Indel molecular marker for identifying monsoonal fish strain in southwest region and application thereof
By developing Indel molecular markers and primer pairs for identifying swamp eel strains in Southwest China, the problem of targeted screening of swamp eel strains has been solved, enabling rapid identification and precise breeding, and protecting the genetic resources of swamp eels in Southwest China.
Patent Information
- Application Number
- CN202411630759.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-15
- Publication Date
- 2025-11-28
- Estimated Expiration
- 2044-11-15
AI Technical Summary
Existing technologies lack effective methods for targeted screening of eel strains from different regions, resulting in the destruction of the genetic resources of wild eel resources and making it difficult to achieve precision breeding.
Indel molecular markers A, B, C, and D were developed to identify the strains of swamp eels from Southwest China, and corresponding primer pairs 1, 2, 3, and 4 were designed. The swamp eels were rapidly identified as belonging to the Southwest China strain by PCR amplification and nucleotide sequence comparison.
This has enabled the rapid identification of yellow eel strains in Southwest China, facilitated the precise screening and breeding of genetic resources, and promoted the domestication of wild germplasm resources.
Smart Images

Figure CN119265316B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of aquatic molecular breeding, and particularly relates to an Indel molecular marker for identifying a Monopterus albus strain in the southwest region and application thereof. BACKGROUND
[0002] Monopterus albus belongs to the Synbranchiformes, Synbranchidae and Monopterus, and is widely distributed in rice fields, marshes and mud ponds in East Asia, South Asia and Southeast Asia. It is one of the "special freshwater fish" with economic value in China due to its good taste, high nutritional value, outstanding flavor and other advantages, and is commercially important and delicious. According to the 2024 China Fishery Statistical Yearbook, the domestic production of Monopterus albus has exceeded 355,000 tons, and the current resource production is in short supply, and the price is high, and its market potential is huge. However, the habitat of wild Monopterus albus is decreasing, and its genetic resources are severely damaged. Therefore, it is particularly necessary to accurately and directionally screen high-quality wild resources. The southwest region is one of the seven major natural geographical divisions in China, and the water system is rich and diverse, and the high-quality germplasm resources are rich.
[0003] Molecular markers are genetic markers based on nucleotide sequence variations between individuals, which can reflect specific DNA fragments of differences in the genome between populations. Compared with other morphological markers, cytological markers, microsatellite markers, etc., Indel markers have the advantages of simple operation, high efficiency, high repeatability, etc., and DNA in different stages of biological development and different tissues can be used for marker analysis. At present, there is no effective method to directionally screen Monopterus albus strains in different regions, so it is necessary to develop molecular markers for screening Monopterus albus strains in specific regions. SUMMARY
[0004] The purpose of the present application is to provide an Indel molecular marker A, B, C or D for identifying a Monopterus albus strain in the southwest region,
[0005] wherein the nucleotide sequence of the Indel molecular marker A is shown in SEQ ID NO: 9 or SEQ ID NO: 13; the nucleotide sequence of the Indel molecular marker B is shown in SEQ ID NO: 10 or SEQ ID NO: 14; the nucleotide sequence of the Indel molecular marker C is shown in SEQ ID NO: 11 or SEQ ID NO: 15; and the nucleotide sequence of the Indel molecular marker D is shown in SEQ ID NO: 12 or SEQ ID NO: 16.
[0006] If there is an insertion of the sequence as shown below at the 31bp base of the sequence as shown in SEQ ID NO: 13: AACCGTGGTTTCACTTTAAGAGGCCCACTAT, then it corresponds to SEQ ID NO: 9;
[0007] If there is a deletion of the sequence as shown below at the 28-57bp base of the sequence as shown in SEQ ID NO: 14: AAAAAAAAAAACCCACAAGGTCTGATCTCTT, then it corresponds to SEQ ID NO: 10;
[0008] If there is a deletion of the sequence as shown below at the 73-101bp base of the sequence as shown in SEQ ID NO: 15: CACATCAAATAAAATAAAAGGGCCAAGGT, then it corresponds to SEQ ID NO: 11;
[0009] If there is a deletion of the sequence as shown below at the 184-204bp base of the sequence as shown in SEQ ID NO: 16: CCAGTGAATACTAATAGCTTG, then it corresponds to SEQ ID NO: 12.
[0010] Another object of the present application is to provide primer pair 1, primer pair 2, primer pair 3 and primer pair 4 for amplifying the above-mentioned Indel molecular markers A, B, C or D, respectively, the nucleotide sequences of which are shown in Table 1 as SEQ ID NO: 1-8:
[0011] Table 1 Nucleotide sequences of four pairs of primers
[0012]
[0013] When the above-mentioned primer pairs of SEQ ID NO: 1-8 are used to amplify the genome DNA of the ricefish in the test area, the ricefish strains in the southwest area can be quickly screened according to the amplified fragments. If the nucleotide sequences of the amplified products are respectively as shown in SEQ ID NO: 9-12, it is identified as a ricefish strain in the southwest area; if the nucleotide sequences of the amplified products are respectively as shown in SEQ ID NO: 13-16, it is identified as a ricefish strain not in the southwest area.
[0014] The present application also provides a kit for identifying ricefish strains in the southwest area, comprising one or more than one of primer pair 1 as shown in SEQ ID NO: 1-2, primer pair 2 as shown in SEQ ID NO: 3-4, primer pair 3 as shown in SEQ ID NO: 5-6 or primer pair 4 as shown in SEQ ID NO: 7-8.
[0015] The application also provides application of the Indel molecular marker, the primer pair of SEQ ID NO: 1-8 or the kit containing the primer pair of SEQ ID NO: 1-8 in identifying the rice field eel strain in the southwest region.
[0016] The application further provides a method for identifying the rice field eel strain in the southwest region, comprising the following steps:
[0017] (1) taking muscle tissue of the tail of the rice field eel to be detected for extracting rice field eel genomic DNA;
[0018] (2) using one or more than one pair of the primer pair of SEQ ID NO: 1-2, the primer pair of SEQ ID NO: 3-4, the primer pair of SEQ ID NO: 5-6 or the primer pair of SEQ ID NO: 7-8 as a template, performing PCR amplification to obtain an amplification product;
[0019] (3) identifying according to the nucleotide sequence of the amplification product respectively with SEQ ID NO: 9-12 or SEQ ID NO: 13-16; if the nucleotide sequence of the amplification product is respectively as shown in SEQ ID NO: 9-12, the rice field eel strain in the southwest region is identified; if the nucleotide sequence of the amplification product is respectively as shown in SEQ ID NO: 13-16, the rice field eel strain not in the southwest region is identified.
[0020] The innovation of the application is:
[0021] The application provides an Indel molecular marker for identifying the rice field eel strain in the southwest region, and different rice field eel strains in different regions can be amplified by PCR using the molecular marker primer pair required for detection provided by the application, so that whether the rice field eel strain in the southwest region can be identified quickly according to the amplification fragment. The Indel marker provided by the application is applied to practice, which is beneficial to rapid genetic identification, rapid screening of the rice field eel strain in the southwest region, speeding up domestication breeding of wild rice field eel germplasm resources in the southwest region and realizing precision breeding. BRIEF DESCRIPTION OF DRAWINGS
[0022] Figure 1 : gel electrophoresis diagram of PCR amplification of 18 rice field eel strain DNAs using primer pair 1
[0023] Figure 2 : gel electrophoresis diagram of PCR amplification of 18 rice field eel strain DNAs using primer pair 2
[0024] Figure 3 : gel electrophoresis diagram of PCR amplification of 18 rice field eel strain DNAs using primer pair 3
[0025] Figure 4Gel electrophoresis map of PCR amplification of DNA of 18 mud eel strains using primer pair 4
[0026] In which the numbers 1-18 represent the following 18 mud eel strains respectively:
[0027] 1, Chongqing; 2, Yibin, Sichuan; 3, Kunming, Yunnan; 4, Hefei, Anhui; 5, Changsha, Hunan; 6, Weinan, Shaanxi; 7, Ankang, Shaanxi; 8, Ganzhou, Jiangxi; 9, Jiujiang, Jiangxi; 10, Zhanjiang, Guangdong; 11, Zhengzhou, Henan; 12, Nanning, Guangxi; 13, Dandong, Liaoning; 14, Dongying, Shandong; 15, Huai'an, Jiangsu; 16, Baoding, Hebei; 17, Sanya, Hainan; 18, Xiantao, Hubei DETAILED DESCRIPTION
[0028] The following examples are only used to further illustrate the content of the present application, but should not be understood as limiting the present application. Modifications or replacements of the method, steps or conditions of the present application without departing from the spirit and essence of the present application shall all belong to the scope of the present application. The experimental methods not specified in the specific conditions in the examples and the reagents and materials not specified in the formula are all according to the conventional conditions in the art, and the reagents used are all commercially available.
[0029] The present application provides an Indel molecular marker for identifying whether the mud eel is a mud eel strain in the southwest region, and the obtaining method of the molecular marker is as follows: based on the existing mud eel genome sequence, by resequencing the mud eels of different regional strains, the genomic regions of the mud eel strains in the southwest region that are different from the mud eel strains in other regions are identified by whole genome association analysis, which are located at the physical positions of 82154891 sites on the first chromosome (Chr1), 38387108-38387137 sites on the eighth chromosome (Chr8), 12128106-12128124 sites on the first chromosome (Chr1), and 13742169-13742189 sites on the first chromosome (Chr1). The flanking sequences of 200bp before and after the Indel variation in the genomic region are selected for primer development. After the Indel molecular marker is amplified by primers, whether the mud eel to be tested is a mud eel strain in the southwest region is identified by the difference of the amplified fragments. The amplified fragments conforming to the nucleotide sequences of the Indel molecular markers SEQ ID NO:9-12 are mud eel strains in the southwest region.
[0030] The present application provides four pairs of primers for detecting the Indel molecular marker, and the sequences of the forward and reverse primers are shown in SEQ ID NO:1-8 respectively.
[0031] Example 1: Identification of 18 regional mud eel strains
[0032] (1) Extraction of mud eel sample genomic DNA
[0033] Cut a small piece of tail muscle of about 0.5 grams from the test O. latipes, extract genomic DNA using a tissue genomic DNA extraction kit (brand: Tiangen, item number: 69504), and use a NanoDrop 2000 spectrophotometer to detect the purity and concentration of the obtained DNA sample. The extracted DNA can be stored at -20°C for long-term storage.
[0034] (2) Indel molecular marker fragment PCR amplification
[0035] Using the O. latipes genomic DNA obtained above as a template, PCR amplification was performed using the primer pairs shown in the nucleotide sequences of primer pair 1 SEQ ID NO: 1-2, primer pair 2 SEQ ID NO: 3-4, primer pair 3 SEQ ID NO: 5-6, or primer pair 4 SEQ ID NO: 7-8 in Table 1.
[0036] A premixed PCR reagent kit with dye (brand: TaKaRa, item number: RR903A) was used to configure the following 20μl reaction system: Premix Taq 10μl, 10μM forward primer 0.5μl, 10μM reverse primer 0.5μl, template DNA 1μl, supplemented with ddH2O to a total volume of 20μl.
[0037] The PCR amplification program was as follows: 98°C pre-denaturation for 10 min, 98°C denaturation for 10 s, 60°C annealing for 30 s, 72°C extension for 1 min, 35 cycles, and 72°C extension for 5 min.
[0038] (3) Agarose gel electrophoresis of the amplified product
[0039] A 2% agarose gel was configured, the PCR amplification product was added, and electrophoresis was performed using 50bp DNA marker as a marker, with the electrophoresis conditions set at 110V and an electrophoresis time of 60 min. A gel imaging instrument was used to take pictures of the bands to obtain gel pictures.
[0040] (4) Identification of the amplified product
[0041] Identification was performed according to the bands on the gel pictures or the sequencing results of the PCR amplification product (sequencing was performed at Shanghai Sunway Biotech Co., Ltd.).
[0042] When primer pair 1 was used and the electrophoresis gel showed a band at 229bp or the sequencing result of the amplified product was as shown in SEQ ID NO: 9, the O. latipes tested was an O. latipes strain from the southwest region; if a band was shown at 199bp or the sequencing result of the amplified product was as shown in SEQ ID NO: 13, the O. latipes tested was an O. latipes strain not from the southwest region.
[0043] If the electrophoresis gel using primer pair 2 shows a band at 135 bp or the sequencing result of the amplified product is as shown in SEQ ID NO:10, then the tested eel is a strain from the Southwest region; if the band shows a band at 165 bp or the sequencing result of the amplified product is as shown in SEQ ID NO:14, then the tested eel is a strain from outside the Southwest region.
[0044] If the electrophoresis gel using primer pair 3 shows a band at 142 bp or the sequencing result of the amplified product is as shown in SEQ ID NO:11, then the tested eel is a strain from the Southwest region; if the band shows a band at 171 bp or the sequencing result of the amplified product is as shown in SEQ ID NO:15, then the tested eel is a strain from outside the Southwest region.
[0045] If the electrophoresis gel using primer pair 4 shows a band at 210 bp or the sequencing result of the amplified product is as shown in SEQ ID NO:12, then the tested eel is a strain from the Southwest region; if the band shows a band at 231 bp or the sequencing result of the amplified product is as shown in SEQ ID NO:16, then the tested eel is a strain from outside the Southwest region.
[0046] The experimental results are as follows: Figures 1-4 As shown.
[0047] Figure 1 The amplification bands of samples 1-3 were located at 229bp, while the amplification bands of samples 4-18 were located at 199bp.
[0048] Figure 2 The amplification bands of samples 1-3 were located at 135bp, while the amplification bands of samples 4-18 were located at 165bp.
[0049] Figure 3 The amplification bands of samples 1-3 were located at 142bp, while the amplification bands of samples 4-18 were located at 171bp.
[0050] Figure 4 The amplification bands of samples 1-3 were located at 210bp, while the amplification bands of samples 4-18 were located at 231bp.
[0051] from Figures 1-4 It is clear from the data that eels No. 1-3, from Chongqing, Yibin in Sichuan, and Kunming in Yunnan, are indeed from the Southwest China strain, while eels No. 4-18 come from other regions.
[0052] The above results show that the Indel molecular markers A, B, C and D can effectively identify whether it is a southern region of the Chinese rice field eel strain. Therefore, the Indel marker provided by the present application is beneficial to quickly realize the genetic identification of the Chinese rice field eel strain, accelerate the domestication breeding of the Chinese rice field eel wild germplasm resources in the southwest region, and realize precision breeding.
Claims
1. An Indel molecular marker combination for identifying strains of yellow eel, characterized in that: The molecular marker combination consists of Indel molecular markers A, B, C, and D, wherein the nucleotide sequences of Indel molecular marker A are shown in SEQ ID NO:9 and SEQ ID NO:13; the nucleotide sequences of Indel molecular marker B are shown in SEQ ID NO:10 and SEQ ID NO:14; the nucleotide sequences of Indel molecular marker C are shown in SEQ ID NO:11 and SEQ ID NO:15; and the nucleotide sequences of Indel molecular marker D are shown in SEQ ID NO:12 and SEQ ID NO:
16.
2. A primer pair for amplifying the Indel molecular marker combination of claim 1, characterized in that: The primer pairs consist of primer pairs 1, 2, 3, and 4, which are used to amplify the Indel molecular markers A, B, C, and D of claim 1, respectively; the nucleotide sequences of primer pair 1 are shown in SEQ ID NO:1-2; the nucleotide sequences of primer pair 2 are shown in SEQ ID NO:3-4; the nucleotide sequences of primer pair 3 are shown in SEQ ID NO:5-6; and the nucleotide sequences of primer pair 4 are shown in SEQ ID NO:7-8.
3. A reagent kit for identifying strains of yellow eel, characterized in that: The kit contains primer pair 1 as shown in SEQ ID NO:1-2; primer pair 2 as shown in SEQ ID NO:3-4; primer pair 3 as shown in SEQ ID NO:5-6; and primer pair 4 as shown in SEQ ID NO:7-8.
4. The application of the Indel molecular marker combination as described in claim 1 for identifying yellow eel strains.
5. The application of the primer pair according to claim 2 for identifying the strain of yellow eel.
6. The application of the kit according to claim 3 for identifying strains of yellow eel.
7. A method for identifying the strain of the yellow eel, comprising the following steps: (1) Muscle tissue from the tail of the eel to be tested was taken for the extraction of genomic DNA from the eel; (2) Using the genomic DNA of the yellow eel as a template, PCR amplification was performed using the primer pairs shown in SEQ ID NO:1-2, SEQ ID NO:3-4, SEQ ID NO:5-6 and SEQ ID NO:7-8 to obtain the amplification products; (3) The nucleotide sequences of the amplified products were compared and identified with SEQ ID NO:9-12 and SEQ ID NO:13-16, respectively.
Citation Information
Patent Citations
Indel molecular marker for identifying producing area of ricefield eel and application of Indel molecular marker
CN120041586A
Indel molecular marker for identifying ricefield eel strain and application of Indel molecular marker
CN120060500A