SiRNA targeting angiotensinogen and medical application thereof

Abstract

The invention relates to siRNA (small interfering Ribonucleic Acid) targeting angiotensinogen and medical application thereof. The invention provides siRNA (small interfering Ribonucleic Acid) and shRNA (short hairpin Ribonucleic Acid) of a targeted angiotensinogen and medical

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and in particular, relates to siRNA, shRNA and a pharmaceutical composition containing the siRNA and shRNA capable of inhibiting the expression of angiotensinogen (AGT), as well as preparation methods and applications thereof. Background Art

[0002] The renin-angiotensin-aldosterone system (RAAS) plays a key role in blood pressure regulation. The RAAS is a complex network of multiple proteases and peptides that is an important regulator of cardiovascular and renal function, and overactivation of the system is central to many common pathological conditions, including hypertension, heart failure, and kidney disease. The RAAS cascade begins with the secretion of renin into the circulation by the juxtaglomerular cells of the kidney. Active renin in the plasma cleaves angiotensinogen (encoded by the AGT gene and produced by the liver) into angiotensin I, which is subsequently converted to angiotensin II by circulating and locally expressed angiotensin-converting enzyme (ACE). Most of the effects of angiotensin II on the RAAS are exerted through its binding to the angiotensin II type 1 receptor (AT1R), resulting in arterial vasoconstriction and adrenal release of aldosterone and glomerular effects such as enhanced Na + reabsorption or regulation of glomerular filtration rate, leading to sodium retention and increased blood pressure.

[0003] Dysregulation of the RAAS leading to, e.g., excessive angiotensin II production and / or AT1R stimulation causes hypertension, which can lead to, e.g., increased oxidative stress, promotion of inflammation, hypertrophy and fibrosis in the heart, kidneys and arteries, and result in, e.g., left ventricular fibrosis, arterial remodeling and glomerulosclerosis.

[0004] RAAS inhibitors include ACE inhibitors, angiotensin II receptor blockers (ARBs), aldosterone antagonists and direct renin inhibitors. RAAS inhibitors are currently important drugs for the treatment of hypertension, prevention and treatment of heart failure, and are widely used clinically. ACE inhibitors and angiotensin II receptor antagonists can activate compensatory pathways, leading to reactivation of angiotensin and aldosterone breakthrough, causing blood angiotensin II and aldosterone concentrations to return to pre-treatment or even higher levels. This may be an important factor in the poor response of patients with refractory hypertension and heart failure to RAAS inhibitory drugs. Therefore, a more effective treatment strategy should be to target the upstream of RAAS enzymes and receptors to avoid compensatory mechanisms and intracellular secretion pathways that limit the therapeutic effect.

[0005] Angiotensinogen (AGT) is the common precursor of all angiotensins, and the liver is the main source of blood AGT. Many studies have confirmed that increased blood AGT concentration is significantly positively correlated with hypertension. Reducing blood AGT concentration can inhibit the activity of the RAAS pathway and lead to a decrease in blood pressure. Treating hypertension by regulating the level of AGT is a promising research and development target.

[0006] Hypertension is a major risk factor for various diseases, disorders and conditions, such as chronic kidney disease, stroke, myocardial infarction, heart failure, cardiac damage (e.g., cardiac dilatation or hypertrophy) and other cardiovascular-related diseases. In addition, it has been shown that hypertension is an important risk factor for cardiovascular morbidity and mortality.

[0007] Despite the large number of antihypertensive drugs available for the treatment of hypertension, more than two-thirds of subjects cannot be controlled with one antihypertensive and require two or more antihypertensives from different drug classes. This further reduces the number of subjects with controlled blood pressure, as compliance and side effects increase with increasing medication use.

[0008] RNA interference (RNAi) refers to the highly conserved phenomenon in the evolutionary process, which is the efficient and specific degradation of homologous mRNA induced by double-stranded small interfering RNA (siRNA). Therefore, it is of great significance to study and develop siRNA targeting AGT. Summary of the invention

[0009] The present invention provides a siRNA and a salt thereof that can specifically inhibit the expression of human angiotensinogen (AGT). The siRNA can specifically target cells expressing human angiotensinogen (AGT), thereby achieving tissue-specific delivery of nucleic acid inhibitors and achieving the treatment of human angiotensinogen (AGT)-related diseases.

[0010] In one aspect, the present invention provides an siRNA or a salt thereof, wherein the siRNA comprises a sense strand and an antisense strand, wherein each nucleotide in the siRNA is independently a modified or unmodified nucleotide, wherein the sense strand comprises a nucleotide sequence I, and the antisense strand comprises a nucleotide sequence II, wherein the nucleotide sequence I and the nucleotide sequence II are at least partially reversely complementary to each other to form a double-stranded region, and the nucleotide sequence I and the nucleotide sequence II are selected from the group consisting of the sequences shown in (1) to (40) below:

[0011] (1) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 8, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 48:

[0012] UCCUGCAAACUUCGGUAAA(SEQ ID NO:8)

[0013] UUUACCGAAGUUUGCAGGAdTdT(SEQ ID NO:48);

[0014] (2) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 9, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 49:

[0015] CCUGCAAACUUCGGUAAAU(SEQ ID NO:9)

[0016] AUUUACCGAAGUUUGCAGGdTdT(SEQ ID NO:49);

[0017] (3) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 10, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 50:

[0018] CGGUAAAUGUGUAACUCGA(SEQ ID NO:10)

[0019] UCGAGUUACACAUUUACCGdTdT(SEQ ID NO:50);

[0020] (4) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 11, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 51:

[0021] ACUCUGUUCAGCAGUGAAA(SEQ ID NO:11)

[0022] UUUCACUGCUGAACAGAGUdTdT(SEQ ID NO:51);

[0023] (5) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 12, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 52:

[0024] UCUGUUCAGCAGUGAAACU(SEQ ID NO:12)

[0025] AGUUUCACUGCUGAACAGAdTdT (SEQ ID NO:52);

[0026] (6) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 13, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 53:

[0027] UCUGCAUCGAUCACUAAGA(SEQ ID NO:13)

[0028] UCUUAGUGAUCGAUGCAGAdTdT (SEQ ID NO:53);

[0029] (7) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 14, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 54:

[0030] UGCAUCGAUCACUAAGACU(SEQ ID NO:14)

[0031] AGUCUUAGUGAUCGAUGCAdTdT (SEQ ID NO:54);

[0032] (8) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 15, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 55:

[0033] GCAUCGAUCACUAAGACUU(SEQ ID NO:15)

[0034] AAGUCUUAGUGAUCGAUGCdTdT (SEQ ID NO:55);

[0035] (9) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 16, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 56:

[0036] GCCGUUGUUCUGGGUACUA(SEQ ID NO:16)

[0037] UAGUACCCAGAACAACGGCdTdT (SEQ ID NO: 56);

[0038] (10) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 17, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 57:

[0039] CCGUUGUUCUGGGUACUAC(SEQ ID NO:17)

[0040] GUAGUACCCAGAACAACGGdTdT (SEQ ID NO:57);

[0041] (11) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 18, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 58:

[0042] CGUUGUUCUGGGUACUACA(SEQ ID NO:18)

[0043] UGUAGUACCCAGAACAACGdTdT (SEQ ID NO: 58);

[0044] (12) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 19, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 59:

[0045] GACAUCCCCUGUGGAUGAA(SEQ ID NO:19)

[0046] UUCAUCCACAGGGGAUGUCdTdT (SEQ ID NO:59);

[0047] (13) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 20, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 60:

[0048] UGCUAGUCGCUGCAAAACU(SEQ ID NO:20)

[0049] AGUUUUGCAGCGACUAGCAdTdT (SEQ ID NO: 60);

[0050] (14) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 21, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 61:

[0051] ACAGGCUACAGGCAAUCCU(SEQ ID NO:21)

[0052] AGGAUUGCCUGUAGCCUGUdTdT (SEQ ID NO: 61);

[0053] (15) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 22, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 62:

[0054] ACCUAAGCAGCCGUUUGU(SEQ ID NO:22)

[0055] ACAAACGGCUGCUUCAGGUdTdT (SEQ ID NO: 62);

[0056] (16) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 23, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 63:

[0057] GCUCUCUGGACUUCACAGA(SEQ ID NO:23)

[0058] UCUGUGAAGUCCAGAGAGCdTdT (SEQ ID NO: 63);

[0059] (17) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 24, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 64:

[0060] CUCUCUGGACUUCACAGAA(SEQ ID NO:24)

[0061] UUCUGUGAAGUCCAGAGAGdTdT (SEQ ID NO: 64);

[0062] (18) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 25, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 65:

[0063] UGCUGAUCCAGCCUCACUA(SEQ ID NO:25)

[0064] UAGUGAGGCUGGAUCAGCAdTdT (SEQ ID NO: 65);

[0065] (19) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 26, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 66:

[0066] GGGUCUCACUUUCCAGCAA(SEQ ID NO:26)

[0067] UUGCUGGAAAGUGAGACCCdTdT (SEQ ID NO: 66);

[0068] (20) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 27, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 67:

[0069] GGUCUCACUUUCCAGCAAA(SEQ ID NO:27)

[0070] UUUGCUGGAAAGUGAGACCdTdT (SEQ ID NO: 67);

[0071] (21) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 28, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 68:

[0072] GUCUCACUUUCCAGCAAAA(SEQ ID NO:28)

[0073] UUUUGCUGGAAAGUGAGACdTdT (SEQ ID NO: 68);

[0074] (22) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 29, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 69:

[0075] AGGUGCUGAACAGCAUUU(SEQ ID NO:29)

[0076] AAAAUGCUGUUCAGCACCUdTdT(SEQ ID NO:69);

[0077] (23) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 30, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 70:

[0078] GGUGCUGAACAGCAUUUU(SEQ ID NO:30)

[0079] AAAAAUGCUGUUCAGCACCdTdT (SEQ ID NO:70);

[0080] (24) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 31, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 71:

[0081] GUGCUGAACAGCAUUUUU(SEQ ID NO:31)

[0082] AAAAAAUGCUGUUCAGCACdTdT (SEQ ID NO:71);

[0083] (25) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 32, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 72:

[0084] UGCUGAACAGCAUUUUUU(SEQ ID NO:32)

[0085] AAAAAAAUGCUGUUCAGCAdTdT(SEQ ID NO:72)

[0086] (26) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 33, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 73:

[0087] GCUGAACAGCAUUUUUUU(SEQ ID NO:33)

[0088] AAAAAAAAUGCUGUUCAGCdTdT (SEQ ID NO:73);

[0089] (27) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 34, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 74:

[0090] AGAGAGCCCACAGAGUCUA(SEQ ID NO:34)

[0091] UAGACUCUGUGGGCUCUCUdTdT(SEQ ID NO:74);

[0092] (28) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 35, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 75:

[0093] CAGUCUCCCACCUUUUCUU(SEQ ID NO:35)

[0094] AAGAAAAGGUGGGAGACUGdTdT (SEQ ID NO:75);

[0095] (29) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 36, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 76:

[0096] CCCAGUUUGCUGGGUUUAU(SEQ ID NO:36)

[0097] AUAAACCCAGCAAACUGGGdTdT (SEQ ID NO:76);

[0098] (30) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 37, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 77:

[0099] CCAGUUUGCUGGGUUUAUU(SEQ ID NO:37)

[0100] AAUAAACCCAGCAAACUGGdTdT (SEQ ID NO:77);

[0101] (31) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 38, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 78:

[0102] CAGUUUGCUGGGUUUAUUU(SEQ ID NO:38)

[0103] AAAUAAACCCAGCAAACUGdTdT (SEQ ID NO:78);

[0104] (32) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 39, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 79:

[0105] GCAUUGCCUUCGGUUUGUA(SEQ ID NO:39)

[0106] UACAAACCGAAGGCAAUGCdTdT (SEQ ID NO:79);

[0107] (33) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 40, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 80:

[0108] CAUUGCCUUCGGUUUGUAU(SEQ ID NO:40)

[0109] AUACAAACCGAAGGCAAUGdTdT (SEQ ID NO:80);

[0110] (34) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 41, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 81:

[0111] AUUGCCUUCGGUUUGUAUU(SEQ ID NO:41)

[0112] AAUACAAACCGAAGGCAAUdTdT (SEQ ID NO:81);

[0113] (35) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 42, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 82:

[0114] UUGCCUUCGGUUUGUAUUU(SEQ ID NO:42)

[0115] AAAUACAAACCGAAGGCAAdTdT (SEQ ID NO:82);

[0116] (36) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 43, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 83:

[0117] UGCCUUCGGUUUGUAUUUA(SEQ ID NO:43)

[0118] UAAAUACAAACCGAAGGCAdTdT (SEQ ID NO:83);

[0119] (37) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 44, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 84:

[0120] UGACCUCCGUGUAGUGUCU(SEQ ID NO:44)

[0121] AGACACUACACGGAGGUCAdTdT (SEQ ID NO:84);

[0122] (38) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 45, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 85:

[0123] UGAACAAUACGUGAAAGAU(SEQ ID NO:45)

[0124] AUCUUUCACGUAUUGUUCAdTdT (SEQ ID NO:85);

[0125] (39) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 46, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 86:

[0126] GAACAAUACGUGAAAGAUG(SEQ ID NO:46)

[0127] CAUCUUUCACGUAUUGUUCdTdT (SEQ ID NO:86);

[0128] (40) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 47, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 87:

[0129] GCACCUGAAUUUCUGUUUG(SEQ ID NO:47)

[0130] CAAACAGAAAUUCAGGUGCdTdT (SEQ ID NO:87).

[0131] In some embodiments, the siRNA is selected from the following double-stranded siRNAs:

[0132]

[0133]

[0134] On the other hand, the present invention provides an shRNA or a salt thereof, wherein the shRNA comprises a sense strand, an antisense strand, and a neck loop sequence separating the sense strand and the antisense strand, wherein each nucleotide in the shRNA is independently a modified or unmodified nucleotide, wherein the sense strand comprises a nucleotide sequence I, and the antisense strand comprises a nucleotide sequence II, wherein the nucleotide sequence I and the nucleotide sequence II are at least partially reversely complementary to each other to form a double-stranded region, and the nucleotide sequence I and the nucleotide sequence II are selected from the group consisting of the sequences shown in (1) to (40) below:

[0135] (1) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 8, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 48:

[0136] UCCUGCAAACUUCGGUAAA(SEQ ID NO:8)

[0137] UUUACCGAAGUUUGCAGGAdTdT(SEQ ID NO:48);

[0138] (2) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 9, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 49:

[0139] CCUGCAAACUUCGGUAAAU(SEQ ID NO:9)

[0140] AUUUACCGAAGUUUGCAGGdTdT(SEQ ID NO:49);

[0141] (3) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 10, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 50:

[0142] CGGUAAAUGUGUAACUCGA(SEQ ID NO:10)

[0143] UCGAGUUACACAUUUACCGdTdT(SEQ ID NO:50);

[0144] (4) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 11, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 51:

[0145] ACUCUGUUCAGCAGUGAAA(SEQ ID NO:11)

[0146] UUUCACUGCUGAACAGAGUdTdT(SEQ ID NO:51);

[0147] (5) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 12, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 52:

[0148] UCUGUUCAGCAGUGAAACU(SEQ ID NO:12)

[0149] AGUUUCACUGCUGAACAGAdTdT (SEQ ID NO:52);

[0150] (6) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 13, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 53:

[0151] UCUGCAUCGAUCACUAAGA(SEQ ID NO:13)

[0152] UCUUAGUGAUCGAUGCAGAdTdT (SEQ ID NO:53);

[0153] (7) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 14, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 54:

[0154] UGCAUCGAUCACUAAGACU(SEQ ID NO:14)

[0155] AGUCUUAGUGAUCGAUGCAdTdT (SEQ ID NO:54);

[0156] (8) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 15, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 55:

[0157] GCAUCGAUCACUAAGACUU(SEQ ID NO:15)

[0158] AAGUCUUAGUGAUCGAUGCdTdT (SEQ ID NO:55);

[0159] (9) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 16, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 56:

[0160] GCCGUUGUUCUGGGUACUA(SEQ ID NO:16)

[0161] UAGUACCCAGAACAACGGCdTdT (SEQ ID NO: 56);

[0162] (10) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 17, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 57:

[0163] CCGUUGUUCUGGGUACUAC(SEQ ID NO:17)

[0164] GUAGUACCCAGAACAACGGdTdT (SEQ ID NO:57);

[0165] (11) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 18, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 58:

[0166] CGUUGUUCUGGGUACUACA(SEQ ID NO:18)

[0167] UGUAGUACCCAGAACAACGdTdT (SEQ ID NO: 58);

[0168] (12) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 19, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 59:

[0169] GACAUCCCCUGUGGAUGAA(SEQ ID NO:19)

[0170] UUCAUCCACAGGGGAUGUCdTdT (SEQ ID NO:59);

[0171] (13) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 20, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 60:

[0172] UGCUAGUCGCUGCAAAACU(SEQ ID NO:20)

[0173] AGUUUUGCAGCGACUAGCAdTdT (SEQ ID NO: 60);

[0174] (14) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 21, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 61:

[0175] ACAGGCUACAGGCAAUCCU(SEQ ID NO:21)

[0176] AGGAUUGCCUGUAGCCUGUdTdT (SEQ ID NO: 61);

[0177] (15) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 22, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 62:

[0178] ACCUAAGCAGCCGUUUGU(SEQ ID NO:22)

[0179] ACAAACGGCUGCUUCAGGUdTdT (SEQ ID NO: 62);

[0180] (16) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 23, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 63:

[0181] GCUCUCUGGACUUCACAGA(SEQ ID NO:23)

[0182] UCUGUGAAGUCCAGAGAGCdTdT (SEQ ID NO: 63);

[0183] (17) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 24, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 64:

[0184] CUCUCUGGACUUCACAGAA(SEQ ID NO:24)

[0185] UUCUGUGAAGUCCAGAGAGdTdT (SEQ ID NO: 64);

[0186] (18) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 25, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 65:

[0187] UGCUGAUCCAGCCUCACUA(SEQ ID NO:25)

[0188] UAGUGAGGCUGGAUCAGCAdTdT (SEQ ID NO: 65);

[0189] (19) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 26, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 66:

[0190] GGGUCUCACUUUCCAGCAA(SEQ ID NO:26)

[0191] UUGCUGGAAAGUGAGACCCdTdT (SEQ ID NO: 66);

[0192] (20) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 27, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 67:

[0193] GGUCUCACUUUCCAGCAAA(SEQ ID NO:27)

[0194] UUUGCUGGAAAGUGAGACCdTdT (SEQ ID NO: 67);

[0195] (21) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 28, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 68:

[0196] GUCUCACUUUCCAGCAAAA(SEQ ID NO:28)

[0197] UUUUGCUGGAAAGUGAGACdTdT (SEQ ID NO: 68);

[0198] (22) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 29, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 69:

[0199] AGGUGCUGAACAGCAUUU(SEQ ID NO:29)

[0200] AAAAUGCUGUUCAGCACCUdTdT(SEQ ID NO:69);

[0201] (23) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 30, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 70:

[0202] GGUGCUGAACAGCAUUUU(SEQ ID NO:30)

[0203] AAAAAUGCUGUUCAGCACCdTdT (SEQ ID NO:70);

[0204] (24) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 31, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 71:

[0205] GUGCUGAACAGCAUUUUU(SEQ ID NO:31)

[0206] AAAAAAUGCUGUUCAGCACdTdT (SEQ ID NO:71);

[0207] (25) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 32, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 72:

[0208] UGCUGAACAGCAUUUUUU(SEQ ID NO:32)

[0209] AAAAAAAUGCUGUUCAGCAdTdT(SEQ ID NO:72)

[0210] (26) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 33, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 73:

[0211] GCUGAACAGCAUUUUUUU(SEQ ID NO:33)

[0212] AAAAAAAAUGCUGUUCAGCdTdT (SEQ ID NO:73);

[0213] (27) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 34, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 74:

[0214] AGAGAGCCCACAGAGUCUA(SEQ ID NO:34)

[0215] UAGACUCUGUGGGCUCUCUdTdT(SEQ ID NO:74);

[0216] (28) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 35, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 75:

[0217] CAGUCUCCCACCUUUUCUU(SEQ ID NO:35)

[0218] AAGAAAAGGUGGGAGACUGdTdT (SEQ ID NO:75);

[0219] (29) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 36, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 76:

[0220] CCCAGUUUGCUGGGUUUAU(SEQ ID NO:36)

[0221] AUAAACCCAGCAAACUGGGdTdT (SEQ ID NO:76);

[0222] (30) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 37, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 77:

[0223] CCAGUUUGCUGGGUUUAUU(SEQ ID NO:37)

[0224] AAUAAACCCAGCAAACUGGdTdT (SEQ ID NO:77);

[0225] (31) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 38, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 78:

[0226] CAGUUUGCUGGGUUUAUUU(SEQ ID NO:38)

[0227] AAAUAAACCCAGCAAACUGdTdT (SEQ ID NO:78);

[0228] (32) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 39, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 79:

[0229] GCAUUGCCUUCGGUUUGUA(SEQ ID NO:39)

[0230] UACAAACCGAAGGCAAUGCdTdT (SEQ ID NO:79);

[0231] (33) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 40, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 80:

[0232] CAUUGCCUUCGGUUUGUAU(SEQ ID NO:40)

[0233] AUACAAACCGAAGGCAAUGdTdT (SEQ ID NO:80);

[0234] (34) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 41, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 81:

[0235] AUUGCCUUCGGUUUGUAUU(SEQ ID NO:41)

[0236] AAUACAAACCGAAGGCAAUdTdT (SEQ ID NO:81);

[0237] (35) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 42, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 82:

[0238] UUGCCUUCGGUUUGUAUUU(SEQ ID NO:42)

[0239] AAAUACAAACCGAAGGCAAdTdT (SEQ ID NO:82);

[0240] (36) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 43, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 83:

[0241] UGCCUUCGGUUUGUAUUUA(SEQ ID NO:43)

[0242] UAAAUACAAACCGAAGGCAdTdT (SEQ ID NO:83);

[0243] (37) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 44, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 84:

[0244] UGACCUCCGUGUAGUGUCU(SEQ ID NO:44)

[0245] AGACACUACACGGAGGUCAdTdT (SEQ ID NO:84);

[0246] (38) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 45, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 85:

[0247] UGAACAAUACGUGAAAGAU(SEQ ID NO:45)

[0248] AUCUUUCACGUAUUGUUCAdTdT (SEQ ID NO:85);

[0249] (39) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 46, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 86:

[0250] GAACAAUACGUGAAAGAUG(SEQ ID NO:46)

[0251] CAUCUUUCACGUAUUGUUCdTdT (SEQ ID NO:86);

[0252] (40) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 47, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 87:

[0253] GCACCUGAAUUUCUGUUUG(SEQ ID NO:47)

[0254] CAAACAGAAAUUCAGGUGCdTdT (SEQ ID NO:87).

[0255] In some embodiments, in the siRNA or shRNA of the present invention, each nucleotide is independently a modified or unmodified nucleotide. In some embodiments, the siRNA or shRNA of the present invention may contain at least one modified nucleotide and / or at least one interstrand modification.

[0256] In some embodiments, all nucleotides on the sense strand are modified nucleotides.

[0257] In some embodiments, all nucleotides on the antisense strand are modified nucleotides.

[0258] In some embodiments, substantially all of the nucleotides of the sense strand and the antisense strand are modified nucleotides.

[0259] In some embodiments, all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand are modified nucleotides.

[0260] The modified nucleotides include, but are not limited to, 2'-F, 2'-OME, 2'-MOE, GNA, UNA, PNA, 5'-VP and other modified nucleotides.

[0261] 2'-F, 2'-OME, and 2'-MOE modifications refer to the replacement of the hydroxyl group at the 2' position of the furanose ring of the nucleotide with fluorine (F), methoxy (OMe), or methoxyethoxy (MOE), respectively.

[0262] GNA modification refers to glycerol nucleotides, which are composed of glycerol (a five-carbon sugar in DNA and RNA) linked by phosphate bonds.

[0263] UNA modification refers to open-ring nucleotides. UNA lacks the C2' and C3' chemical bonds of the RNA ribose ring, but can still mimic unmodified RNA when bound to the RNA double-stranded structure.

[0264] PNA modification refers to peptide nucleic acid, a class of DNA analogs that replace the sugar-phosphate backbone with a polypeptide backbone.

[0265] 5'-VP modification refers to the modification of the 5' end of the siRNA by vinyl-phosphodiesterase.

[0266] The interchain modifications include, but are not limited to, phosphorothioate, -OEt, -OME and other modifications. Phosphorothioate modification refers to the replacement of the hydroxyl group on the phosphate backbone by a thiol group, -OEt modification refers to the replacement of the hydrogen of the hydroxyl group on the phosphate backbone by an ethyl group, and -OME modification refers to the replacement of the hydrogen of the hydroxyl group on the phosphate backbone by a methyl group.

[0267] In another aspect, the present invention provides a method for preparing the above shRNA or siRNA.

[0268] The shRNA or siRNA of the present invention can be chemically synthesized or prepared by transcribing an expression cassette in a recombinant nucleic acid structure into a single-stranded RNA. Nucleic acid inhibitors such as siRNA or shRNA (or constructs or expression vectors containing shRNA) can be delivered into cells by using appropriate transfection reagents, or can also be delivered into cells using a variety of techniques known in the art.

[0269] In yet another aspect, the present invention provides a pharmaceutical composition comprising the above-mentioned siRNA and / or shRNA and / or salts thereof, and optionally a pharmaceutically acceptable carrier.

[0270] As used herein, "pharmaceutically acceptable carriers" refer to carriers for administering therapeutic agents, including various excipients and diluents. In the composition, pharmaceutically acceptable carriers may contain liquids, such as water, saline, buffers, etc. In addition, auxiliary substances may also be present in these carriers, such as fillers, lubricants, glidants, wetting agents and emulsifiers, pH buffer substances, etc. The carriers may also contain cell transfection reagents.

[0271] In some embodiments, the pharmaceutical composition of the present invention can be administered in various forms, including but not limited to intravenous administration, subcutaneous injection, intramuscular injection, transdermal administration, topical administration, implantation, sustained-release administration, and the like.

[0272] In the present invention, the salt of the product, for example, the above-mentioned siRNA, shRNA, for example, can be an alkali metal salt, such as a potassium salt, a sodium salt or a lithium salt, or can be an ammonium salt. In particular, the salt is a sodium salt.

[0273] In another aspect, the present invention provides a method for treating a subject who would benefit from reduced expression of angiotensinogen (AGT), the method comprising administering to the subject a therapeutically effective amount of the siRNA or salt thereof and / or shRNA or salt thereof and / or pharmaceutical composition of the present invention.

[0274] In some embodiments, the method comprises administering to the subject a fixed dose of about 50 mg to 800 mg of the active substance of the siRNA or salt thereof and / or shRNA or salt thereof and / or pharmaceutical composition.

[0275] In another aspect, the present invention provides use of the above siRNA or salt thereof or shRNA or salt thereof or pharmaceutical composition in the preparation of a drug capable of inhibiting the expression of angiotensinogen (AGT) gene.

[0276] In another aspect, the present invention provides use of the above siRNA or salt thereof or shRNA or salt thereof or pharmaceutical composition in the preparation of a drug for preventing or treating angiotensinogen (AGT)-related diseases or disorders.

[0277] In the present invention, the angiotensinogen (AGT)-related diseases or disorders refer to diseases caused by angiotensinogen disorder, examples of which include but are not limited to hypertension, critical hypertension, essential hypertension, secondary hypertension, hypertensive crisis, hypertensive emergency state, isolated systolic and diastolic hypertension, pregnancy-related hypertension, diabetic hypertension, resistant hypertension, refractory hypertension, paroxysmal hypertension, renovascular hypertension, Goldblatt's hypertension, ocular hypertension, glaucoma, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, unstable hypertension, hypertensive heart disease, and hypertensive nephropathy.

[0278] In yet another aspect, the present invention provides a method for inhibiting the expression of angiotensinogen (AGT) gene in cells, the method comprising contacting the cells with an effective amount of the siRNA, shRNA, salts thereof and / or pharmaceutical composition described in the present invention, thereby inhibiting the expression of AGT gene in the cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0279] Figure 1 Shown is the amount of remaining AGT mRNA after administration of AGT siRNA in the HepG2 cell line.

[0280] Figures 2 to 4 The inhibition rate and IC50 of AGT siRNA in inhibiting AGT mRNA in HepG2 cell line are shown. DETAILED DESCRIPTION

[0281] Hereinafter, the specific embodiments of the present invention will be described in detail. It should be understood that the specific embodiments described herein are only used to illustrate and explain the present invention, and are not used to limit the present invention.

[0282] In the present invention, angiotensinogen (AGT) mRNA refers to mRNA having a sequence shown in Genbank Accession No. NM_000029.3. Further, unless otherwise specified, the term "target gene" used in the present invention refers to a gene that transcribes the above AGT mRNA, and the term "target mRNA" refers to the above AGT mRNA.

[0283] definition

[0284] The term "linked" as used herein, when referring to the connection between two molecules, means that the two molecules are connected by a covalent bond or the two molecules are associated via a non-covalent bond (eg, a hydrogen bond or an ionic bond).

[0285] The term "inhibit" as used herein, when referring to the expression of a given gene, means that gene expression is reduced when the cell, cell population or tissue is treated with the siRNA, shRNA and pharmaceutical composition of the present invention, compared to cells, cell populations or tissues that have not been so treated.

[0286] The term "inhibit" in the present invention is used interchangeably with "reduce", "silence", "downregulate" and other similar terms, and includes any level of inhibition. Preferably, inhibition includes statistically significant inhibition or clinically significant inhibition.

[0287] As used herein, the phrase "inhibiting the expression of AGT" or "inhibiting the expression of an AGT gene" includes inhibiting the expression of any AGT gene (e.g., an AGT gene expressed by an expression construct in a cell) as well as variants or mutants of an AGT gene encoding an AGT protein.

[0288] Each nucleotide in the sense strand and the antisense strand is independently a modified or unmodified nucleotide.

[0289] In the context of the present invention, the expressions "complementary" or "reverse complementary" are used interchangeably and have the meaning known to those skilled in the art, i.e., in a double-stranded nucleic acid molecule, the bases of one chain are each paired with the bases on the other chain in a complementary manner. In DNA, the purine base adenine (A) is always paired with the pyrimidine base thymine (T) (or uracil (U) in RNA); the purine base guanine (C) is always paired with the pyrimidine base cytosine (G). Each base pair includes a purine and a pyrimidine. When adenine on one chain is always paired with thymine (or uracil) on the other chain, and guanine is always paired with cytosine, the two chains are considered to be complementary to each other, and the sequence of the chain can be inferred from the sequence of its complementary chain. Correspondingly, "mismatch" means in the art that in a double-stranded nucleic acid, the bases at corresponding positions are not paired in a complementary form.

[0290] In the above and below, unless otherwise specified, "substantially reverse complementary" means that there are no more than 3 base mismatches between the two nucleotide sequences involved; "substantially reverse complementary" means that there are no more than 1 base mismatch between the two nucleotide sequences; "completely reverse complementary" means that there is no base mismatch between the two nucleotide sequences. In the above and below, the existence of "nucleotide difference" between one nucleotide sequence and another nucleotide sequence means that the base type of the nucleotide at the same position of the former is changed compared with the latter. For example, when a nucleotide base in the latter is A, and the corresponding nucleotide base at the same position of the former is U, C, G or T, it is determined that there is a nucleotide difference at that position between the two nucleotide sequences. In some embodiments, when a nucleotide at the original position is replaced by an abasic nucleotide or its equivalent, it can also be considered that a nucleotide difference has occurred at that position.

[0291] In the above and below, particularly when describing the preparation method of the siRNA of the present invention, the pharmaceutical composition containing siRNA, unless otherwise specified, the nucleoside monomer (nucleoside monomer) refers to the modified or unmodified nucleoside phosphoramidite monomer (unmodified or modified RNA phosphoramidites, sometimes RNA phosphoramidites are also referred to as Nucleoside phosphoramidites) used in the phosphoramidite solid phase synthesis according to the type and order of nucleotides in the siRNA to be prepared. Phosphoramidite solid phase synthesis is a method used in RNA synthesis known to those skilled in the art. The nucleoside monomer used in the present invention can be obtained by commercial purchase.

[0292] As used herein, "optional" or "optionally" means that the event or situation described thereafter may or may not occur, and the description includes instances where the event or situation occurs and instances where it does not occur. For example, "optionally substituted" "alkyl" includes "alkyl" and "substituted alkyl" as defined below. It will be understood by those skilled in the art that for any group containing one or more substituents, these groups are not intended to introduce any substitution or substitution pattern that is sterically impractical, synthetically unfeasible, and / or inherently unstable.

[0293] The term "subject", as used herein, refers to any animal, such as a mammal or marsupial. Subjects of the present invention include, but are not limited to, humans, non-human primates (e.g., monkeys and gorillas), mice, rabbits, dogs, cats, pigs, horses, cows, rats, or poultry of any kind.

[0294] As used herein, "treatment" refers to a method for obtaining a beneficial or desired result, including but not limited to a therapeutic benefit. "Therapeutic benefit" means eradicating or improving the underlying disorder being treated. In addition, the therapeutic benefit is obtained by eradicating or improving one or more physiological symptoms associated with the underlying disorder, thereby observing improvement in the subject, although the subject may still be afflicted with the underlying disorder. "Improvement" refers to the alleviation of at least one indicator, marker, sign and / or symptom of a related disease, disorder or condition. In certain embodiments, improvement includes delaying or slowing down the progress of one or more indicators of a condition, disorder and / or disease. The severity of the indicator can be determined by subjective or objective metrics known to those skilled in the art.

[0295] "Hypertension" or "HTN" refers to a chronic medical condition in which blood pressure is elevated in animals. Elevated blood pressure requires the heart to work harder to circulate blood through the blood vessels. It is said that if blood pressure is continuously at or above 140 / 90 mmHg, high blood pressure is present. Hypertension is classified as primary (idiopathic) or secondary. The cause of primary hypertension is unclear and is believed to be related to genetics, diet, lack of exercise and obesity. Secondary hypertension is caused by another medical condition. Hypertension is a major risk factor for the following: shortened life expectancy, chronic kidney disease, stroke, myocardial infarction, heart failure, vascular aneurysm (e.g., aortic aneurysm), peripheral arterial disease, organ damage (e.g., cardiac enlargement or hypertrophy) and other cardiovascular diseases, disorders and / or conditions or symptoms thereof. Antihypertensive drugs, dietary changes and lifestyle changes can reduce hypertension and reduce diseases, disorders and / or conditions associated with hypertension. Hypertension can be resistant to drug intervention (i.e., controllable by commercially available drug therapy) or resistant to drug intervention.

[0296] The present invention is further described below in conjunction with examples, but these examples are not intended to limit the scope of the present invention. Experimental methods in the examples of the present invention that do not specify specific conditions are generally carried out under conventional conditions or under conditions recommended by raw material or commodity manufacturers. Reagents that do not specify specific sources can be obtained from any supplier of molecular biology reagents with quality / purity for molecular biology applications.

[0297] Example 1 Sequence Design of Human AGT siRNA

[0298] Human (Homo sapiens) AGT gene (SEQ ID NO: 1, 2, 3), mouse (Mus musculus) AGT gene (SEQ ID NO: 4), rat (Rattus norvegicus) AGT gene (SEQ ID NO: 5), monkey (Macaca mulatta) AGT gene (SEQ ID NO: 6, 7) were used as target genes to design 19 / 19nt siRNAs to meet the general rules of active siRNAs, wherein two thymine deoxyribonucleic acids were added to the 3' end of the antisense strand. And siRNAs with homology between human AGT siRNA and mouse or rat or monkey gene sequences were selected as siRNA sets to be screened. The unmodified sense and antisense strand sequences are detailed in Table 1.

[0299] Table 1. Unmodified sense and antisense strands of human siRNA

[0300]

[0301]

[0302] Example 2 Inhibition of AGT in Human Hepatoma Cell Line (HepG) by siRNA - Inhibitory Activity at Two Concentration Points

[0303] Dosage experiments were performed in a human hepatoma cell line (HepG2) at two concentrations, 10 nM and 0.1 nM final duplex concentrations. See Table 2 for experimental consumables.

[0304] 24h before transfection, HepG2 cells were plated on 96-well plates at about 20,000 cells / well, with 100 μL of culture medium per well. During transfection, Lipofectamine RNAi MAX (ThermoFisher, 13778150) was used to transfect siRNA according to the product manual. The final concentration of siRNA transfection was 10nM and 0.1nM. After 24 hours of treatment, total RNA was extracted from cells using a high-throughput cell RNA extraction kit (QIAGEN, RNeasy 96Kit) and RNA reverse transcription experiments (Takara PrimeScript TM II 1st Strand cDNA Synthesis Kit:6210A) and quantitative real-time PCR (ThermoTaqMan TM Fast Advanced Master Mix: 4444964) was used for detection, and the Taqman probe primer information is shown in Table 3. The mRNA level of human AGT was measured and corrected according to the level of the hGAPDH internal reference gene.

[0305] After the Taqman probe Q-PCR test is completed, the corresponding Ct value is obtained according to the threshold value automatically set by the system. The relative expression of the AGT gene is quantified by comparing the Ct values: Comparative Ct refers to calculating the gene expression difference by the difference between the Ct value of the internal reference gene, also known as 2 -ΔΔCt , ΔΔCt=[(Ct experimental group target gene-Ct experimental group internal reference)-(Ct control group target gene-Ct control group internal reference)].

[0306] Table 2. Consumables for cell viability screening experiments

[0307] name company Part Number / Model Lipofectamine RNAi Max Invitrogen 13778150 High-throughput Cellular RNA Extraction Kit QIAGEN 74181 <![CDATA[PrimeScript TM II 1st Strand cDNA Synthesis Kit]]> Takara 6210B(A×4) <![CDATA[TaqMan TM Fast Advanced Master Mix]]> Thermo 4444964

[0308] Table 3. Taqman probe primer information table

[0309] Primer name SEQ ID NO: Sequence information hAGT-P-MGB 88 ATGAAGAAACTATCTCCCCGGACCATCCA hAGT-F-MGB 89 GGACAAGGTGGAGGGTCTCAC hAGT-R-MGB 90 AGATCCTTGCAGCACCAGTTG hGAPDH-PF1-MGB 91 GACCCCTTCATTGACCTCAACTAC hGAPDH-PR1-MGB 92 TTGACGGTGCCATGGAATTT hGAPDH-P1-MGB 93 TTACATGTTCCAATATGATTCC

[0310] The results are expressed as the residual expression of human AGT mRNA relative to control cells not treated with siRNA. Figure 1 and Table 4.

[0311] Table 4. Results of the effects of dual siRNA concentrations on the residual expression of AGT in human hepatoma cell line (HepG2)

[0312]

[0313]

[0314] Example 3 Inhibition of AGT in Human Hepatoma Cell Line (HepG2) by siRNA - Inhibitory Activity at Multiple Concentration Points

[0315] A dose response experiment was performed in a human hepatoma cell line (HepG2) using siRNA at 7 concentration gradient points.

[0316] The experimental operation is referred to Example 2. 24h before transfection, HepG2 cells were plated on a 96-well plate at about 20,000 cells / well, with 100 μL culture medium per well. During transfection, Lipofectamine RNAi MAX (ThermoFisher, 13778150) was used to transfect siRNA with reference to the product manual, and the gradient final concentration of siRNA transfection was 10, 2.5, 0.625, 0.15625, 0.039036, 0.009766 and 0.002441 nM. After 24 hours of treatment, a high-throughput cell RNA extraction kit was used to extract total cell RNA, perform RNA reverse transcription experiments and quantitative real-time PCR detection, determine the mRNA level of human VEGFA, and calibrate the mRNA level of human AGT according to the level of the GAPDH internal reference gene.

[0317] The results are expressed as the remaining percentage of human AGT mRNA expression relative to control cells not treated with siRNA. The overall results of the inhibition rate of each siRNA are shown in Figures 2 to 4 , the inhibition rate IC 50 The results are shown in Table 5.

[0318] Table 5. IC50 concentration inhibitory activity of siRNA against human AGT in HepG2 cells

[0319]

[0320] SEQ ID NO:1

[0321] ATCCCATGAGCGGGCAGCAGGGTCAGAAGTGGCCCCCGTGTTGCCTAAGCAAGACTCTCCCCTGCC

[0322] CTCTGCCCTCTGCACCTCCGGCCTGCATGTCCCTGTGGCCTCTTGGGGGTACATCTCCCGGGGCTGG

[0323] GTCAGAAGGCCTGGGTGGTTGGCCTCAGGCTGTCACACACCTAGGGAGATGCTCCCGTTTCTGGGA

[0324] ACCTTGGCCCCGACTCCTGCAAACTTCGGTAAATGTGTAACTCGACCCTGCACCGGCTCACTCTGTT

[0325] CAGCAGTGAAACTCTGCATCGATCACTAAGACTTCCTGGAAGAGGTCCCAGCGTGAGTGTCGCTTCT

[0326] GGCATCTGTCCTTCTGGCCAGCCTGTGGTCTGGCCAAGTGATGTAACCCTCCTCTCCAGCCTGTGCA

[0327] CAGGCAGCCTGGGAACAGCTCCATCCCCACCCCTCAGCTATAAATAGGGCATCGTGACCCGGCCGGG

[0328] GGAAGAAGCTGCCGTTGTTCTGGGTACTACAGCAGAAGGGTATGCGGAAGCGAGCACCCCAGTCTG

[0329] AGATGGCTCCTGCCGGTGTGAGCCTGAGGGCCACCATCCTCTGCCTCCTGGCCTGGGCTGGCCTGGC

[0330] TGCAGGTGACCGGGTGTACATACACCCCTTCCACCTCGTCATCCACAATGAGAGTACCTGTGAGCAG

[0331] CTGGCAAAGGCCAATGCCGGGAAGCCCAAAGACCCCACCTTCATACCTGCTCCAATTCAGGCCAAG

[0332] ACATCCCCTGTGGATGAAAAGGCCCTACAGGACCAGCTGGTGCTAGTCGCTGCAAAACTTGACACC

[0333] GAAGACAAGTTGAGGGCCGCAATGGTCGGGATGCTGGCCAACTTCTTGGGCTTCCGTATATATGGCA

[0334] TGCACAGTGAGCTATGGGGCGTGGTCCATGGGGCCACCGTCCTCTCCCCAACGGCTGTCTTTGGCAC

[0335] CCTGGCCTCTCTCTATCTGGGAGCCTTGGACCACACAGCTGACAGGCTACAGGCAATCCTGGGTGTT

[0336] CCTTGGAAGGACAAGAACTGCACCTCCCGGCTGGATGCGCACAAGGTCCTGTCTGCCCTGCAGGCT

[0337] GTACAGGGCCTGCTAGTGGCCCAGGGCAGGGCTGATAGCCAGGCCCAGCTGCTGCTGTCCACGGTG

[0338] GTGGGCGTGTTCACAGCCCCAGGCCTGCACCTGAAGCAGCCGTTTGTGCAGGGCCTGGCTCTCTATA

[0339] CCCCTGTGGTCCTCCCACGCTCTCTGGACTTCACAGAACTGGATGTTGCTGCTGAGAAGATTGACAG

[0340] GTTCATGCAGGCTGTGACAGGATGGAAGACTGGCTGCTCCCTGATGGGAGCCAGTGTGGACAGCAC

[0341] CCTGGCTTTCAACACCTACGTCCACTTCCAAGGGAAGATGAAGGGCTTCTCCCTGCTGGCCGAGCCC

[0342] CAGGAGTTCTGGGTGGACAACAGCACCTCAGTGTCTGTTCCCATGCTCTCTGGCATGGGCACCTTCC

[0343] AGCACTGGAGTGGACATCCAGGACAACTTCTCGGTGACTCAAGTGCCCTTTCACTGAGAGCGCCTGCC

[0344] TGCTGCTGATCCAGCCTCACTATGCCTCTGACCTGGACAAGGTGGAGGGTCTCACTTTCCAGCAAAA

[0345] CTCCCTCAACTGGATGAAGAAACTATCTCCCCGGACCATCCACCTGACCATGCCCCAACTGGTGCTG

[0346] CAAGGATCTTATGACCTGCAGGACCTGCTCGCCCAGGCTGGAGCTGCCCGCCATTCTGCCACACCGAGC

[0347] TGAACCTGCAAAATTGAGCAATGACCGCATCAGGGTGGGGGAGGTGCTGAACAGCATTTTTTTTG

[0348] AGCTTGAAGCGGATGAGAGAGAGCCCACAGAGTCTACCCAACAGCTTAACAAGCCTGAGGTCTTGG

[0349] AGGTGACCCTGAACCGCCCATTCCTGTTTGCTGTGTATGATCAAAGCGCCACTGCCCTGCACTTCCT

[0350] GGGCCGCGTGGCCAACCCGCTGAGCACAGCATGAGGCCAGGGCCCCAGAACACAGTGCCTGGCAA

[0351] GGCCTCTGCCCCTGGCCTTTGAGGCAAAGGCCAGCAGCAGATAACAACCCCGGACAAATCAGCGAT

[0352] GTGTCACCCCCAGTCTCCCACCTTTTCTTCTAATGAGTCGACTTTGAGCTGGAAAGCAGCCGTTTCT

[0353] CCTTGGTCTAAGTGTGCTGCATGGAGTGAGCAGTAGAAGCCTGCAGCGGCACAAATGCACCTCCCA

[0354] GTTTGCTGGGTTTATTTTAGAGAATGGGGGTGGGGAGGCAAGAACCAGTGTTTAGCGCGGGACTACT

[0355] GTTCCAAAAAGAATTCCAACCGACCAGCTTGTTTGTGAAACAAAAAAGTGTTCCCTTTTCAAGTTG

[0356] AGAACAAAAATTGGGTTTTAAAATTAAAGTATACATTTTTGCATTGCCTTCGGTTTGTATTTAGTGTCT

[0357] TGAATGTAAGAACATGACCTCCGTGTAGTGTCTGTAATACCTTAGTTTTTTCCACAGATGCTTGTGATT

[0358] TTTGAACAATACGTGAAAGATGCAAGCACCTGAATTTCTGTTTGAATGCGGAACCATAGCTGGTTATT

[0359] TCTCCCTTGTGTTAGTAATAAACGTCTTGCCACAATAAGCCTCCAAAAAAAA

[0360] SEQ ID NO:2

[0361] GAAGAAGCTGCCGTTGTTCTGGGTACTACAGCAGAAGGGTATGCGGAAGCGAGCACCCCAGTCTGGA

[0362] GATGGCTCCTGCCGGTGTGAGCCTGAGGGCCACCATCCTCTGCCTCCTGGCCTGGGCTGGCCTGGCT

[0363] GCAGGTGACCGGGTGTACATACACCCCTTCCACCTCGTCATCCACAATGAGAGTACCTGTGAGCAGC

[0364] TGGCAAAGGCCAATGCCGGGAAGCCCAAAGACCCCACCTTCATACCTGCTCCAATTCAGGCCAAGA

[0365] CATCCCCTGTGGAATGAAAGGCCCTACAGGACCAGCTGGTGCTAGTCGCTGCAAAACTTGACACCG

[0366] AAGACAAGTTGAGGGCCGCAATGGTCGGGATGCTGGCCAACTTCTTGGGCTTCCGTATATATGGCAT

[0367] GCACAGTGAGCTATGGGGCGTGGTCCATGGGGCCACCGTCCTTCCCCAACGGCTGTCTTTGGCACC

[0368] CTGGCCTCTCTCTATCTGGGAGCCTTGGACCACACAGCTGACAGGCTACAGGCAATCCTGGGTGTTC

[0369] CTTGGAAGGACAAGAACTGCACCTCCCGGCTGGATGCGCACAAGGTCCTGTCTGCCCTGCAGGCTG

[0370] TACAGGGCCTGCTAGTGGCCCAGGGCAGGGCTGATAGCCAGGCCCAGCTGCTGCTGTCCACGGTGG

[0371] TGGGCGTGTTCACAGCCCCAGGCCTGCACCTGAAGCAGCCGTTTGTGCAGGGCCTGGCTCTCTATAC

[0372] CCCTGTGGTCCTCCCACGCTCTCTGGACTTCACAGAACTGGATGTTGCTGCTGAGAAGATTGACAGG

[0373] TTCATGCAGGCTGTGACAGGATGGAAGACTGGCTGCTCCCTGATGGGAGCCAGTGTGGACAGCACC

[0374] CTGGCTTTCAACACCTACGTCCACTTCCAAGGGAAGATGAAGGGCTTCTCCCTGCTGGCCGAGCCCC

[0375] AGGAGTTCTGGGTGGACAACAGCACCTCAGTGTCTGTTCCCATGCTCTCTGGCATGGGCACCTTCCA

[0376] GCACTGGAGTGACATCCAGGACAACTTCTCGGTGACTCAAGTGCCCTTCACTGAGAGCGCCTGCCT

[0377] GCTGCTGATCCAGCCTCACTATGCCTCTGACCTGGACAAGGTGGAGGGTCTCACTTTCCAGCAAAAC

[0378] TCCCTCAACTGGATGAAGAAACTATCTCCCCGGACCATCCACCTGACCATGCCCCAACTGGTGCTGC

[0379] AAGGATCTTATGACCTGCAGGACCTGCTCGCCCAGGCTGAGCTGCCCGCCATTCTGCACACCGAGCT

[0380] GAACCTGCAAAAATTGAGCAATGACCGCATCAGGGTGGGGGAGGTGCTGAACAGCATTTTTTTTGA

[0381] GCTTGAAGCGGATGAGAGAGAGCCCACAGAGTCTACCCAACAGCTTAACAAGCCTGAGGTCTTGGA

[0382] GGTGACCCTGAACCGCCCATTCCTGTTTGCTGTGTATGATCAAAGCGCCACTGCCCTGCACTTCCTG

[0383] GGCCGCGTGGCCAACCCGCTGAGCACAGCATGAGGCCAGGGCCCCAGAACACAGTGCCTGGCAAG

[0384] GCCTCTGCCCCTGGCCTTTGAGGCAAAGGCCAGCAGCAGATAACAACCCCGGACAAATCAGCGATG

[0385] TGTCACCCCCAGTCTCCCACCTTTTCTTCTAATGAGTCGACTTTGAGCTGGAAAGCAGCCGTTTCTCC

[0386] TTGGTCTAAGTGTGCTGCATGGAGTGAGCAGTAGAAGCCTGCAGCGGCACAAATGCACCTCCCAGT

[0387] TTGCTGGGTTTATTTTAGAGAATGGGGGTGGGGAGGCAAGAACCAGTGTTTAGCGCGGGACTACTGT

[0388] TCCAAAAAGAATTCCAACCGACCAGCTTGTTTGTGAAACAAAAAAGTGTTCCCTTTTCAAGTTGAG

[0389] AACAAAAATTGGGTTTTAAAATTAAAGTATACATTTTTGCATTGCCTTCGGTTTGTATTTAGTGTCTTG

[0390] AATGTAAGAACATGACCTCCGTGTAGTGTCTGTAATACCTTAGTTTTTTCCACAGATGCTTGTGATTTT

[0391] TGAACAATACGTGAAAGATGCAAGCACCTGAATTTCTGTTTGAATGCGGAACCATAGCTGGTTATTTC

[0392] TCCCTTGTGTTAGTAATAAACGTCTTGCCACAATAAGCCTCCAAAAA

[0393] SEQ ID NO:3

[0394] AGAAAGTAGACCCTCACCAGGCATGGAATCTGCCAGTGCCTTGATCTTGGACTTCCAGCTTCCAGAA

[0395] CTGGTATGCGGAAGCGAGCACCCCAGTCTGAGATGGCTCCTGCCGGTGTGAGCCTGAGGGCCACCA

[0396] TCCTCTGCCTCCTGGCCTGGGCTGGCCTGGCTGCAGGTGACCGGGTGTACATACACCCCTTCCACCT

[0397] CGTCATCCACAATGAGAGTACCTGTGAGCAGCTGGCAAAGGCCAATGCCGGGAAGCCCAAAGACCC

[0398] CACCTTCATACCTGCTCCAATTCAGGCCAAGACATCCCCTGTGGATGAAAAGGCCCTACAGGACCAG

[0399] CTGGTGCTAGTCGCTGCAAAACTTGACACCGAAGACAAGTTGAGGGCCGCAATGGTCGGGATGCTG

[0400] GCCAACTTCTTGGGCTTCCGTATATATGGCATGCACAGTGAGCTATGGGGCGTGGTCCATGGGGCCAC

[0401] CGTCCTCTCCCCAACGGCTGTCTTTGGCACCCTGGCCTCTCTCTATCTGGGAGCCTTGGACCACACA

[0402] GCTGACAGGCTACAGGCAATCCTGGGTGTTCCTTGGAAGGACAAGAACTGCACCTCCCGGCTGGAT

[0403] GCGCACAAGGTCCTGTCTGCCCTGCAGGCTGTACAGGGCCTGCTAGTGGCCCAGGGCAGGGCTGAT

[0404] AGCCAGGCCCAGCTGCTGCTGTCCACGGTGGTGGGCGTGTTCACAGCCCCAGGCCTGCACCTGAAG

[0405] CAGCCGTTTGTGCAGGGCCTGGCTCTCTATACCCCTGTGGTCCTCCCACGCTCTCTGGACTTCACAG

[0406] AACTGGATGTTGCTGCTGAGAAGATTGACAGGTTCATGCAGGCTGTGACAGGATGGAAGACTGGCT

[0407] GCTCCCTGATGGGAGCCAGTGTGGACAGCACCCTGGCTTTCAACACCTACGTCCACTTCCAAGGGA

[0408] AGATGAAGGGCTTCTCCCTGCTGGCCGAGCCCCAGGAGTTCTGGGTGGACAACAGCACCTCAGTGT

[0409] CTGTTCCCATGCTCTCTGGCATGGGCACCTTCCAGCACTGGAGTGACATCCAGGACAACTTCTCGGT

[0410] GACTCAAGTGCCCTTCACTGAGAGCGCCTGCCTGCTGCTGATCCAGCCTCACTATGCCTCTGACCTG

[0411] GACAAGGTGGAGGGTCTCACTTTCCAGCAAAACTCCCTCAACTGGATGAAGAAACTATCTCCCCGG

[0412] ACCATCCACCTGACCATGCCCCAACTGGTGCTGCAAGGATCTTATGACCTGCAGGACCTGCTCGCCC

[0413] AGGCTGAGCTGCCCGCCATTCTGCACACCGAGCTGAACCTGCAAAAATTGAGCAATGACCGCATCA

[0414] GGGTGGGGGAGGTGCTGAACAGCATTTTTTTTGAGCTTGAAGCGGATGAGAGAGAGCCCACAGAGT

[0415] CTACCCAACAGCTTAACAAGCCTGAGGTCTTGGAGGTGACCCTGAACCGCCCATTCCTGTTTGCTGT

[0416] GTATGATCAAAGCGCCACTGCCCTGCACTTCCTGGGCCGCGTGGCCAACCCGCTGAGCACAGCATG

[0417] AGGCCAGGGCCCCAGAACACAGTGCCTGGCAAGGCCTCTGCCCCTGGCCTTTGAGGCAAAGGCCA

[0418] GCAGCAGATAACAACCCCGGACAAATCAGCGATGTGTCACCCCCAGTCTCCCACCTTTTCTTCTAAT

[0419] GAGTCGACTTTGAGCTGGAAAGCAGCCGTTTCTCCTTGGTCTAAGTGTGCTGCATGGAGTGAGCAGT

[0420] AGAAGCCTGCAGCGGCACAAATGCACCTCCCAGTTTGCTGGGTTTATTTTAGAGAATGGGGGTGGG

[0421] GAGGCAAGAACCAGTGTTTAGCGCGGGACTACTGTTCCAAAAAGAATTCCAACCGACCAGCTTGTT

[0422] TGTGAAACAAAAAAGTGTTCCCTTTTCAAGTTGAGAACAAAAATTGGGTTTTAAAATTAAAGTATAC

[0423] ATTTTTGCATTGCCTTCGGTTTGTATTTAGTGTCTTGAATGTAAGAACATGACCTCCGTGTAGTGTCTG

[0424] TAATACCTTAGTTTTTTCCACAGATGCTTGTGATTTTTGAACAATACGTGAAAGATGCAAGCACCTGA

[0425] ATTTCTGTTTGAATGCGGAACCATAGCTGGTTATTTCTCCCTTGTGTTAGTAATAAACGTCTTGCCACA

[0426] ATAAGCCTCCAAAAA

[0427] SEQ ID NO:4

[0428] ATAGCTGTGCTTGTCTAGGTTGGCGCTGAAGGATACACAGAAGCAAATGCACAGATCGGAGATGACT

[0429] CCCACGGGGGCAGGCCTGAAGGCCACCATCTTCTGCATCTTGACCTGGGTCAGCCTGACGGCTGGG

[0430] GACCGCGTATACATCCACCCCTTCCATCTCCTTTACCACAACAAGAGCACCTGCGCCCAGCTGGAGA

[0431] ACCCCAGTGTGGAGACACTCCCAGAGTCAACGTTCGAGCCTGTGCCCATTCAGGCCAAGACCTCCC

[0432] CTGTGAATGAGAAGACCCTGCATGATCAGCTCGTGCTGGCCGCCGAGAAGCTAGAGGATGAGGACC

[0433] GGAAGCGGGCTGCCCAGGTCGCAATGATCGCCAACTTCGTGGGCTTCCGCATGTACAAGATGCTGAA

[0434] TGAGGCAGGAAGTGGGGCCAGTGGGGCCATCCTCTCACCACCAGCTCTCTTTGGCACCCTGGTCTC

[0435] TTTCTACCTTGGATCCTTAGATCCCACGGCCAGCCAGCTGCAGACGCTGCTGGATGTCCCTGTGAAG

[0436] GAGGGAGACTGCACCTCCCGACTAGATGGACACAAGGTCCTCGCTGCCCTGCGGGCCATTCAGGGC

[0437] TTGCTGGTCACCCAGGGTGGGAGCAGCAGCCAGACACCCCTGCTACAGTCCATTGTGGTGGGGCTC

[0438] TTCACTGCTCCAGGCTTTCGTCTAAAGCACTCATTTGTTCAGAGCCTGGCTCTCTTTACCCCTGCCCT

[0439] CTTCCCACGCTCTCTGGATTTATCCACTGACCCAGTTCTTGCCACTGAGAAAATCAACAGGTTCATAA

[0440] AGGCTGTGACAGGGTGGAAGATGAACTTGCCACTGGAGGGGGTCAGTACAGACAGCACCCTACTTT

[0441] TCAACACCTACGTTCACTTCCAAGGAACGATGAGAGGTTTCTCTCAGCTGCCTGGAGTCCATGAATT

[0442] CTGGGTGGACAACAGCATCTCGGTGTCTGTGCCCATGATCTCCGGCACTGGCAACTTCCAGCACTGG

[0443] AGTGACACCCAGAACAACTTCTCCGTGACGTGCGTGCCCCTAGGTGAGAGAGCCACCCTGCTGCTC

[0444] ATCCAGCCCCACTGCACCTCAGATCTCGACAGGGTGGAGGCCCTCATCTTCCGGAACGACCTCCTGA

[0445] CTTGGATAGAGAACCCGCCTCCTCGGGCCATCCGCCTGACTCTGCCCCAGCTGGAAATCCGAGGATC

[0446] CTACAATCTGCAGGACCTGCTGGCTGAGGACAAGCTGCCCACCCTTTTGGGTGCGGAGGCAAATCT

[0447] GAACAACATTGGTGACACCAACCCCCGAGTGGGAGAGGTTCTCAATAGCATCCTCCTCGAACTCAA

[0448] AGCAGGAGAGGAGGAACAGCCGACCACGTCTGTCCAGCAGCCTGGCTCACCGGAGGCACTGGATG

[0449] TGACCCTGAGCAGCCCCTTCCTGTTCGCCATCTACGAGCAGGACTCAGGCACGCTGCACTTTCTGGG

[0450] CAGAGTGAATAACCCCCAGAGTGTGGTGTGAGGCCTTGTGCCTAGCCATGGAGACAAGGCCGGTGT

[0451] CGGAGAACCGTTCTGGGCAAAACTCAGTGCTGTCACCCCTGGCTCCCCATCACGCCTTGTAGCGCG

[0452] GCAGAGGCCGTCTCCTTGGAGACTGCGCTGACCGAGAATAAATGATGAGCAGCAGAGCCTCCTGGG

[0453] ATGTGGGTTTGTTTGGATACTGGGGTGACAGCCAGAAGCTGGCACTCTGCACAGGACTGCCACTCT

[0454] GGAAGAAATTTGGACCAAAAAACTGTTTGTGACACCAAAAAGCACCCCCCCTTTTTTTTATTTGAGG

[0455] ACAGAAATTGGGTTTTAACATTAAAATGCACATTATCCCCTTA

[0456] SEQ ID NO:5

[0457] CCTTGCTCCATCTTGGCTAAGCCTGGATTCCCATGGTCCCCCGACCTGGGTCCTCCCCCAGCCTCTGT

[0458] ACAGAGTAGCCTGGGAATAGATCCATCTTCACCCCCTCGAGTATAAATAAGGCTGCTTGGTTCACCA

[0459] GGGGATAGCTGTGCTTGTCTGGGCTGGAGCTAAAGGACACACAGAAGCAAGTCCACAGATCCGTGA

[0460] TGACTCCCACGGGGGCAGGCCTGAAGGCCACCATCTTCTGCATCCTGACCTGGGTCAGCCTGACAG

[0461] CTGGGGACCGCGTATACATCCACCCCTTTCATCTCCTCTACTACAGCAAGAGCACCTGCGCCCAGCT

[0462] GGAGAACCCCAGTGTGGAGACGCTCCCAGAGCCAACCTTTGAGCCTGTGCCCATTCAGGCCAAGAC

[0463] CTCCCCCGTGGATGAGAAGACCCTGCGAGATAAGCTCGTGCTGGCCACTGAGAAGCTAGAGGCTGA

[0464] GGATCGGCAGCGAGCTGCCCAGGTCGCGATGATTGCCAACTTCATGGGTTTCCGCATGTACAAGATG

[0465] CTGAGTGAGGCAAGAGGTGTAGCCAGTGGGGCCGTCCTCTCTCCACCGGCCCTCTTTGGCACCCTG

[0466] GTCTCTTTCTACCTTGGATCGTTGGATCCCACGGCCAGCCAGTTGCAGGTGCTGCTGGGCGTCCCTG

[0467] TGAAGGAGGGAGACTGCACCTCCCGGCTGGACGGACATAAGGTCCTCACTGCCCTGCAGGCTGTTC

[0468] AGGGCTTGCTGGTCACCCAGGGTGGAAGCAGCAGCCAGACACCCCTGCTACAGTCCACCGTGGTGG

[0469] GCCTCTTCACTGCCCCAGGCTTGCGCCTAAAACAGCCATTTGTTGAGAGCTTGGGTCCCTTCACCCC

[0470] CGCCATCTTCCCTCGCTCTCTGGACTTATCCACTGACCCAGTTCTTGCTGCCCAGAAAATCAACAGGT

[0471] TTGTGCAGGCTGTGACAGGGTGGAAGATGAACTTGCCACTAGAGGGGGTCAGCACGGACAGCACC

[0472] CTATTTTTCAACACCTACGTTCACTTCCAAGGGAAGATGAGAGGCTTCTCCCAGCTGACTGGGCTCC

[0473] ATGAGTTCTGGGTGGACAACAGCACCTCAGTGTCTGTGCCCATGCTCTCGGGCACTGGCAACTTCCA

[0474] GCACTGGAGTGACGCCCAGAACAACTTCTCCGTGACACGCGTGCCCCTGGGTGAGAGTGTCACCCT

[0475] GCTGCTGATCCAGCCCCAGTGCGCCTCAGATCTCGACAGGGTGGAGGTCCTCGTCTTCCAGCACGA

[0476] CTTCCTGACTTGGATAAAGAACCCGCCTCCTCGGGCCATCCGTCTGACCCTGCCGCAGCTGGAAATT

[0477] CGGGGATCCTACAACCTGCAGGACCTGCTGGCTCAGGCCAAGCTGTCTACCCTTTTGGGTGCTGAGG

[0478] CAAATCTGGGCAAGATGGGTGACACCAACCCCCGAGTGGGAGAGGTTCTCAACAGCATCCTCCTTG

[0479] AACTCCAAGCAGGCGAGGAGGAGCAGCCCACAGAGTCTGCCCAGCAGCCTGGCTCACCCGAGGTG

[0480] CTGGACGTGACCCTGAGCAGTCCGTTCCTGTTCGCCATCTACGAGCGGGACTCAGGTGCGCTGCACT

[0481] TTCTGGGCAGAGTGGATAACCCCCAAAATGTGGTGTGATGCCTCCTGTGTAGCCATGGAGACAAGGC

[0482] CAGCGTCAGAGAGCTATCCTGGGCAAAAATCAGTGCCTTCACCCCTGGCTTCCCGTCACTCCTTCCA

[0483] GCAAGGCAGAGGCCGTCTCCTTGGAGATGGCGCTAACTGAGAATAAATGATGAGCAGCAGCCTCCT

[0484] GGGGTGTGGGTTTGTTTGGACACTGGGGTGAGAGCCAGGAGCTGGCACTCTGTATAGGAGGACTGC

[0485] CATCCTGGAAAAAAAAAATGGACCAAACAACTGTTTGTGAAATAAAAAAAAAAAAATTCCCTTTTTA

[0486] TTTGAAAAAAAAAAAAAAAAAAAAAAAAA

[0487] SEQ ID NO:6

[0488] AAGGTCACACATCCCATGAGCGGGCAGCAGGGTCAGAAGTGGCCCCCGTGTTGCCTGAGCGAGAC

[0489] GCTCCCCTGCCCTCTGCCCTCCGCGCCTCCGGCCTGCATGTCCCCGTGGCCTCTTAGGGGCACATCC

[0490] CGGGGCTGGGTCAGGAGGTCTGGGCGGTTGGCCTTAAGCTGTCACACACCCAGGGAGATGCTGCTG

[0491] TTTCTGGGAACCTTGGCCCCCACTCCTGCAAACTTCGGTAAATGTGTAACTCGACCCTGCACCGGCT

[0492] CACTCTGTTCAGCAGTGAAACTGTGCATCGATCACTAAGACTTCCTGGAAGGGGTCCCAGCGTGAG

[0493] TGTCCCTTCTGGCGTCTGTCTTTCTGGCCAGCCTGTGGTCTGGCCACATGATGTAACCCCCCTCCAGC

[0494] CTGTGCACAGGCAGCCTGGGAACGGCTCCATCCCCACCCCTCAGATATAAATAGGGCCTCATGACGC

[0495] GGCCAGGGGAAGAAGCTGCCATTGTTCTGGGTACTACAGCAGAAGGGTATGCAGAAGCGAGCACCC

[0496] CAGTCCGAGATGGCTCCTGCCAGCGTGAGCCTGAGGGCCACCATCCTCTGCCTCCTGGCCTGGGCTG

[0497] GCCTGGCCACAGGTGACCGGGTGTACATACACCCCTTCCACCTCGTCATCCACAATGAGAGTACCTG

[0498] TGAGCAGCTGGCAAAGGCCAATGCTGGGAAGCCCAAAGATCCCACCTTCACACCTGTTCCGATACA

[0499] GGCCAAGACGTCCCCTGTGGATGAAAAGGCCCTGCAGGACCAGCTAGTGCTGGTCGCTGCAAAACT

[0500] CGACACCGAGGACAAGTTGAGAGCCGCGATGGTCGGGATGCTGGCCAACTTCTTGGGCTTCCGTATA

[0501] TATGGCATGCACAGTGAGCTATGGGGCGTGGTCCATGGGGCCACCATCCTCTCCCCAACGGCTGTCT

[0502] TTGGCACCCTGGCCTCTCTCTACCTGGGAGCGTTGGACCACACAGCCGACAGGCTACAGGCAATCCT

[0503] GGGCGTCCCTTGGAAGGACAAGAACTGCACCTCCCGGCTGGATGCGCACAAGGTCCTCTCTGCCCT

[0504] GCAGGCTGTACAGGGCCTGCTGGTGGCCCAGGGCAGGGCTGACGGCCAGTCCCAGCTGCTGTTGTC

[0505] CACAGTGGTGGGTCTCTTCACAGCCCCAGATCTGCACCTGAAGCAGCCGTTTGTGCAGGGCCTGGC

[0506] TCTCTATGCCCCTGTGGTCCTCCCACGCTCTCTGGACTTCACAGACCTGGAAGTCGCTGCTGAGAAG

[0507] ATTGACAGGTTCATGCAGGCTGTGACAGGATGGAAGATTAGCAGCCCCCTGACGGGAGCCAGTGCG

[0508] GACAGCACCCTGGTTTTCAACACCTACGTCCATTTCCAAGGGAAGATGAGGGACTTCTTCCTGCTGG

[0509] CTGAGCCCCAGGAGTTCTGGGTGGACAACAGCACCTCAGTGTCTGTCCCCATGCTGTCTGGCGTGG

[0510] GCACCTTCCAGCACTGGAGCGACGCCCAGGACAACTTCTCAGTGACTCAAGTGCCCTTTACTGAGA

[0511] GCGCCTGCTTGCTGCTGATTCAGCCTCACTACGCCTCTGACCTGGACAAGGTGGAGGGTCTCACTTT

[0512] CCAGCAAAACTCCCTCAACTGGATGAAGAAACTGTCTCCCCGGGCCATCCACCTGACCATGCCCCG

[0513] ACTGGTGCTGCGAGGATCTTATGACCTGCAGGACCTGCTTGCCCAGGCTGAGCTGCCCGCCATTCTG

[0514] GGCACCGAGCTGAACCTGCAAAAATTGAGCAATGACGACCTCAGGGTGGGGAAGGTGCTGAACAG

[0515] CATTTTTTTTGAACTCGAAGCGGATGAGAGAGAGCCCACAGAGTCTACCCGACAGCTGAACAGGCC

[0516] TGAGTTCTTGGAGGTGACCCTGGACCGCCCATTCCTGTTTGCTGTGTATGATCAAAGTGCCACTGCC

[0517] CTGCACTTCCTGGGCCGTGTGGCCAACCCGCTGAGCCCAGCATGAGGCCAGGGCCCCAGAACACAG

[0518] CGCCTGGCAAGGCCTCTGCCCCTGGCCTTTGAGGCGAAGGCCAGCGGCAGATAGTAACTCTGGACA

[0519] AACCAGCGATTTGTCACCCCCAGTCTCCCACCTTTTCTTCTAATGAGTCAACTTCGAGCTGGAAAGC

[0520] AGTCGTTTCTCCTTGGTCTAAGTGGTGCTGCGTGGAGTGAGCAGTAAGAAACCTGTGGCAGCACAA

[0521] ATGCGCCTCCCAGGTTGCTGGGTTTATTTTAGAGAATGGGGGTGGGGAGGCAAGAACCAGTGTTTAG

[0522] CGCGGGACCACCGTTCCAAAAAGAATTCCAACCGACCAGCTTGTTTTTGTGAAACAAAAAAGTGTTCC

[0523] CTTTTCAAGTTGAGAACAAAAATTGGGTTTTAAAATTAAAGTATACATTTTTGCATTGCCTTCGGTT

[0524] GTATTTAGTGTCTTGAATGTAAGAACATGACCTCCGTGTAGTGTCTACAGTAGCTTAGTTTTTTCCAC

[0525] AGATGCTTGTGATTTTTTTGAACAACAGTGAAAGATGCAAGCATCTGAATTTCTGTTTGAATGTGGA

[0526] AACCATAGCTGGTTATTTCTCTTTTGTGTTAGTAATAAACGTCTTGCAACAATAA

[0527] SEQ ID NO:7

[0528]

[0529] TTTTTTGAACAACACGTGAAGATGCAAGCATCTGAATTTCTGTTTGAATGTGGAAACCATAGCTGG

[0530] TTATTTCTCTTTTGTGTTAGTAATAAACGTCTTGCAACAATAA。

Claims

1. An siRNA or a salt thereof, wherein the siRNA comprises a sense strand and an antisense strand, wherein each nucleotide in the siRNA is independently a modified or unmodified nucleotide, wherein: The sense strand contains a nucleotide sequence I, and the antisense strand contains a nucleotide sequence II. The nucleotide sequence I and the nucleotide sequence II are at least partially reverse complementary to each other to form a double-stranded region. The nucleotide sequence I and the nucleotide sequence II are selected from the group consisting of the sequences shown in (1) to (40): (1) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 8, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 48: UCCUGCAAACUUCGGUAAA(SEQ ID NO:8) UUUACCGAAGUUUGCAGGAdTdT(SEQ ID NO:48); (2) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 9, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 49: CCUGCAAACUUCGGUAAAU(SEQ ID NO:9) AUUUACCGAAGUUUGCAGGdTdT(SEQ ID NO:49); (3) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 10, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 50: CGGUAAAUGUGUAACUCGA(SEQ ID NO:10) UCGAGUUACACAUUUACCGdTdT(SEQ ID NO:50); (4) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 11, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 51: ACUCUGUUCAGCAGUGAAA(SEQ ID NO:11) UUUCACUGCUGAACAGAGUdTdT(SEQ ID NO:51); (5) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 12, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 52: UCUGUUCAGCAGUGAAACU(SEQ ID NO:12) AGUUUCACUGCUGAACAGAdTdT (SEQ ID NO:52); (6) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 13, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 53: UCUGCAUCGAUCACUAAGA(SEQ ID NO:13) UCUUAGUGAUCGAUGCAGAdTdT (SEQ ID NO:53); (7) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 14, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 54: UGCAUCGAUCACUAAGACU(SEQ ID NO:14) AGUCUUAGUGAUCGAUGCAdTdT (SEQ ID NO: 54); (8) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 15, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 55: GCAUCGAUCACUAAGACUU(SEQ ID NO:15) AAGUCUUAGUGAUCGAUGCdTdT (SEQ ID NO:55); (9) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 16, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 56: GCCGUUGUUCUGGGUACUA(SEQ ID NO:16) UAGUACCCAGAACAACGGCdTdT (SEQ ID NO: 56); (10) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 17, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 57: CCGUUGUUCUGGGUACUAC(SEQ ID NO:17) GUAGUACCCAGAACAACGGdTdT (SEQ ID NO:57); (11) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 18, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 58: CGUUGUUCUGGGUACUACA(SEQ ID NO:18) UGUAGUACCCAGAACAACGdTdT (SEQ ID NO:58); (12) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 19, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 59: GACAUCCCCUGUGGAUGAA(SEQ ID NO:19) UUCAUCCACAGGGGAUGUCdTdT (SEQ ID NO:59); (13) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 20, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 60: UGCUAGUCGCUGCAAAACU(SEQ ID NO:20) AGUUUUGCAGCGACUAGCAdTdT (SEQ ID NO: 60); (14) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 21, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 61: ACAGGCUACAGGCAAUCCU(SEQ ID NO:21) AGGAUUGCCUGUAGCCUGUdTdT (SEQ ID NO: 61); (15) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 22, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 62: ACCUAAGCAGCCGUUUGU(SEQ ID NO:22) ACAAACGGCUGCUUCAGGUdTdT (SEQ ID NO: 62); (16) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 23, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 63: GCUCUCUGGACUUCACAGA(SEQ ID NO:23) UCUGUGAAGUCCAGAGAGCdTdT (SEQ ID NO: 63); (17) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 24, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 64: CUCUCUGGACUUCACAGAA(SEQ ID NO:24) UUCUGUGAAGUCCAGAGAGdTdT (SEQ ID NO: 64); (18) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 25, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 65: UGCUGAUCCAGCCUCACUA(SEQ ID NO:25) UAGUGAGGCUGGAUCAGCAdTdT (SEQ ID NO: 65); (19) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 26, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 66: GGGUCUCACUUUCCAGCAA(SEQ ID NO:26) UUGCUGGAAAGUGAGACCCdTdT (SEQ ID NO: 66); (20) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 27, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 67: GGUCUCACUUUCCAGCAAA(SEQ ID NO:27) UUUGCUGGAAAGUGAGACCdTdT(SEQ ID NO:67); (21) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 28, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 68: GUCUCACUUUCCAGCAAAA(SEQ ID NO:28) UUUUGCUGGAAAGUGAGACdTdT (SEQ ID NO: 68); (22) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 29, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 69: AGGUGCUGAACAGCAUUU(SEQ ID NO:29) AAAAUGCUGUUCAGCACCUdTdT(SEQ ID NO:69); (23) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 30, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 70: GGUGCUGAACAGCAUUUU(SEQ ID NO:30) AAAAAUGCUGUUCAGCACCdTdT (SEQ ID NO:70); (24) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 31, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 71: GUGCUGAACAGCAUUUUU(SEQ ID NO:31) AAAAAAUGCUGUUCAGCACdTdT (SEQ ID NO:71); (25) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 32, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 72: UGCUGAACAGCAUUUUUU(SEQ ID NO:32) AAAAAAAUGCUGUUCAGCAdTdT(SEQ ID NO:72) (26) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 33, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 73: GCUGAACAGCAUUUUUUU(SEQ ID NO:33) AAAAAAAAUGCUGUUCAGCdTdT (SEQ ID NO:73); (27) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 34, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 74: AGAGAGCCCACAGAGUCUA(SEQ ID NO:34) UAGACUCUGUGGGCUCUCUdTdT(SEQ ID NO:74); (28) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 35, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 75: CAGUCUCCCACCUUUUCUU(SEQ ID NO:35) AAGAAAAGGUGGGAGACUGdTdT (SEQ ID NO:75); (29) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 36, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 76: CCCAGUUUGCUGGGUUUAU(SEQ ID NO:36) AUAAACCCAGCAAACUGGGdTdT (SEQ ID NO:76); (30) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 37, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 77: CCAGUUUGCUGGGUUUAUU(SEQ ID NO:37) AAUAAACCCAGCAAACUGGdTdT (SEQ ID NO:77); (31) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 38, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 78: CAGUUUGCUGGGUUUAUUU(SEQ ID NO:38) AAAUAAACCCAGCAAACUGdTdT (SEQ ID NO:78); (32) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 39, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 79: GCAUUGCCUUCGGUUUGUA(SEQ ID NO:39) UACAAACCGAAGGCAAUGCdTdT (SEQ ID NO:79); (33) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 40, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 80: CAUUGCCUUCGGUUUGUAU(SEQ ID NO:40) AUACAAACCGAAGGCAAUGdTdT (SEQ ID NO:80); (34) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 41, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 81: AUUGCCUUCGGUUUGUAUU(SEQ ID NO:41) AAUACAAACCGAAGGCAAUdTdT (SEQ ID NO:81); (35) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 42, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 82: UUGCCUUCGGUUUGUAUUU(SEQ ID NO:42) AAAUACAAACCGAAGGCAAdTdT (SEQ ID NO:82); (36) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 43, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 83: UGCCUUCGGUUUGUAUUUA(SEQ ID NO:43) UAAAUACAAACCGAAGGCAdTdT (SEQ ID NO:83); (37) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 44, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 84: UGACCUCCGUGUAGUGUCU(SEQ ID NO:44) AGACACUACACGGAGGUCAdTdT (SEQ ID NO:84); (38) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 45, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 85: UGAACAAUACGUGAAAGAU(SEQ ID NO:45) AUCUUUCACGUAUUGUUCAdTdT (SEQ ID NO:85); (39) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 46, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 86: GAACAAUACGUGAAAGAUG(SEQ ID NO:46) CAUCUUUCACGUAUUGUUCdTdT (SEQ ID NO:86); (40) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 47, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 87: GCACCUGAAUUUCUGUUUG(SEQ ID NO:47) CAAACAGAAAUUCAGGUGCdTdT (SEQ ID NO:87).

2. The siRNA or a salt thereof according to claim 1, which is selected from the following double-stranded siRNA:

3. The siRNA or a salt thereof according to claim 1 or 2, wherein The siRNA comprises at least one modified nucleotide and / or at least one interstrand modification, Preferably, all nucleotides on the sense strand are modified nucleotides, and / or all nucleotides on the antisense strand are modified nucleotides, More preferably, substantially all of the nucleotides of the sense strand and the antisense strand are modified nucleotides, Still more preferably, all nucleotides of the sense strand and all nucleotides of the antisense strand are modified nucleotides, in particular, the modified nucleotides are selected from 2'-F, 2'-OME, 2'-MOE, GNA, UNA, PNA, 5'-VP modified nucleotides; and the interchain modifications are selected from thiophosphate, -OEt, -OME modifications.

4. A shRNA or a salt thereof, wherein the shRNA comprises a sense strand, an antisense strand, and a neck loop sequence separating the sense strand and the antisense strand, wherein each nucleotide in the shRNA is independently a modified or unmodified nucleotide, wherein: The sense strand contains a nucleotide sequence I, and the antisense strand contains a nucleotide sequence II. The nucleotide sequence I and the nucleotide sequence II are at least partially reverse complementary to each other to form a double-stranded region. The nucleotide sequence I and the nucleotide sequence II are selected from the group consisting of the sequences shown in (1) to (40): (1) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 8, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 48: UCCUGCAAACUUCGGUAAA(SEQ ID NO:8) UUUACCGAAGUUUGCAGGAdTdT(SEQ ID NO:48); (2) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 9, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 49: CCUGCAAACUUCGGUAAAU(SEQ ID NO:9) AUUUACCGAAGUUUGCAGGdTdT(SEQ ID NO:49); (3) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 10, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 50: CGGUAAAUGUGUAACUCGA(SEQ ID NO:10) UCGAGUUACACAUUUACCGdTdT(SEQ ID NO:50); (4) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 11, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 51: ACUCUGUUCAGCAGUGAAA(SEQ ID NO:11) UUUCACUGCUGAACAGAGUdTdT(SEQ ID NO:51); (5) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 12, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 52: UCUGUUCAGCAGUGAAACU(SEQ ID NO:12) AGUUUCACUGCUGAACAGAdTdT (SEQ ID NO:52); (6) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 13, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 53: UCUGCAUCGAUCACUAAGA(SEQ ID NO:13) UCUUAGUGAUCGAUGCAGAdTdT (SEQ ID NO:53); (7) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 14, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 54: UGCAUCGAUCACUAAGACU(SEQ ID NO:14) AGUCUUAGUGAUCGAUGCAdTdT (SEQ ID NO: 54); (8) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 15, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 55: GCAUCGAUCACUAAGACUU(SEQ ID NO:15) AAGUCUUAGUGAUCGAUGCdTdT (SEQ ID NO:55); (9) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 16, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 56: GCCGUUGUUCUGGGUACUA(SEQ ID NO:16) UAGUACCCAGAACAACGGCdTdT (SEQ ID NO: 56); (10) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 17, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 57: CCGUUGUUCUGGGUACUAC(SEQ ID NO:17) GUAGUACCCAGAACAACGGdTdT (SEQ ID NO:57); (11) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 18, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 58: CGUUGUUCUGGGUACUACA(SEQ ID NO:18) UGUAGUACCCAGAACAACGdTdT (SEQ ID NO:58); (12) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 19, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 59: GACAUCCCCUGUGGAUGAA(SEQ ID NO:19) UUCAUCCACAGGGGAUGUCdTdT (SEQ ID NO:59); (13) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 20, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 60: UGCUAGUCGCUGCAAAACU(SEQ ID NO:20) AGUUUUGCAGCGACUAGCAdTdT (SEQ ID NO: 60); (14) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 21, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 61: ACAGGCUACAGGCAAUCCU(SEQ ID NO:21) AGGAUUGCCUGUAGCCUGUdTdT (SEQ ID NO: 61); (15) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 22, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 62: ACCUAAGCAGCCGUUUGU(SEQ ID NO:22) ACAAACGGCUGCUUCAGGUdTdT (SEQ ID NO: 62); (16) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 23, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 63: GCUCUCUGGACUUCACAGA(SEQ ID NO:23) UCUGUGAAGUCCAGAGAGCdTdT (SEQ ID NO: 63); (17) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 24, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 64: CUCUCUGGACUUCACAGAA(SEQ ID NO:24) UUCUGUGAAGUCCAGAGAGdTdT (SEQ ID NO: 64); (18) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 25, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 65: UGCUGAUCCAGCCUCACUA(SEQ ID NO:25) UAGUGAGGCUGGAUCAGCAdTdT (SEQ ID NO: 65); (19) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 26, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 66: GGGUCUCACUUUCCAGCAA(SEQ ID NO:26) UUGCUGGAAAGUGAGACCCdTdT (SEQ ID NO: 66); (20) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 27, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 67: GGUCUCACUUUCCAGCAAA(SEQ ID NO:27) UUUGCUGGAAAGUGAGACCdTdT(SEQ ID NO:67); (21) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 28, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 68: GUCUCACUUUCCAGCAAAA(SEQ ID NO:28) UUUUGCUGGAAAGUGAGACdTdT (SEQ ID NO: 68); (22) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 29, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 69: AGGUGCUGAACAGCAUUU(SEQ ID NO:29) AAAAUGCUGUUCAGCACCUdTdT(SEQ ID NO:69); (23) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 30, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 70: GGUGCUGAACAGCAUUUU(SEQ ID NO:30) AAAAAUGCUGUUCAGCACCdTdT (SEQ ID NO:70); (24) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 31, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 71: GUGCUGAACAGCAUUUUU(SEQ ID NO:31) AAAAAAUGCUGUUCAGCACdTdT (SEQ ID NO:71); (25) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 32, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 72: UGCUGAACAGCAUUUUUU(SEQ ID NO:32) AAAAAAAUGCUGUUCAGCAdTdT(SEQ ID NO:72) (26) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 33, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 73: GCUGAACAGCAUUUUUUU(SEQ ID NO:33) AAAAAAAAUGCUGUUCAGCdTdT (SEQ ID NO:73); (27) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 34, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 74: AGAGAGCCCACAGAGUCUA(SEQ ID NO:34) UAGACUCUGUGGGCUCUCUdTdT(SEQ ID NO:74); (28) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 35, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 75: CAGUCUCCCACCUUUUCUU(SEQ ID NO:35) AAGAAAAGGUGGGAGACUGdTdT (SEQ ID NO:75); (29) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 36, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 76: CCCAGUUUGCUGGGUUUAU(SEQ ID NO:36) AUAAACCCAGCAAACUGGGdTdT (SEQ ID NO:76); (30) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 37, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 77: CCAGUUUGCUGGGUUUAUU(SEQ ID NO:37) AAUAAACCCAGCAAACUGGdTdT (SEQ ID NO:77); (31) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 38, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 78: CAGUUUGCUGGGUUUAUUU(SEQ ID NO:38) AAAUAAACCCAGCAAACUGdTdT (SEQ ID NO:78); (32) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 39, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 79: GCAUUGCCUUCGGUUUGUA(SEQ ID NO:39) UACAAACCGAAGGCAAUGCdTdT (SEQ ID NO:79); (33) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 40, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 80: CAUUGCCUUCGGUUUGUAU(SEQ ID NO:40) AUACAAACCGAAGGCAAUGdTdT (SEQ ID NO:80); (34) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 41, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 81: AUUGCCUUCGGUUUGUAUU(SEQ ID NO:41) AAUACAAACCGAAGGCAAUdTdT (SEQ ID NO:81); (35) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 42, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 82: UUGCCUUCGGUUUGUAUUU(SEQ ID NO:42) AAAUACAAACCGAAGGCAAdTdT (SEQ ID NO:82); (36) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 43, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 83: UGCCUUCGGUUUGUAUUUA(SEQ ID NO:43) UAAAUACAAACCGAAGGCAdTdT (SEQ ID NO:83); (37) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 44, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 84: UGACCUCCGUGUAGUGUCU(SEQ ID NO:44) AGACACUACACGGAGGUCAdTdT (SEQ ID NO:84); (38) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 45, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 85: UGAACAAUACGUGAAAGAU(SEQ ID NO:45) AUCUUUCACGUAUUGUUCAdTdT (SEQ ID NO:85); (39) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 46, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 86: GAACAAUACGUGAAAGAUG(SEQ ID NO:46) CAUCUUUCACGUAUUGUUCdTdT (SEQ ID NO:86); (40) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 47, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 87: GCACCUGAAUUUCUGUUUG(SEQ ID NO:47) CAAACAGAAAUUCAGGUGCdTdT (SEQ ID NO:87).

5. The shRNA or a salt thereof according to claim 4, wherein The shRNA comprises at least one modified nucleotide and / or at least one interstrand modification, Preferably, all nucleotides on the sense strand are modified nucleotides, and / or all nucleotides on the antisense strand are modified nucleotides, More preferably, substantially all of the nucleotides of the sense strand and the antisense strand are modified nucleotides, Still more preferably, all nucleotides of the sense strand and all nucleotides of the antisense strand are modified nucleotides, Particularly, the modified nucleotides are selected from 2'-F, 2'-OME, 2'-MOE, GNA, UNA, PNA, 5'-VP modified nucleotides; and the interchain modifications are selected from phosphorothioate, -OEt, -OME modifications.

6. A pharmaceutical composition comprising the siRNA or a salt thereof according to any one of claims 1 to 3 and / or the shRNA or a salt thereof according to any one of claims 4 to 5, and optionally a pharmaceutically acceptable carrier.

7. Use of the siRNA or salt thereof according to any one of claims 1 to 3, or the shRNA or salt thereof according to any one of claims 4 to 5, or the pharmaceutical composition according to claim 6 in the preparation of a drug capable of inhibiting angiotensinogen gene expression.

8. Use of the siRNA or salt thereof according to any one of claims 1 to 3, or the shRNA or salt thereof according to any one of claims 4 to 5, or the pharmaceutical composition according to claim 6 in the preparation of a medicament for preventing or treating angiotensinogen-related diseases or disorders.

9. The use according to claim 8, wherein The angiotensinogen-related disease or disorder refers to a disease caused by angiotensinogen disorder, in particular, including hypertension, critical hypertension, essential hypertension, secondary hypertension, hypertensive crisis, hypertensive emergency state, isolated systolic and diastolic hypertension, pregnancy-related hypertension, diabetic hypertension, resistant hypertension, refractory hypertension, paroxysmal hypertension, renovascular hypertension, Goldblatt's hypertension, ocular hypertension, glaucoma, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, unstable hypertension, hypertensive heart disease, and hypertensive nephropathy.

10. A method for inhibiting the expression of angiotensinogen (AGT) gene in cells, the method comprising contacting the cells with an effective amount of siRNA or a salt thereof as described in any one of claims 1 to 3, and / or shRNA or a salt thereof as described in any one of claims 4 to 5, and / or the pharmaceutical composition as described in claim 6, thereby inhibiting the expression of AGT gene in the cells.

Images