A high expression promoter pets3 in plants and application thereof

Abstract

This invention discloses a high-expression promoter PETS3 in plants and its applications. The sequence of the high-expression promoter PETS3 is shown in SEQ ID NO.1. This invention successfully cloned a meristem-high expression level promoter PETS3 from Brassica napus. This promoter drives the expression level of the heterologous gene Cas9 in the stem meristem of Brassica napus to be more than 18 times higher than that driven by pro35S. Furthermore, this promoter can also drive high-level expression of the gene in roots and callus tissues. This invention solves the problem of the lack of strong meristem promoters in existing rapeseed gene editing applications. Using this promoter in gene editing practice has the advantages of short cycle time, low workload, and high efficiency, and has a promising application prospect in the fields of plant genetics and breeding and genetic engineering.

Description

Technical Field

[0001] This invention belongs to the field of plant biotechnology and plant genetic engineering, specifically relating to a highly expressed promoter PETS3 in plants and its applications. Background Technology

[0002] Brassica napus is one of the world's most important oilseed crops, and improving rapeseed germplasm resources using genetic engineering is a highly efficient breeding method. Promoters, which drive the expression of exogenous genes in host cells, are important tools in genetic engineering. Promoters can be classified according to their gene-driving behavior into constitutive promoters, tissue-specific promoters, and inducible promoters. Constitutive promoters drive high-level expression of genes in all or most cells, thus limiting their application. Tissue-specific and inducible promoters, on the other hand, can control the expression of target genes in specific tissues or under specific conditions, and therefore have greater application potential in genetic engineering. For example, the 8SGα promoter of the cowpea storage protein gene drives the specific and efficient expression of the gene in seeds, and can serve as a highly efficient and specific promoter for bioreactors (Chen MX, Zheng SX, Yang YN, et al. Strong seed-specific protein expression from the Vigna radiata storage protein 8SGα promoter in transgenic Arabidopsis isses. Journal of Biotechnology, 2014, 174: 49-56.); using an egg cell-specific promoter can significantly improve the efficiency of the CRISPR / Cas9 system in Arabidopsis (Wang, ZP, Xing, HL, Dong, L, et al. Egg cell-specific promoter-controlled CRISPR / Cas9 efficiently generates homozygous mutants for multiple target genes in Arabidopsis in a single generation. Genome biology, 2015, 16: 144-156.).

[0003] The apical meristem consists of the primitive cells and newly derived cells at the tips of roots and stems that maintain their meristematic capacity for a long period. These meristematic cells divide rapidly and are the source of various other tissues and organs in the plant. The proliferation and differentiation of meristematic cells are strictly regulated, significantly impacting the overall growth of the plant, such as stem length, leaf distribution, and fruit quantity. In gene editing using the CRISPR / Cas9 system, the longer the expression duration and the higher the expression level of Cas9 nucleases and sgRNAs, the higher the efficiency. CRISPR / Cas9 system promoters are typically constitutive promoters such as Ubi and 35S promoters, which are not very effective in rapeseed. Egg cell and embryo-specific promoters have shown good results in Arabidopsis gene editing, but the transformation methods in rapeseed differ from those in Arabidopsis, making these promoters unsuitable. These problems can be solved by using promoters that are highly efficient in rapeseed meristems, enabling the sustained and efficient accumulation of Cas nucleases or specific genes in the meristem.

[0004] Currently, some meristem-specific promoters have been identified and applied. For example, Chinese patent (patent number CN116676307A) reports that the highly efficient promoter ZmIRT1 for expressing vascular bundles and meristems in maize roots is mainly expressed in the vascular bundles and meristems of roots, but its expression effect is not compared with other promoters. Chinese patent application (patent number CN115125242A) discloses the strong expression promoter OsNPY4 for rice meristems, which can drive the expression of exogenous genes in rice lateral roots and tillers. However, the expression levels of exogenous genes driven by these promoters in meristems are not compared with those of constitutive promoters such as Ubi and 35S.

[0005] However, no efficient expression promoters suitable for rapeseed meristems have been reported. Therefore, developing endogenous strong promoters suitable for rapeseed molecular breeding and gene editing is fundamental to the further development of rapeseed genetic engineering technology and has significant application value for improving rapeseed gene editing efficiency and breeding efficiency. Summary of the Invention

[0006] Objective of the invention: To address the shortcomings of existing technologies, this invention provides a plant-based promoter, PETS3, for high expression. This invention isolates and identifies a highly efficient promoter, PETS3, for expression in the meristem of rapeseed and regulates the high expression of target genes in meristems. This effectively solves the problem of low expression activity in meristems when using constitutive promoters to drive the expression of exogenous genes in Brassica napus.

[0007] The present invention also provides the application of the highly expressed promoter PETS3 in the plant.

[0008] Technical solution: To achieve the above objectives, the present invention provides a plant-based high-expression promoter whose nucleotide sequence is one of the following sequences:

[0009] (1) The sequence shown in SEQ ID NO.1;

[0010] (2) A DNA molecule sequence that has more than 90% similarity to the nucleotide sequence described in (1) and can regulate the efficient expression of genes in meristematic tissues;

[0011] (3) A DNA molecule that can hybridize with the nucleotide sequence described in (1) or (2) under strict conditions and has promoter function.

[0012] The present invention contains gene expression cassettes or recombinant plasmids containing the plant promoters that are highly expressed.

[0013] The method for constructing recombinant plasmids according to the present invention includes the following steps:

[0014] Genomic DNA was extracted from Brassica napus, primers were designed for PCR amplification, the PCR product was ligated with a vector from a rapid cloning kit, and transformed into competent cells to obtain the TA-PETS3 plasmid. The TA-PETS3 plasmid and the plant expression vector were digested with enzymes, and the resulting fragments were ligated to obtain the recombinant plasmid.

[0015] The primers are:

[0016] PETS3-cF AATTAACCTGCAGGAAAAGTC;

[0017] PETS3-cR CCATGGCCTGCAGGATTGTTA.

[0018] The rapid cloning kit vector is the TA / Blunt-Zero rapid cloning kit vector, and the plant expression vector is pBI101.

[0019] Preferably, the method for constructing the recombinant plasmid includes the following steps:

[0020] Genomic DNA was extracted from Brassica napus, and PCR amplification was performed using designed primers. The PCR product was ligated into a vector using the TA / Blunt-Zero rapid cloning kit and transformed into E. coli DH5α by heat shock to obtain the TA-PETS3 plasmid. The TA-Pets3 plasmid and the plant expression vector pBI101 plasmid were digested with Hind III and Xma I restriction endonucleases. After electrophoresis, the PETS3 sequence and the linearized pBI101 plasmid were recovered. The obtained fragments were ligated using T4 ligase to obtain the recombinant plasmid pBI101-PETS3.

[0021] Furthermore, the PCR reaction system includes: 10 μl of 5×Phanta Buffer; 2 μl of dNTP; 1 μl each of Pets3-cF / cR; 1 μl of Phanta enzyme; 1 μl of DNA template; and 34 μl of ddH2O.

[0022] Furthermore, the PCR program was as follows: 95℃ for 10 min pre-denaturation; 95℃ for 30 s, 58℃ for 30 s, 72℃ for 1 min, 32 cycles; 72℃ for 7 min.

[0023] Furthermore, genomic DNA was extracted from young leaves of Brassica napus using the CTAB method.

[0024] The present invention relates to recombinant microorganisms or transgenic plant cells containing the plant meristem high-expression promoter, the gene expression cassette, or the recombinant plasmid.

[0025] The present invention relates to the application of plant high-expression promoters, gene expression cassettes, recombinant plasmids, recombinant microorganisms, transgenic plant cells, or transgenic animal cell lines in improving the expression level of target genes in plants.

[0026] The plant in question is Brassica napus.

[0027] Furthermore, the application of improving the expression level of the target gene in plant meristems, roots, and callus tissues.

[0028] The target gene is either the driver heterologous gene Cas9 or the commonly used reporter gene GUS.

[0029] Furthermore, the expression level was detected using the following primer sequences:

[0030] Cas9-qF GGAGGGGAAGGAGACTAACAGAGATG;

[0031] Cas9-qR CTTGTCCCAGCCGCCCATGAACTG;

[0032] BnUBQ9-qFTCCATCCGACAGCCCTTACTCT;

[0033] BnUBQ9-qR ACACTTTGGTCCTAAAAGCCACC.

[0034] Furthermore, the promoters, gene expression frames, and recombinant plasmids are used in the creation and screening of transgenic microorganisms, plant or animal cells, as well as in gene editing of microorganisms, plant and animal cells.

[0035] This invention also provides a method for expressing a target gene. This method uses the aforementioned DNA molecule as a promoter to initiate the expression of the target gene.

[0036] In the above method, the DNA molecule is operatively linked upstream of the target gene to be expressed, thereby initiating the expression of the target gene.

[0037] The application of the promoter, gene expression cassette, and recombinant plasmid of this invention in the cultivation of improved germplasm of Brassica napus.

[0038] This invention successfully cloned a meristem-high expression level promoter, PETS3, from Brassica napus. This promoter drives the heterologous gene Cas9 to express at a level more than 18 times higher in the stem meristem of Brassica napus than under the pro35S promoter. Furthermore, this promoter can also drive high-level expression of the gene in roots and callus. This invention solves the problem of the lack of strong meristem promoters in existing rapeseed gene editing applications. Using this high-expression-level promoter in gene editing practice can improve gene editing efficiency, resulting in shorter cycle times, lower workload, and higher efficiency. It has excellent application prospects in the fields of plant genetics and breeding and genetic engineering.

[0039] Beneficial effects: Compared with the prior art, the present invention has the following advantages:

[0040] (1) This invention obtained a meristematic tissue-efficient expression promoter PETS3 from Brassica napus.

[0041] (2) The promoter PETS3 can efficiently and stably drive the expression of exogenous genes in Brassica napus, and the expression level in meristems is about 18.57 times that of Cas9 driven by the constitutive promoter P35s.

[0042] (3) Gene editing components are expressed efficiently in meristematic tissues, which has the effects of high editing efficiency, short cycle and low cost.

[0043] (4) The promoter of the present invention has important application value in the germplasm improvement of Brassica napus. Attached Figure Description

[0044] Figure 1 It is GUS histochemical staining. Among them, the callus tissue of proETS3:GUS: pBI101-PETS3 transgenic explants can stain a deep blue, and the hair roots are also stained; NTC: the callus tissue of non-transgenic explants cannot be stained blue.

[0045] Figure 2 These are the electrophoresis results of the proETS3 promoter cloning product. Lane M is the DNA marker; lanes 1-5 are the electrophoresis results of the proETS3 cloning product.

[0046] Figure 3 These are the electrophoresis results of PCR identification of TA-PETS3 recombinant plasmid-positive colonies. Lane M is the DNA marker; lane + is the positive control; lanes 1-11 are the colony electrophoresis results.

[0047] Figure 4 This study used quantitative real-time PCR to detect the expression level of the proETS3 promoter-driven Cas9 gene in the meristem of Brassica napus. Specifically, the expression level of P35S-driven Cas9 was set to 1 relative to the expression level of the internal reference gene, and the expression level of the PETS3 promoter-driven Cas9 gene was a fold increase relative to the 35S-driven Cas9 expression level. Brassica napus BnUBQ9 was used as the internal reference gene. Detailed Implementation

[0048] The present invention will be further described below with reference to the accompanying drawings and embodiments.

[0049] All raw materials or reagents used in this invention are commercially available, and all carriers are known or can be purchased directly.

[0050] Experimental materials:

[0051] The plant material was the Brassica napus cultivar “J9712” provided by Yangzhou University (Natural variation in BnaA07.MKK9 confers resistance to Sclerotinia stem rot in oilseed rape. Nat Commun. 2024 Jun 13;15(1):5059. doi:10.1038 / s41467-024-49504-6.PMID:38871727;PMCID:PMC11176195.). E. coli DH5α competent cells, PCR mix, Phanta high-fidelity enzyme, T4 DNA ligase, plasmid miniprep kit, and gel extraction kit were purchased from Nanjing Novizan Biotechnology Co., Ltd.; plant RNA extraction kit, reverse transcription kit, and real-time PCR kit were purchased from Beijing Jingquanshijin Biotechnology Co., Ltd.; X-Glucose was purchased from Beijing Solarbio Science & Technology Co., Ltd.; restriction endonucleases HindIII and XmaI were purchased from New England Biolabs; Agrobacterium strains C58C1 and GV310 were purchased from Shanghai Weidi Biotechnology Co., Ltd.; and overexpression vectors pBI101 (#175557) and pRGEB32 (#63142) were purchased from Addgene. The TA / Blunt-Zero rapid cloning kit vector was purchased from Nanjing Novizan Biotechnology Co., Ltd.

[0052] Example 1

[0053] DNA extraction from young rapeseed leaves and cloning of promoter fragments

[0054] Genomic DNA was extracted from young leaves of the rapeseed variety “J9712” using the CTAB method. Primers were designed based on the sequence information of the “ZS11” rapeseed genome database. Using these primers as templates, PCR amplification was performed using the high-fidelity enzyme Phanta and the specific primers PETS3-cF / cR (sequence shown in Table 1).

[0055] PCR reaction system: 10 μl of 5×Phanta Buffer; 2 μl of dNTP (2.5 mM); 1 μl each of PETS3-cF / cR (10 μM); 1 μl of Phanta enzyme; 1 μl of DNA template; 34 μl of ddH2O.

[0056] PCR program: 95℃ for 10 min pre-denaturation; 95℃ for 30 s, 58℃ for 30 s, 72℃ for 1 min, 33 cycles; 72℃ for 7 min. Electrophoresis was performed on a 1% agarose gel, and the results are as follows. Figure 2 As shown. After electrophoresis, the gel containing the target band was excised, and the PCR product was recovered using a gel extraction kit. The recovered product was ligated into the vector from the TA / Blunt-Zero rapid cloning kit, transformed into *E. coli* DH5α by heat shock, and colonies were picked for PCR identification. The identification results are shown in the figure. Figure 3 As shown in the figure. Positive clones were sent to Nanjing Qingke Biotechnology Co., Ltd. for sequencing. After successful sequencing, the plasmid was extracted and named TA-PETS3. The promoter fragment is PETS3, and its sequence is shown in SEQ ID NO.1.

[0057] Table 1: Primer sequence information used in the experiment

[0058]

[0059] Example 2

[0060] 1. Cloning of the PETS3 promoter and construction of its driving GUS reporter gene expression vector

[0061] The TA-PETS3 plasmid constructed in Example 1 and the plant expression vector pBI101 plasmid were digested with HindIII and XmaI restriction endonucleases, respectively. After electrophoresis, the PETS3 sequence and the linearized pBI101 plasmid were recovered, and the resulting fragments were ligated using T4 ligase. The resulting plasmid was transformed into *E. coli* DH5α by heat shock, and after screening for positive clones and confirming correct sequencing, the plasmid was extracted and named pBI101-PETS3. At this point, the reporter gene GUS in the pBI101 vector is driven by the PETS3 promoter and can be expressed in plant cells.

[0062] 2. Agrobacterium-mediated genetic transformation of Brassica napus

[0063] The constructed plasmid pBI101-PETS3 was transformed into Agrobacterium rhizogenes C58C1 using the heat shock method. Then, the hypocotyl genetic transformation method was used to transform Brassica napus. Specifically, 5-7 day-old seedlings of the Brassica napus line “J9712” were used, and the hypocotyls were cut into approximately 1 cm pieces. 4 ml of Agrobacterium containing the target plasmid was incubated at 28℃ with shaking for approximately 16 hours until the OD value reached 0.2-0.4. The supernatant was removed by centrifugation, and the culture medium was washed with 40 ml of MS medium (MS + 30 g / L sucrose + 1...). After resuspending the explants in 0.00 μM acetylsyleugenol, an Agrobacterium infection solution was prepared. Hypocotyl segments were immersed in the Agrobacterium suspension for 15 min and then removed and cultured on 1 / 2 MS medium for 2 days. The hypocotyl explants were then transferred to root induction medium (MS + 30 g / L sucrose + 18 g / L mannitol + 100 μM acetylsyleugenol) and cultured for 4 weeks at 22℃ with a 16 / 8 h photoperiod. Hypocotyl explants that induced callus and roots were used for GUS histochemical staining.

[0064] 3. GUS histochemical staining

[0065] Prepare 10 ml of GUS staining solution (0.1 M sodium phosphate buffer; 10 mM EDTA; 0.5 mM potassium ferricyanide; 0.5 mM potassium ferrocyanide; 0.5 mg / ml X-Gluc; 0.1% Triton X-100; 1×PBS). Place the test material in the GUS staining solution and incubate at 37°C for 8–12 h. Destain the samples with 70% ethanol, changing the destaining solution every hour. Take photos after the explants are free of chlorophyll.

[0066] The results showed that rapeseed explants transfected with pBI101-PETS3 plasmid were stained a darker blue. Figure 1 The control explants were not stained blue, while the control explants were not. This result indicates that the PETS3 promoter of rapeseed can drive the expression of the exogenous reporter gene GUS in the callus and adventitious roots of rapeseed, and therefore this promoter can be used for plant genetic improvement.

[0067] Example 3

[0068] Construction of Cas9 gene expression vector

[0069] The TA-PETS3 plasmid and the plant expression vector pRGEB32 plasmid were digested with SbfI and BstBI restriction endonucleases. After electrophoresis, the PETS3 sequence and the linearized pRGEB32 plasmid were recovered, and the resulting fragments were ligated using T4 ligase. The fragments were transformed into *E. coli* DH5α by heat shock. After screening for positive clones and confirming correct sequencing, the plasmid was extracted and named pRGEB32-PETS3. A CaMV 35S promoter (GenBank: FJ362600.1, 10382-11162nt) was synthesized, and SbfI and BstBI restriction sites were added to both ends. The promoter was then inserted into the pRGEB32 plasmid using restriction enzyme digestion and ligation to construct pRGEB32-P35s as a control.

[0070] The constructed plasmids pRGEB32-PETS3 and pRGEB32-P35s were transformed into Agrobacterium GV3101 using the heat shock method. Then, the hypocotyl genetic transformation method was used to transform Brassica napus. Specifically, the hypocotyls of 5-7 day old Brassica napus seedlings were infected with Agrobacterium, using the same method as in Example 2. When the transgenic seedlings grew to approximately 6-8 true leaves, about 0.1 g of apical meristem was collected, and RNA was extracted using a plant RNA extraction kit and reverse transcribed into cDNA. The expression level of the Cas9 gene in each tissue was detected using quantitative real-time PCR. The endogenous Brassica napus gene BnUBQ9 was used as an internal control gene (quantitative detection primer sequences are shown in Table 1). The expression level of P35S-driven Cas9 was set to 1 relative to the expression level of the internal control gene, and the expression level of Cas9 driven by the PETS3 promoter was a multiple relative to the expression level of Cas9 driven by 35S. Brassica napus BnUBQ9 was used as the internal control gene.

[0071] PCR program: 95℃ for 3 min pre-denaturation; 95℃ for 30 s, 55℃ for 30 s, 72℃ for 30 s, 40 cycles.

[0072] Quantitative results are shown in Figure 4 The expression level of the Cas9 gene driven by the pETS3 promoter was 18.57 times that driven by the p35s promoter. This indicates that the promoter can efficiently drive the expression of exogenous genes in callus tissue.

[0073] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions claimed by the present invention.

Claims

1. A promoter highly expressed in a plant, characterized in that, Its nucleotide sequence is shown in SEQ ID NO.

1.

2. A recombinant plasmid containing the plant high-expression promoter as described in claim 1.

3. A method for constructing the recombinant plasmid according to claim 2, characterized in that, Includes the following steps: Genomic DNA was extracted from Brassica napus, primers were designed for PCR amplification, the PCR product was ligated with a vector from a rapid cloning kit, and transformed into competent cells to obtain the TA-PETS3 plasmid. The TA-PETS3 plasmid and the plant expression vector were digested with enzymes, and the resulting fragments were ligated to obtain the recombinant plasmid.

4. The construction method according to claim 3, characterized in that, The primers are: PETS3-cF AATTAACCTGCAGGAAAAGTC; PETS3-cR CCATGGCCTGCAGGATTGTTA.

5. The construction method according to claim 3, characterized in that, The preferred vector for the rapid cloning kit is the TA / Blunt-Zero rapid cloning kit vector, and the plant expression vector is pBI101.

6. A recombinant microorganism containing the plant meristem high-expression promoter of claim 1 or the recombinant plasmid of claim 2.

7. The application of a plant high-expression promoter as described in claim 1, or a recombinant plasmid as described in claim 2, or a recombinant microorganism as described in claim 6, in improving the expression level of a target gene in a plant; wherein the plant is Brassica napus.

8. The application according to claim 7, characterized in that, Application of improving the expression level of target genes in plant meristems, roots and callus.

9. The application according to claim 7, characterized in that, The target gene is a driver heterologous gene. Cas9 Or the commonly used reporter gene GUS.

Images