A SNP molecular marker of Larix olgensis and a whole-genome liquid chip prepared therefrom and its application

By developing SNP molecular markers of long larch and whole genome liquid phase chips, the problems of long larch breeding cycle and high cost of long larch breeding are solved, efficient and low-cost genotyping and breeding are achieved, and multi-field applications are supported.

CN119265335BActive Publication Date: 2025-07-22INST OF FORESTRY CHINESE ACAD OF FORESTRY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410922435.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2024-05-21
Filing Date
2024-07-10
Publication Date
2025-07-22
Estimated Expiration
2044-07-10

AI Technical Summary

Technical Problem

The breeding cycle of Changbai Larch is long, the breeding cost is high, and there are problems of uneven yields and low seed quality. The existing molecular marking technology is difficult to efficiently cover the SNP sites of the entire genome, resulting in low breeding efficiency.

Method used

Developed SNP molecular markers of long white larch and their genome-wide liquid phase chips, use high-throughput molecular markers to screen and design probes, cover the SNP sites of the entire genome, and combine liquid phase capture and sequencing technology to perform genotyping to reduce detection costs and improve accuracy.

Benefits of technology

It has achieved low-cost and efficient genotyping of long-white larch, supporting genetic diversity assessment, germplasm resource identification, kinship identification and molecular design breeding, shortening the breeding cycle, improving breeding accuracy, and is suitable for the growth of long-white larch varieties and the excavation of stress-resistant traits.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004937102880000011
    Figure BDA0004937102880000011
  • Figure BDA0004937102880000021
    Figure BDA0004937102880000021
  • Figure BDA0004937102880000031
    Figure BDA0004937102880000031
Patent Text Reader

Abstract

The present invention discloses a SNP molecular marker of Larix olgensis and a whole-genome liquid chip prepared therefrom and its applications. The SNP molecular marker of Larix olgensis includes at least one of 61,680 SNP molecular markers, and the physical positions of the 61,680 SNP molecular markers are determined by sequence alignment based on the Japanese larch reference genome GCA_027924585.1; the SNP molecular marker of Larix olgensis of the present invention can be used for specific identification of Larix olgensis trees. Using the loci to prepare a whole-genome liquid chip for Larix olgensis can achieve low-cost genotyping, assessment of genetic diversity of Larix olgensis, identification of germplasm resources and genetic relationships, molecular design breeding, construction of genetic maps and functional gene mapping, genome-wide association analysis and intelligent breeding, and has high application value in multiple fields of Larix olgensis breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to a SNP molecular marker of Larix olgensis, a whole-genome liquid chip prepared therefrom, and their applications. Background Art

[0002] Larix olgensis Henry belongs to the genus Larix of the family Pinaceae. Its trunk is straight and it has strong stress resistance, with high economic value and ecological value. It is an important native timber and afforestation tree species. At present, the research on Larix olgensis mainly focuses on genetic evolution and selection of excellent families. By selecting excellent clones and families and hybridization, excellent germplasms have been obtained and developed to varying degrees. However, due to the long growth cycle of Larix, it has become a major limiting factor in germplasm improvement. At the same time, there are also problems such as uneven yield and low seed quality in Larix tree species. Using molecular marker breeding to construct genetic maps and establish markers associated with phenotypic traits can shorten the breeding cycle, reduce breeding costs, and improve the accuracy of breeding. Conducting an evaluation of genetic diversity for specific traits of germplasm resources can better explore and utilize excellent germplasms and improve breeding efficiency.

[0003] In recent years, molecular markers such as RAPD, RFLP, and SNP have been widely used in Larix research. These markers have characteristics such as genetic stability and high specificity. Among them, SNP is the most abundant type of variation in the whole genome. Compared with other markers, it has the characteristics of high density, high genetic stability, and easy analysis. The whole-genome breeding chip is a breeding tool based on high-throughput molecular marker technology, which can cover SNP sites throughout the genome, with characteristics such as wide coverage, high sensitivity, high throughput, and high accuracy. The SNP liquid chip has advantages such as convenient detection, low cost, high throughput, and high sensitivity. Using the whole-genome breeding chip to comprehensively evaluate the genotype analysis, genetic diversity, and functional gene discovery of Larix olgensis germplasm resources is helpful to accelerate the discovery of excellent germplasms of Larix, identify new functional genes, and promote the transformation of Larix from conventional breeding to molecular design breeding and intelligent breeding. Summary of the Invention

[0004] The present invention aims to solve at least one of the technical problems existing in the above-mentioned prior art. For this purpose, the present invention provides a SNP molecular marker of Larix olgensis.

[0005] The present invention also provides a whole-genome liquid chip for detecting the above-mentioned SNP molecular marker of Larix olgensis.

[0006] The present invention also provides a kit for detecting the above-mentioned SNP molecular marker of Larix olgensis.

[0007] The present invention also provides a method for screening SNP molecular markers of Larix olgensis Henry.

[0008] The present invention also provides an application of the above SNP molecular markers of Larix olgensis Henry, whole-genome liquid-phase chips or kits.

[0009] The present invention also provides a breeding method for Larix olgensis Henry.

[0010] According to one aspect of the present invention, there is provided a SNP molecular marker of Larix olgensis Henry, including at least one of 61,680 SNP molecular markers, and the physical positions of the 61,680 SNP molecular markers are determined by sequence alignment based on the Japanese larch reference genome GCA_027924585.1, and the locus information is specifically shown in Table 1 below.

[0011] Table 1

[0012]

[0013]

[0014]

[0015]

[0016]

[0017]

[0018]

[0019]

[0020]

[0021]

[0022]

[0023]

[0024]

[0025]

[0026]

[0027]

[0028]

[0029]

[0030]

[0031]

[0032]

[0033]

[0034]

[0035]

[0036]

[0037]

[0038]

[0039]

[0040]

[0041]

[0042]

[0043]

[0044]

[0045]

[0046]

[0047]

[0048]

[0049]

[0050]

[0051]

[0052]

[0053]

[0054]

[0055]

[0056]

[0057]

[0058]

[0059]

[0060]

[0061]

[0062]

[0063]

[0064]

[0065]

[0066]

[0067]

[0068]

[0069]

[0070]

[0071]

[0072]

[0073]

[0074]

[0075]

[0076]

[0077]

[0078]

[0079]

[0080]

[0081]

[0082] In some embodiments of the present invention, the position information of the SNP molecular marker is represented in the form of chromosome number: physical position, and the specific chromosome number is the chromosome number before the ":" in BSBM0100 + the table.

[0083] In some embodiments of the present invention, for the SNP molecular marker 0826.1:5022779G / -, the "-" represents the insertion of GAAACCGAGTCGAATGAGCCGGAGAAAAGCAAAACCGAGTCGAATGAGCCGAAGAAAAGCA.

[0084] In some embodiments of the present invention, when Alt is ".", it means that there are multiple possible mutations.

[0085] In some embodiments of the present invention, when ref is A, Alt is ".", indicating that the mutation can be T, G, C or N;

[0086] When ref is T, Alt is "." indicating that the mutation can be A, G, C or N;

[0087] When ref is G, Alt is "." indicating that the mutation can be T, A, C or N;

[0088] When ref is C, Alt is "." indicating that the mutation can be T, A, G or N, where N is a deletion.

[0089] In the second aspect of the present invention, a whole-genome liquid chip is proposed, and the whole-genome liquid chip includes a primer set and / or a probe for detecting the above-mentioned SNP molecular marker of Larix olgensis.

[0090] In the third aspect of the present invention, a kit is proposed, and the kit contains a primer set and / or a probe for detecting the above-mentioned SNP molecular marker of Larix olgensis.

[0091] In the fourth aspect of the present invention, a screening method for the above-mentioned SNP molecular marker of Larix olgensis is proposed, and the screening method includes the following steps: mining and screening target-site SNPs from the whole-genome sequencing data of Larix olgensis, then designing probes for the target-site SNPs, screening the SNPs that meet the requirements of the probes, and finally using them as the SNP molecular markers of Larix olgensis.

[0092] In some embodiments of the present invention, the mining and screening of target site SNPs includes the following steps: collecting Larix olgensis samples, sequencing to obtain whole-genome sequencing data; aligning the whole-genome sequencing data to the Larix kaempferi reference genome GCA_027924585.1, and using GATK software to detect and filter SNPs; screening the filtered markers to obtain target site SNPs; the screening parameters are: Maf≥0.05, detection rate≥90%, heterozygosity≤0.3, Depth≥5.

[0093] In some embodiments of the present invention, the filtering criteria are as follows: QD<2.0||FS>60.0||MQ<35.0||MQRankSum<-12.5||Read PosRankSum<-8.0||DP>6950.

[0094] In some embodiments of the present invention, the length of the probe is 80-120bp.

[0095] In some embodiments of the present invention, the length of the probe is about 100bp.

[0096] In some embodiments of the present invention, the GC content of the probe is between 20% and 80%.

[0097] In some embodiments of the present invention, screening SNPs that meet the requirements of the probe includes the following steps: sequencing the probe, and removing the probes that cannot be uniquely aligned on the genome and whose flanking sequences contain repetitive sequences.

[0098] In the fifth aspect of the present invention, an application of at least one of the above-mentioned Larix olgensis SNP molecular markers, whole-genome liquid chip and kit is proposed, and the application is for genotyping detection of Larix olgensis.

[0099] In some embodiments of the present invention, the application is for the identification of germplasm resources of Larix olgensis.

[0100] In some embodiments of the present invention, the application is for genome-wide association analysis of Larix olgensis.

[0101] In some embodiments of the present invention, the application is for cluster analysis and identification of genetic relationships of Larix olgensis.

[0102] In some embodiments of the present invention, the application is for genetic mapping and gene localization of Larix olgensis.

[0103] In some embodiments of the present invention, the application is for the identification of genetic diversity of Larix olgensis.

[0104] In some embodiments of the present invention, the application is for molecular design breeding of Larix olgensis.

[0105] In some embodiments of the present invention, the application can be specifically realized by the following method:

[0106] S1. Genotype the sample to be tested using at least one of the Larix olgensis SNP molecular markers, whole-genome liquid-phase chips, and kits to obtain a genotype typing result;

[0107] S2. Analyze the genotype typing result obtained in step S1.

[0108] In the sixth aspect of the present invention, a breeding method for Larix olgensis is proposed, including the following steps: Detect the DNA of the Larix olgensis to be tested using at least one of the above-mentioned Larix olgensis SNP molecular markers, whole-genome liquid-phase chips, and kits, and select Larix olgensis for subsequent breeding.

[0109] In some embodiments of the present invention, the detection is carried out based on the liquid-phase probe capture sequencing typing technology.

[0110] The present invention has at least the following beneficial effects:

[0111] The Larix olgensis SNP molecular markers of the present invention can be used for specific identification of Larix olgensis trees. Using the Larix olgensis SNP molecular markers to prepare a whole-genome liquid-phase chip for Larix olgensis can achieve low-cost genotyping. It is mainly specific to Larix olgensis and can also realize the evaluation of Larix olgensis genetic diversity, identification of germplasm resources and genetic relationships, molecular design breeding, construction of genetic maps and functional gene mapping, genome-wide association analysis, and intelligent breeding, and has high application value in multiple fields of Larix olgensis breeding; and this whole-genome liquid-phase chip also includes 256 growth and stress resistance trait loci, which can be used for the exploration and utilization of important trait genes and molecular marker-assisted selection.

[0112] At the same time, the whole-genome liquid-phase chip for Larix olgensis prepared by the present invention can be used for low-cost and large-scale genotyping detection of Larix olgensis. Because the reference genome of Larix is relatively large (up to 13 Gb), the cost of obtaining genotype typing results by resequencing is relatively high. The cost of the 60K liquid-phase chip is reduced by more than 90% compared with resequencing (10×); and based on the principle of the liquid-phase chip, the loci are flexible, and new functional marker loci can be added at any time later. This chip also contains 256 trait-associated loci, which is more suitable for the exploration and research of growth and stress resistance genes of Larix olgensis varieties, and is conducive to the development and utilization of Larix olgensis germplasm resources and the creation of new varieties.

[0113] Other features and advantages of the present invention will be set forth in the following description, and in part will be obvious from the description, or may be learned by practice of the present invention. Description of the Drawings

[0114] The present invention will be further described below in conjunction with the drawings and embodiments, where:

[0115] Figure 1 It is the MAF distribution diagram in Embodiment 1 of the present invention;

[0116] Figure 2 It is the chromosome density distribution diagram of the 60K cGPS liquid-phase chip locus of Larix olgensis in Embodiment 1 of the present invention;

[0117] Figure 3 It is the schematic diagram of the cGPS liquid-phase chip process detection in Embodiment 1 of the present invention;

[0118] Figure 4 It is the detection result diagram of the average consistency rate of genotypes of technical replicate samples in Embodiment 3 of the present invention;

[0119] Figure 5 It is the cluster analysis diagram of the 60K cGPS liquid-phase chip of Larix olgensis in Embodiment 4 of the present invention. Detailed Embodiments

[0120] The concept of the present invention and the technical effects generated will be clearly and completely described below in conjunction with the embodiments to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all embodiments. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative efforts shall fall within the scope of protection of the present invention.

[0121] For those not specified in the embodiments, they are carried out according to the conventional conditions or the conditions recommended by the manufacturer. For the reagents or instruments not specified by the manufacturer, they are all conventional products that can be obtained through commercial purchase.

[0122] Embodiment 1

[0123] In this embodiment, an SNP molecular marker of Larix olgensis and a whole-genome liquid-phase chip of Larix olgensis designed according to the SNP molecular marker of Larix olgensis are prepared.

[0124] 1. The screening process of the SNP molecular marker of Larix olgensis is as follows:

[0125] (1) Obtain the SNP candidate locus set from the whole-genome resequencing data source

[0126] To obtain genome-wide loci rich in genetic information, representative germplasms from different natural distribution areas of Larix olgensis were collected, including 131 Larix olgensis materials from Heilongjiang and Jilin provinces. Whole-genome resequencing was performed, and the libraries were sequenced on the MGI DNBSEQ-T7 high-throughput sequencing platform. For SNP calling, fastp (v0.20.0) was used for filtering in sequence, and the Burrows-Wheeler Aligner (0.7.12-r1039) was used to align to the Larix kaempferi reference genome (GCA_027924585.1). The picard1.107 software (http: / / www.psc.edu / index.php / user-resources / software / picard) was used to sort the sam file and convert it into a bam file, and PCR duplicates were removed. The GATK software was used for SNP detection and filtering. According to the genomic data, the following filtering criteria were adopted: QD < 2.0 || FS > 60.0 || MQ < 35.0 || MQRankSum < -12.5 || Read PosRankSum < -8.0 || DP > 6950. After filtering, a.vcf file containing SNP variation information for all samples was obtained.

[0127] (2) Locus screening

[0128] The MAF (Minor Allele Frequency), detection rate, heterozygosity rate, and sequencing depth of all sample SNP loci were statistically analyzed. Based on the parameters of MAF ≥ 0.05, detection rate ≥ 90%, heterozygosity rate ≤ 0.3, and Depth ≥ 5, 228,174,614 SNP loci were screened and used for probe design. The principle of probe design is to design probes within 100 bp on both sides of all target loci. The probe length is generally 100 bp, and the GC content is between 20% and 80%. According to the probe design results, probes that cannot be uniquely aligned on the genome and those containing repetitive sequences in the flanking sequences were removed. Based on the principle of uniform distribution, 61,424 SNP loci with high polymorphism and good universality were preferentially selected (as shown in Figure 1 ). At the same time, combining the existing research results of the project (differential loci obtained from transcriptome sequencing analysis) and 256 important trait-associated loci mined by genome-wide association analysis, including traits such as diameter at breast height, length of annual branches, coniferous trees, and stress resistance, a total of 61,680 candidate SNP loci were finally obtained. The loci are shown in Table 1 of the specification. The chromosome distribution map is shown in Figure 2 .

[0129] 2. Larix olgensis whole-genome liquid chip

[0130] Based on the 61,680 SNP sites obtained by screening, Huazhi Biotechnology Co., Ltd. synthesized liquid-phase capture probes, and adopted the precise positioning sequencing genotyping technology (cGPS) based on liquid-phase capture of target-region genomic sequences to form a system for the whole-genome liquid-phase chip of Larix olgensis, and prepared the whole-genome liquid-phase chip of Larix olgensis (61,680 SNP liquid-phase chips).

[0131] Based on an optimized thermodynamic stability algorithm model, cGPS designs probes for genomic sequences of different target regions, uses the synthesized specific probes to perform liquid-phase hybridization capture and enrichment on multiple different target sequences located at different genomic positions, and then constructs a sequencing library and performs high-throughput sequencing on the captured and enriched target genomic sequences, so as to obtain the genotypes of all SNP / InDel sites within the target region, as Figure 3 shown.

[0132] Example 2

[0133] This example provides a method for using the whole-genome liquid-phase chip of Larix olgensis in Example 1 above to identify Larix olgensis, which specifically includes the following content:

[0134] 1. Extraction and detection of Larix olgensis gDNA

[0135] Select 12 Larix olgensis samples as verification samples for the whole-genome liquid-phase chip development system of Larix olgensis, collect fresh needle tissues of 12 Larix olgensis samples respectively, and extract gDNA from the tissues by the magnetic bead method. Analyze the integrity and purity of gDNA by 1% agarose gel electrophoresis method, and accurately quantify the concentration using Qubit.

[0136] 2. cGPS experimental procedure

[0137] (1) Take 200 ng of quantitatively qualified gDNA after quality inspection, use restriction enzyme reagents to digest the DNA into fragments with a size of 100 - 500 bp, and then add Taq enzyme for end repair;

[0138] (2) Use T4 ligase to ligate the adapter fragments to both ends of the DNA, and use fragment sorting magnetic beads to purify and amplify the ligation product to complete library construction;

[0139] (3) Place the library qualified by quality inspection, blocking reagent, RNA enzyme inhibitor Rnase Block, and 60K liquid-phase chip probes on a PCR instrument for hybridization reaction, and hybridize and incubate at 55 °C overnight (16 - 24 h);

[0140] (4) Capture the hybridization products using streptavidin, amplify and enrich the captured library, and perform PE150 sequencing using the BGI sequencing platform; (5) The raw data after high-throughput sequencing is processed through quality control filtering, etc. Use the fastp software to remove Reads contaminated with adapters and low-quality Reads. Align with the target genome using the BWA software, and then use the GATK software to analyze the variant sites of the sequencing results to obtain the genotype typing results of the target sites. The process schematic diagram is as shown in Figure 3 shown.

[0141] Example 3 Evaluation of the Genotyping Effect of the Whole Genome Liquid Chip of Larix olgensis

[0142] To verify the genotyping effect of the whole genome liquid chip of Larix olgensis, use the whole genome liquid chip of Larix olgensis obtained in Example 1 to perform genotyping detection on 15 Larix olgensis samples (including 3 replicate samples) (see Example 2 for the specific operation method).

[0143] Table 2 Locus Detection Rates of 15 Larix olgensis Samples

[0144]

[0145] The results are shown in Table 2 and Figure 4 as shown. It can be seen from Table 2 that the locus detection rates of the 15 samples are between 97.17% and 98.68%, and the average detection rate is 98.05%; it can be seen from Figure 4 that for the comparison of the genotype results of the 3 replicate samples, the consistency rates are between 98.00% and 98.92%, and the average consistency rate is 98.31%.

[0146] Example 4 Evaluation of the Genotyping Effect of the Whole Genome Liquid Chip of Larix olgensis

[0147] Use the whole genome liquid chip of Larix olgensis prepared in Example 1 to detect 673 different Larix olgensis (known sources) samples, extract the sample genotyping, use the Plink software, calculate the genetic distance matrix based on the IBS method and perform cluster analysis, and construct a phylogenetic tree diagram to judge the genetic relationship, evolutionary relationship and composition structure of different materials.

[0148] The results are as shown in Figure 5 shown. The results show that the whole genome liquid chip of Larix olgensis prepared by the method of the present invention can effectively distinguish Larix olgensis varieties from different sources.

[0149] The above has made a detailed description of the embodiments of the present invention. However, the present invention is not limited to the above embodiments, and various changes can be made without departing from the spirit of the present invention within the scope of knowledge possessed by those of ordinary skill in the art. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. A liquid-phase chip for the whole genome of Larix olgensis, characterized in that, The whole-genome liquid chip includes probes for detecting SNP molecular markers of Larix olgensis; The SNP molecular markers of Larix olgensis consist of 61,680 SNP molecular markers. The physical positions of the 61,680 SNP molecular markers are determined by sequence alignment based on the Japanese larch reference genome GCA_027924585.

1. The locus information is specifically shown in Table 1 in the specification; In Table 1, for the SNP molecular marker 0826.1:5022779G / -, "-" represents the insertion of GAAACCGAGTCGAATGAGCCGGAGAAAAGCAAAACCGAGTCGAATGAGCCGAAGAAAAGCA; In Table 1, when Alt is ".", it indicates that there are multiple possible mutations; the specific possible mutations are as follows: When ref is A, Alt is ".", indicating that the mutation can be T, G, C or N; When ref is T, Alt is "." indicating that the mutation can be A, G, C or N; When ref is G, Alt is "." indicating that the mutation can be T, A, C or N; When ref is C, Alt is "." indicating that the mutation can be T, A, G or N, where N represents deletion.

2. A kit, characterized in that, The kit contains probes for detecting the SNP molecular markers of Larix olgensis as described in claim 1.

3. Use of one of the whole-genome liquid chip of Larix olgensis described in claim 1 and the kit described in claim 2 in any of the following: (1) Use in genotyping detection of Larix olgensis; (2) Use in germplasm resource identification of Larix olgensis; (3) Use in genome-wide association analysis of Larix olgensis; (4) Use in cluster analysis and genetic relationship identification of Larix olgensis; (5) Use in genetic map and gene mapping of Larix olgensis; (6) Use in genetic diversity identification of Larix olgensis; (7) Use in molecular design breeding of Larix olgensis.

4. A breeding method for Larix olgensis, characterized in that, It includes the following steps: Detect the DNA of the Larix olgensis to be tested using one of the whole-genome liquid chip of Larix olgensis described in claim 1 and the kit described in claim 2, and select Larix olgensis for subsequent breeding.

Citation Information

Patent Citations

  • SNP marker related with lignin content of larix olgensis and applications thereof

    CN105936939A

  • Chili SNP (Single Nucleotide Polymorphism) molecular marker combination, SNP chip and application thereof

    CN117587159A