Molecular marker, primer pair and method for identifying sex of pistachio nuts

Abstract

The invention discloses a molecular marker, a primer pair and a method for identifying sex of pistachio nuts. The molecular marker is derived from a nucleotide sequence of a pistachio chromosome. The primer pair Seq.W.1 and Seq.W.2 is a pistachio nut female (ZW) individual specificity nucleic acid molecular probe, and the primer pair Seq.Z.1 is a pistachio nut male (ZZ) specificity negative control nucleic acid molecular probe. A conventional PCR method is adopted, a primer pair is used for amplification, and the sex of pistachio plants can be judged according to the existence of an amplification product. The primer pair provided by the invention is a pistachio nut male individual specific molecular probe, and identification requirements can be met only by a small number of leaf samples; the accuracy and the sensitivity are high, and if two PCR amplification bands with specified lengths can be amplified from a sample, the sample is judged as a female individual; if only one negative PCR amplification band can be amplified, judging that the individual is a male individual; the method is simple, adopts a PCR technology for detection, and is fast and efficient.

Description

Technical Field

[0001] The invention belongs to the technical field of identifying the sex of plants by molecular biological methods, and particularly relates to a molecular marker, a primer pair and a method for identifying the sex of pistachios. Background Art

[0002] Pistachio, scientifically known as Pistacia vera L., is a dioecious plant with significant differences in the biological and ecological traits of male and female individuals. Female pistachio plants produce large amounts of fruit and are an important source of nuts. However, the dioecious nature of pistachio trees creates natural inconveniences in breeding. The gender of new hybrid varieties often requires a long period of planting to be identified. Therefore, early gender identification of pistachio trees has always been an important requirement for pistachio seedling production and cultivation applications.

[0003] At present, the traditional methods of pistachio sex identification mainly rely on morphological characteristics, such as the shape and color of the tree or flower. However, these methods need to wait until the pistachio enters the flowering and fruiting period, which is time-sensitive and cannot meet the needs of early identification. In addition, there are some explorations based on physiological and biochemical indicators, but the stability and accuracy of these methods are very limited.

[0004] In 2022, Kafkas et al. published a research paper titled "The Pistachio Genomes Provide Insights into Nut Tree Domestication and ZW Sex Chromosome Evolution" in the international journal Plant Communications, deciphering the ZW and ZZ genomes of pistachios and proposing a model for the formation and evolution of ZW sex chromosomes in pistachios. These results provide a basis for designing efficient and accurate molecular markers for pistachio sex identification. Summary of the invention

[0005] In view of the serious deficiencies in the prior art methods for identifying the sex of pistachios, the present invention provides a molecular marker, a primer pair and a method for identifying the sex of pistachios, so as to achieve rapid and accurate identification of the sex of pistachios.

[0006] A molecular marker for identifying the sex of pistachio, the molecular marker is derived from a key nucleotide sequence of the sex determining region of chromosome 14 of pistachio, the nucleotide sequence is shown as W.Marker.1, W.Marker.2 and Z.Marker.1.

[0007] The nucleotide sequence for identifying the sex of pistachios provided by the present invention is derived from chromosome 14 of the pistachio genome that has been publicly published. The SDR region of the chromosome conforms to the ZW sex determination system and can completely distinguish between female and male pistachio individuals. Therefore, specific nucleic acid molecular probes can be designed and synthesized based on the highly conserved segments of this region to establish a molecular biological method for quickly and accurately identifying the sex of pistachios.

[0008] A primer pair for identifying the sex of pistachio, characterized in that the detection of the W sex determination region can arbitrarily select one of primer pairs 1 and 2, and the detection of the Z sex determination region selects primer pair 3:

[0009] Primer pair 1: (Seq.W.1)

[0010] Upstream primer TGCCCTTTTGTGTTATTTCTTTTATT,

[0011] Downstream primer: AGAGTCTATCACCGAGCTTCTTCTG;

[0012] Primer pair 2: (Seq.W.2)

[0013] Upstream primer ATGGAATATCAATATGAAGATTGCACG,

[0014] Downstream primer: TCAAATGTCATGACTTTGTTTTGATATG;

[0015] Primer pair 3 (Seq. Z.1):

[0016] Upstream primer: AGGATTCCTGATAGGTTCATTCGGAA,

[0017] Downstream primer: ATCACCTTCTTCCAAATTATTATCCCTCG.

[0018] The primer pair for identifying the sex of pistachio in the present invention is a specific nucleic acid molecular probe based on the characteristic nucleotide sequence of the sex determining region (W region and Z region) of pistachio, and is designed using the Primer3 web tool. The molecular probe has high specificity and high specificity, and can react with the sex determining region of pistachio respectively to identify the W and Z sex determining regions in the genome.

[0019] A method for identifying the sex of a pistachio fruit tree comprises the following steps:

[0020] (1) Extracting genomic DNA from pistachio tree samples using leaves as material;

[0021] (2) using the genomic DNA from step (1) as a template and performing PCR amplification using the primers described in claim 3;

[0022] (3) Agarose gel electrophoresis is used to detect the products of PCR step (2). Seq.W.1 or Seq.W.2 will amplify a 749 bp or 428 bp band, indicating that the sample has a W sex-determining segment; Seq.Z.1 will amplify a 1182 bp band, indicating that the sample has a Z sex-determining segment. Combining the two results, it can be determined whether the sample is female (ZW) or male (ZZ).

[0023] The PCR method was used to amplify the target fragment nucleotide sequences W.Marker.1, W.Marker.1 and Z.Marker.1 using Seq.W.1, Seq.W.2 and Seq.Z.1 primers. The PCR method can quickly and accurately identify the sex of pistachios, and only a small amount of leaf samples are needed.

[0024] To ensure a high PCR amplification success rate, the conditions are:

[0025] Pre-denaturation at 94°C for 6 min;

[0026] 35 cycles of reaction: denaturation at 94°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for s;

[0027] 72℃ pistachios for 7min;

[0028] Store at 4°C.

[0029] To improve the accuracy of pistachio sex identification, fresh and healthy pistachio leaves should be selected first, avoiding those with lesions, insect infestations and leaf veins. The pistachio trees to be tested can be seedlings, saplings, etc., or large trees without flowers or fruits.

[0030] The present invention has the beneficial effects:

[0031] The primer pair provided by the present invention is a pistachio sex-specific nucleic acid molecular probe. When the sex source of the sample is unknown, its sex can be identified by detecting whether the target nucleotide sequence corresponding to the probe exists in the sample genome, thereby providing a rapid and accurate method for pistachio sex identification, which will be helpful for the early identification of pistachio hybrid varieties and other breeding work. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1The following is the electrophoresis diagram of PCR amplification of 11 male and female pistachio samples using primer pairs Seq.W.1, Seq.W.2 and Seq.Z.1. Female samples can produce specific bands corresponding to Seq.W.1, Seq.W.2 and Seq.Z.1, while male samples can only produce specific bands corresponding to Seq.Z.1. DETAILED DESCRIPTION

[0033] Example 1: Preparation of genomic DNA from male and female pistachio individuals

[0034] 1. Extraction of sample genomic DNA

[0035] (1) Take 100 mg of fresh plant tissue (or 20 mg of dry tissue), add liquid nitrogen and grind thoroughly, then place in a clean centrifuge tube.

[0036] (2) Add 400 μl of PlantZol and vortex to mix until the sample is completely suspended.

[0037] (3) Add 7.5 μl RNase A to the above lysate and mix thoroughly.

[0038] (4) Incubate at 55°C for 15 minutes.

[0039] (5) Add an equal volume of phenol-chloroform, vortex to mix, and centrifuge at 12,000 × g for 5 min.

[0040] (6) Carefully pipette the upper aqueous phase into a clean centrifuge tube, add an equal volume of isopropanol, and invert thoroughly to mix (threaded or clustered genomic DNA may appear at this time).

[0041] (7) Centrifuge at 12,000 × g for 5 minutes and remove the supernatant.

[0042] (8) Add 500 μl of 70% ethanol, vortex for 5 seconds, centrifuge at 12,000 × g for 5 minutes, and remove the supernatant.

[0043] (9) Centrifuge again for 1-2 minutes and aspirate any remaining liquid.

[0044] (10) Dry the DNA pellet, add 50-200 μl TE, and incubate at 65°C for 10 min-1 h to dissolve the DNA, flicking the pellet several times to aid dissolution.

[0045] Example 2: Preparation of Nucleic Acid Molecular Probes Specific to the Sex Determination Region of Male and Female Pistachios

[0046] The publicly published pistachio genome was obtained, and several candidate marker sequences were selected for blastn sequence comparison and identification in the relevant sex determination region to obtain effective specific nucleotide sequences. Then, the Primer3 online tool was used to design the following primers:

[0047] Primer pair 1: (Seq.W.1)

[0048] Upstream primer TGCCCTTTTGTGTTATTTCTTTTATT,

[0049] Downstream primer: AGAGTCTATCACCGAGCTTCTTCTG;

[0050] Primer pair 2: (Seq.W.2)

[0051] Upstream primer ATGGAATATCAATATGAAGATTGCACG,

[0052] Downstream primer: TCAAATGTCATGACTTTGTTTTGATATG;

[0053] Primer pair 3 (Seq. Z.1):

[0054] Upstream primer: AGGATTCCTGATAGGTTCATTCGGAA,

[0055] Downstream primer: ATCACCTTCTTCCAAATTATTATCCCTCG.

[0056] The above oligonucleotide molecules can be synthesized on an automatic DNA synthesizer.

[0057] The amplified sequence of primer pair Seq.W.1 is shown as W.Marker.1.

[0058] The amplified sequence of primer pair Seq.W.2 is shown as W.Marker.2.

[0059] The amplified sequence of primer pair Seq.Z.1 is shown as Z.Marker.1.

[0060] Example 3: Validation of the pistachio sex determination region-specific nucleic acid molecular probe (PCR method)

[0061] (1) Obtaining the pistachio sample genomic DNA sequence using the method in Example 1

[0062] (2) PCR reaction was carried out according to the primers in Example 2, under the following conditions:

[0063] Pre-denaturation at 94°C for 6 min;

[0064] 35 cycles of reaction: denaturation at 94°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 60 s;

[0065] 72℃ pistachios for 7min;

[0066] Store at 4°C.

[0067]

[0068] (3) The PCR amplification results were detected by 1% agarose gel electrophoresis.

[0069] (4) The electrophoresis results are shown in the figure. Figure 1 The electrophoresis diagrams of 11 pairs of female and male pistachio samples were amplified by PCR using specific nucleic acid molecular probes Seq.W.1, Seq.W.2 and Seq.Z.1. In the amplification results, 100% of female individuals were able to detect the 749bp band corresponding to Seq.W.1, the 428bp band corresponding to Seq.W.2, and the 1182bp band corresponding to Seq.Z.1, proving that they were female (having both Z and W sex determination regions); 100% of male individuals could only detect the 1182bp band corresponding to Seq.Z.1, proving that they were male (having only the Z sex determination region). This illustrates the high specificity of the Seq.W.1 / Seq.W.2 / Seq.Z.1 primers.

Claims

1. A molecular marker for identifying the sex of pistachios, characterized in that: The molecular marker is derived from the key nucleotide sequence of the sex determining region of chromosome 14 of pistachio, and the nucleotide sequence is shown as W.Marker.1, W.Marker.2 and Z.Marker.

1.

2. The use of molecular markers as claimed in claim 1 in identifying the sex of pistachios.

3. A primer pair for identifying the sex of pistachios, characterized in that: Primer pairs 1 and 2 were used for W region identification, and primer pair 3 was used for Z region identification: Primer pair 1: (Seq.W.1) Upstream primer TGCCCTTTTGTGTTATTTCTTTTATT, Downstream primer: AGAGTCTATCACCGAGCTTCTTCTG; Primer pair 2: (Seq.W.2) Upstream primer ATGGAATATCAATATGAAGATTGCACG, Downstream primer: TCAAATGTCATGACTTTGTTTTGATATG; Primer pair 3 (Seq. Z.1): Upstream primer: AGGATTCCTGATAGGTTCATTCGGAA, Downstream primer: ATCACCTTCTTCCAAATTATTATCCCTCG.

4. The application of the primer pair as claimed in claim 3 in identifying the sex of pistachio.

5. A method for identifying the sex of pistachios, characterized in that: The steps include: (1) Extracting pistachio genomic DNA; (2) using the pistachio genomic DNA from step (1) as a PCR detection template and performing PCR amplification using the primer pair described in claim 3; (3) Electrophoresis is used to detect the amplified product. If the amplified product has a 749 bp or 428 bp band when amplified using primer pair 1 or primer pair 2, and the amplified product has a 1182 bp band when amplified using primer pair 3, the gene is female. If the amplified product does not have the above band when amplified using primer pair 1 or primer pair 2, and only the corresponding band is present when amplified using primer pair 3, the gene is male.

6. The method according to claim 5, characterized in that The PCR amplification system is:

7. The method according to claim 5, characterized in that PCR amplification conditions are: Pre-denaturation at 94°C for 6 min; 35 cycles of reaction: denaturation at 94°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for s; 72℃ pistachios for 7min; Store at 4℃.

8. The method according to claim 5, characterized in that The pistachio trees to be tested were seedlings or trees that had not yet flowered, and fresh leaf samples were used for testing.

Images