombinant strain J2, the first-level seed solution of the recombinant strain J3, and the first-level seed solution of the recombinant strain J4, respectively.

[0061] The above-mentioned primary seed liquids were inoculated into another 50 ml LB medium at a volume ratio of 1%, respectively, and placed in a shaker, and cultured at 37°C and 220 rpm for 6 h to obtain the secondary seed liquid of the recombinant strain J1, the secondary seed liquid of the recombinant strain J2, the secondary seed liquid of the recombinant strain J3, and the secondary seed liquid of the recombinant strain J4, respectively.

[0062] The above-mentioned secondary seed liquids were added to LB fermentation medium and cultured at 37°C for 3 hours, and then IPTG with a final concentration of 0.2 mM was added for induction culture. The fermentation tank speed was controlled to be ≤1000Rpm, the ventilation ratio was 1V / V / min, the temperature was 30°C, and the pH value was 7.0. The culture was continued for 36 hours until the fermentation was completed, and the fermentation broth of the recombinant strain J1, the fermentation broth of the recombinant strain J2, the fermentation broth of the recombinant strain J3, and the fermentation broth of the recombinant strain J4 were obtained respectively.

[0063] LB medium: peptone 10 g / L, yeast powder 5 g / L, NaCl 10 g / L.

[0064] After the induction culture, the fermentation broths were centrifuged at 5000 × g for 10 min, the bacteria were collected, and the bacteria were resuspended in 100 mM sodium phosphate buffer with a pH of 7.5. The bacterial cells were broken by ultrasound to release the intracellular enzymes. The ultrasonic power was 400 W and the time was 30 min. After the ultrasound, they were centrifuged at 4 ° C and 8000 × g for 10 min in a refrigerated centrifuge, and the supernatants were collected to obtain glycosyltransferase UGT91C1 mutant N1 enzyme solution, glycosyltransferase UGT91C1 mutant N2 enzyme solution, glycosyltransferase UGT91C1 mutant N3 enzyme solution and glycosyltransferase UGT91C1 mutant N4 enzyme solution, respectively. Example 3

[0065] Enzyme activity assay

[0066] Using the wild-type glycosyltransferase UGT91C1 enzyme solution as a control, the four glycosyltransferase UGT91C1 mutant enzyme solutions obtained above, namely, glycosyltransferase UGT91C1 mutant N1 enzyme solution, glycosyltransferase UGT91C1 mutant N2 enzyme solution, glycosyltransferase UGT91C1 mutant N3 enzyme solution and glycosyltransferase UGT91C1 mutant N4 enzyme solution, were respectively prepared to determine the enzyme activity of the following five reaction systems (1 mL):

[0067] (1) 100 mM phosphate buffer (pH 7.0), 2 mM UDPG, 2 mM rebaudioside A (RA), and 5 OD wild-type glycosyltransferase UGT91C1 enzyme solution were reacted at 40°C and 200 rpm for 30 min.

[0068] (2) 100 mM phosphate buffer (pH 7.0), 2 mM UDPG, 2 mM rebaudioside A (RA), and 5 OD glycosyltransferase UGT91C1 mutant N1 enzyme solution were reacted at 40°C and 200 rpm for 30 min.

[0069] (3) 100 mM phosphate buffer (pH 7.0), 2 mM UDPG, 2 mM rebaudioside A (RA), and 5 OD glycosyltransferase UGT91C1 mutant N2 enzyme solution were reacted at 40°C and 200 rpm for 30 min.

[0070] (4) 100 mM phosphate buffer (pH 7.0), 2 mM UDPG, 2 mM rebaudioside A (RA), and 5 OD glycosyltransferase UGT91C1 mutant N3 enzyme solution were reacted at 40°C and 200 rpm for 30 min.

[0071] (5) 100 mM phosphate buffer (pH 7.0), 2 mM UDPG, 2 mM rebaudioside A (RA), and 5 OD glycosyltransferase UGT91C1 mutant N4 enzyme solution were reacted at 40°C and 200 rpm for 30 min.

[0072] After the above reactions were completed, samples were taken and heated at 95°C for 5 min to terminate the reaction, 4 volumes of ethanol were added, and the mixture was centrifuged at 12,000 rpm for 5 min. The supernatant was filtered through a 0.22 μm filter membrane, and the filtrate was detected by high performance liquid chromatography to calculate the enzyme activity.

[0073] The HPLC conditions were as follows:

[0074] Column temperature: 45°C. Chromatographic conditions: UV 210nm, mobile phase: (A) acetonitrile, (B) 10mmol sodium dihydrogen phosphate (adjusted to pH=2.6 with phosphoric acid), flow rate: 0.8 mL / min, elution program: 0~15min, 26% volume of (A), 74% volume of (B); 16~42min, 33% volume of (A), 67% volume of (B).

[0075] The results of the test are as follows Figure 1 As shown: Compared with the wild-type glycosyltransferase UGT91C1, the catalytic activities of the glycosyltransferase UGT91C1 mutants N1, N2, N3 and N4 are all improved, among which the mutant N4 carrying three mutations at the same time has the highest enzyme activity, which is 2 times higher than the wild-type glycosyltransferase UGT91C1. Example 4

[0076] Stability verification

[0077] 1. The following reaction systems (1 mL) were prepared using the glycosyltransferase UGT91C1 mutant N4 enzyme solution obtained in Example 2:

[0078] 100mM phosphate buffer, 10mM UDPG, 5mM STV, 5OD of glycosyltransferase UGT91C1 mutant N4 enzyme solution.

[0079] The above reaction system was prepared in 5 portions, and the reaction was carried out at pH values ​​of 6, 6.5, 7, 7.5, and 8.0, 35°C, and 200 rpm for 0.5 h. After the reaction, samples were taken and heated at 95°C for 5 min to terminate the reaction. After cooling, 4 times the volume of ethanol was added, and the mixture was centrifuged at 12000 rpm for 5 min. The supernatant was filtered through a 0.22 μm filter membrane, and the filtrate was detected by liquid chromatography. When STV was used as the substrate, the product was rebaudioside E (RE). The yield of RE was calculated respectively.

[0080] The results of the test are as follows Figure 2 As shown: the optimal reaction pH value of the catalytic reaction is 7~7.5, and the corresponding RE yield is the highest, indicating that the stability of the glycosyltransferase UGT91C1 mutant N4 is the highest at this pH value.

[0081] 2. The following reaction systems (1 mL) were prepared using the glycosyltransferase UGT91C1 mutant N4 enzyme solution obtained in Example 2:

[0082] 100mM phosphate buffer, 10mM UDPG, 5mM rebaudioside A (RA), 5OD of glycosyltransferase UGT91C1 mutant N4 enzyme solution.

[0083] The above reaction system was prepared in 5 portions, and the reaction was carried out at pH values ​​of 6, 6.5, 7, 7.5, and 8.0, 35°C, and 200 rpm for 0.5 h. After the reaction, samples were taken and heated at 95°C for 5 min to terminate the reaction. After cooling, 4 times the volume of ethanol was added, and the mixture was centrifuged at 12000 rpm for 5 min. The supernatant was filtered through a 0.22 μm filter membrane, and the filtrate was detected by liquid chromatography. When RA was used as the substrate, the product was rebaudioside D (RD). The yield of RD was calculated respectively.

[0084] The results of the test are as follows Figure 2 As shown: the optimal reaction pH value of the catalytic reaction is 7~7.5, and the corresponding RD yield is the highest, indicating that the stability of the glycosyltransferase UGT91C1 mutant N4 is the highest at this pH value.

[0085] 3. The following reaction system (1 mL) was prepared with the glycosyltransferase UGT91C1 mutant N4 enzyme solution obtained in Example 2:

[0086] 100 mM phosphate buffer (pH 7.0), 10 mM UDPG, 5 mM STV, 5 OD of glycosyltransferase UGT91C1 mutant N4 enzyme solution.

[0087] The above reaction system was prepared in 4 portions and reacted at 30°C, 35°C, 40°C, and 45°C at 200rpm for 0.5h. After the reaction, samples were taken and heated at 95°C for 5min to terminate the reaction. After cooling, 4 times the volume of ethanol was added. The mixture was shaken and mixed, and centrifuged at 12000rpm for 5min. The supernatant was filtered through a 0.22μm filter membrane, and the filtrate was detected by liquid chromatography to calculate the content of RE.

[0088] The results of the test are as follows Figure 3 As shown: the optimal reaction temperature of the above catalytic reaction is 35~40℃, corresponding to the highest RE yield, indicating that the stability of the glycosyltransferase UGT91C1 mutant N4 is the highest at this temperature.

[0089] 4. The following reaction system (1 mL) was prepared with the glycosyltransferase UGT91C1 mutant N4 enzyme solution obtained in Example 2:

[0090] 100 mM phosphate buffer (pH 7.0), 10 mM UDPG, 5 mM RA, 5 OD of glycosyltransferase UGT91C1 mutant N4 enzyme solution.

[0091] The above reaction system was prepared in 4 portions and reacted at 30°C, 35°C, 40°C, and 45°C at 200rpm for 0.5h. After the reaction, samples were taken and heated at 95°C for 5min to terminate the reaction. After cooling, 4 times the volume of ethanol was added to terminate the reaction. The mixture was shaken and mixed, and centrifuged at 12000rpm for 5min. The supernatant was filtered through a 0.22μm filter membrane, and the filtrate was detected by liquid chromatography to calculate the content of RD.

[0092] The results of the test are as follows Figure 3 As shown: the optimal reaction temperature of the above catalytic reaction is 35~40℃, and the corresponding RD and yields are the highest, indicating that the stability of the glycosyltransferase UGT91C1 mutant N4 is the highest at this temperature. Example 5

[0093] Conversion assay coupled to sucrose synthase

[0094] 1. RA was used as substrate to biosynthesize RD through glycosyltransferase UGT91C1 mutant N4 coupled with sucrose synthase. The specific steps are as follows:

[0095] The following reaction system was scaled up for in vitro shake flask transformation, and the final concentrations of the materials were as follows:

[0096] 50OD of glycosyltransferase UGT91C1 mutant N4 enzyme solution, 20OD of sucrose synthase enzyme solution, 700mM sucrose, 2mM UDPG, 50mM RA, made up to 10ml with 100mM phosphate buffer, and 1mM NaOH was used to adjust and maintain the pH value of the conversion system at 7.5.

[0097] The reaction system was shaken at 37°C for 24 hours before the reaction was terminated. Samples were taken at 4h, 8h, 12h, 16h and 24h during the conversion process to detect the progress of the reaction. The samples were diluted 200 times until clear and then filtered through a 0.22μm organic filter membrane. The filtered clear liquid was used to qualitatively and quantitatively detect the composition of the reaction products using liquid chromatography.

[0098] The results are as follows Figure 4 As shown: The glycosyltransferase UGT91C1 mutant coupled with sucrose synthase can construct a UDPG recycling system, while reducing the amount of UDPG added in the reaction system, and synthesizing RD using RA as a substrate.

[0099] 2. Using STV as substrate, RE was biosynthesized by coupling sucrose synthase with glycosyltransferase UGT91C1 mutant N4. The specific steps are as follows:

[0100] The following reaction system was scaled up for in vitro shake flask transformation, and the final concentrations of the materials were as follows:

[0101] 50OD of glycosyltransferase UGT91C1 mutant N4 enzyme solution, 20OD of sucrose synthase enzyme solution, 500mM sucrose, 2mM UDPG, 30mM STV, made up to 10ml with 100mM phosphate buffer, and 1mM NaOH was used to adjust and maintain the pH value of the conversion system at 7.5.

[0102] The reaction system was shaken at 37°C for 24 hours before the reaction was terminated. Samples were taken at 4h, 8h, 12h, 16h and 24h during the conversion process to detect the progress of the reaction. The samples were diluted 200 times until clear and then filtered through a 0.22μm organic filter membrane. The filtered clear liquid was used to qualitatively and quantitatively detect the composition of the reaction products using liquid chromatography.

[0103] The results are as follows Figure 4 As shown: The glycosyltransferase UGT91C1 mutant coupled with sucrose synthase can construct a UDPG recycling system, while reducing the amount of UDPG added in the reaction system, and synthesizing RE using STV as a substrate. Example 6

[0104] The effect of the amount of glycosyltransferase UGT91C1 mutant N4 on the conversion reaction was tested. The specific test process is as follows:

[0105] 1. Using STV as substrate, the following reaction systems (10 ml) with different amounts of glycosyltransferase UGT91C1 mutant N4 were prepared to catalyze STV to prepare RE:

[0106] 100mM sodium phosphate buffer (pH 7.5), glycosyltransferase UGT91C1 mutant N4 enzyme solution (20OD, 30OD, 40OD, 50OD respectively), 2 mM UDPG, 30 mM STV, 700mM sucrose, sucrose synthase enzyme solution 20OD, and 1mM NaOH was used to adjust and maintain the pH value of the conversion system at 7.5.

[0107] The above reaction systems were reacted at 40°C for 24 hours, and then heated to 95°C to inactivate and terminate the reaction. The mixture was shaken and mixed, and the mixture was filtered through a 0.22 μm organic filter membrane. The filtrate was used for qualitative and quantitative detection of the reaction products by high performance liquid chromatography.

[0108] The results are as follows Figure 5 As shown: When the enzyme amount of glycosyltransferase UGT91C1 mutant N4 was between 20 and 50 OD, there was no significant difference in the RE production.

[0109] 2. Using RA as substrate, the following reaction systems (10 ml) with different enzyme amounts of UGT91C1 mutant N4 were prepared to catalyze RA to prepare RD:

[0110] 100mM sodium phosphate buffer (pH 7.5), glycosyltransferase UGT91C1 mutant N4 enzyme solution (20OD, 30OD, 40OD, 50OD respectively), 2 mM UDPG, 50mM RA, 700mM sucrose, sucrose synthase enzyme solution 20OD, and 1mM NaOH was used to adjust and maintain the pH value of the conversion system at 7.5.

[0111] The above reaction systems were reacted at 40°C for 24 hours, and then heated to 95°C to inactivate and terminate the reaction. The mixture was shaken and mixed, and the mixture was filtered through a 0.22 μm organic filter membrane. The filtrate was used for qualitative and quantitative detection of the reaction products by high performance liquid chromatography.

[0112] The results are as follows Figure 5 As shown: When the enzyme amount of glycosyltransferase UGT91C1 mutant N4 is between 30 and 50 OD, the RD yield is the highest. Example 7

[0113] The effect of UDPG concentration on the conversion reaction was tested. The specific test process is as follows:

[0114] 1. Using STV as substrate, the following reaction systems (10 ml) with different UDPG concentrations were prepared respectively, and glycosyltransferase UGT91C1 mutant N4 was used to catalyze STV to prepare RE:

[0115] 100mM sodium phosphate buffer (pH 7.5), 30OD of glycosyltransferase UGT91C1 mutant N4 enzyme solution, UDPG (0.5mM, 1mM, 1.5mM, 2mM respectively), 30mM STV, 700mM sucrose, 20OD of sucrose synthase enzyme solution, and 1mM NaOH was used to adjust and maintain the pH value of the conversion system at 7.5.

[0116] After the above reaction systems were reacted at 40°C for 24 hours, they were heated to 95°C to inactivate and terminate the reactions, shaken and mixed, and filtered through a 0.22 μm organic filter membrane. The filtrates were used for qualitative and quantitative detection of the reaction products using high performance liquid chromatography.

[0117] The results are as follows Figure 6 As shown: When the concentration of UDPG in the reaction system is 1~2mM, the yield of RE reaches the highest.

[0118] 2. Using RA as substrate, the following reaction systems (10 ml) with different UDPG concentrations were prepared respectively, and RA was catalyzed to prepare RD using the glycosyltransferase UGT91C1 mutant N4:

[0119] 100mM sodium phosphate buffer (pH 7.5), 30OD of glycosyltransferase UGT91C1 mutant N4 enzyme solution, UDPG (0.5mM, 1mM, 1.5mM, 2mM respectively), 50mM RA, 700mM sucrose, 20OD of sucrose synthase enzyme solution, and 1mM NaOH was used to adjust and maintain the pH value of the conversion system at 7.5.

[0120] After the above reaction systems were reacted at 40°C for 24 hours, they were heated to 95°C to inactivate and terminate the reactions, shaken and mixed, and filtered through a 0.22 μm organic filter membrane. The filtrates were used for qualitative and quantitative detection of the reaction products using high performance liquid chromatography.

[0121] The results are as follows Figure 6 As shown: when the concentration of UDPG in the reaction system is 1.5~2mM, the yield of RD reaches the highest. Example 8

[0122] The effect of sucrose concentration on the conversion reaction was tested. The specific test process is as follows:

[0123] 1. Using STV as substrate, the following reaction systems with different sucrose concentrations (10 ml) were prepared respectively, and glycosyltransferase UGT91C1 mutant N4 was used to catalyze STV to prepare RE:

[0124] 100mM sodium phosphate buffer (pH 7.5), 30OD of glycosyltransferase UGT91C1 mutant N4 enzyme solution, 1.5mM UDPG, 30mM STV, sucrose (400mM, 500mM, 600mM, 700mM respectively), 20OD of sucrose synthase enzyme solution, and 1mM NaOH was used to adjust and maintain the pH value of the conversion system at 7.5.

[0125] After the above reaction systems were reacted at 40°C for 24 hours, they were heated to 95°C to inactivate and terminate the reactions, shaken and mixed, and filtered through a 0.22 μm organic filter membrane. The filtrates were used for qualitative and quantitative detection of the reaction products using high performance liquid chromatography.

[0126] The results are as follows Figure 7 As shown: when the sucrose concentration in the reaction system was 400~700mM, there was no significant difference in RE yield.

[0127] 2. Using RA as substrate, the following reaction systems with different sucrose concentrations (10 ml) were prepared respectively, and RA was catalyzed to prepare RD using the glycosyltransferase UGT91C1 mutant N4:

[0128] 100mM sodium phosphate buffer (pH 7.5), 30OD of glycosyltransferase UGT91C1 mutant N4 enzyme solution, 1.5mM UDPG, 50mM RA, sucrose (400mM, 500mM, 600mM, 700mM respectively), 20OD of sucrose synthase enzyme solution, and 1mM NaOH was used to adjust and maintain the pH value of the conversion system at 7.5.

[0129] After the above reaction systems were reacted at 40°C for 24 hours, they were heated to 95°C to inactivate and terminate the reactions, shaken and mixed, and filtered through a 0.22 μm organic filter membrane. The filtrates were used for qualitative and quantitative detection of the reaction products using high performance liquid chromatography.

[0130] The results are as follows Figure 7 As shown: when the sucrose concentration in the reaction system is 600~700mM, the RD yield is the highest.

[0131] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention is described in detail with reference to the aforementioned embodiments, those skilled in the art can still modify the technical solutions described in the aforementioned embodiments or replace some of the technical features therein by equivalents. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A glycosyltransferase UGT91C1 mutant, characterized in that: Obtained by single-point mutation or multi-point combined mutation of the 380th amino acid, the 204th amino acid, and the 208th amino acid of the amino acid sequence shown in SEQ ID NO.1: The 380th amino acid mutated from G to D; the 204th amino acid mutated from L to A; the 208th amino acid mutated from F to A; The amino acid sequence of the glycosyltransferase UGT91C1 mutant is shown in SEQ ID NO. 3, SEQ ID NO. 4 or SEQ ID NO.

5.

2. A coding gene, characterized in that It has a nucleotide sequence encoding the glycosyltransferase UGT91C1 mutant according to claim 1.

3. A biomaterial, characterized in that: The biological material comprises the coding gene according to claim 2, and the biological material is an expression unit, an expression vector or a genetically engineered bacterium.

4. Use of the mutant according to claim 1, the encoding gene according to claim 2 or the biological material according to claim 3 in the preparation of rebaudioside D or rebaudioside E.

5. The use according to claim 4, characterized in that: The glycosyltransferase UGT91C1 mutant was combined with sucrose synthase to prepare rebaudioside D using rebaudioside A, UDPG and sucrose as substrates.

6. The use according to claim 5, characterized in that: The glycosyltransferase UGT91C1 mutant was combined with sucrose synthase to prepare rebaudioside D using rebaudioside A, UDPG and sucrose as substrates. The final concentrations of the various materials in the reaction system were as follows: Sodium phosphate buffer 50-100 mM, glycosyltransferase UGT91C1 mutant enzyme solution 30-50 OD, sucrose synthase enzyme solution 15-20 OD, sucrose 600-700 mM, UDPG 1.5-2 mM, rebaudioside A 40-60 mM; the pH value of the reaction system is 7-7.5, and the reaction temperature is 35-40°C.

7. The use according to claim 4, characterized in that: The glycosyltransferase UGT91C1 mutant was combined with sucrose synthase to prepare rebaudioside E using stevioside STV, UDPG and sucrose as substrates.

8. The use according to claim 7, characterized in that: The glycosyltransferase UGT91C1 mutant was combined with sucrose synthase to prepare rebaudioside E using stevioside STV, UDPG and sucrose as substrates. The final concentrations of the various materials in the reaction system were as follows: Sodium phosphate buffer 50-100 mM, glycosyltransferase UGT91C1 mutant enzyme solution 20-50 OD, sucrose synthase enzyme solution 15-20 OD, sucrose 400-700 mM, UDPG 1-2 mM, stevioside STV 30-40 mM; the pH value of the reaction system is 7-7.5, and the reaction temperature is 35-40°C.

Images