A molecular marker related to the early or late bolting of cabbage and its application

Abstract

The application discloses a molecular marker related to early and late bolting of cabbage and application thereof. The application is based on preserved early and late bolting materials, and difference sequence analysis is carried out according to genome resequencing results combined with phenotype identification results in many years, difference target segment function annotation analysis is carried out, and a molecular marker closely related to the bolting trait is screened out. The DNA of early and late bolting cabbage is subjected to PCR amplification, and the molecular marker is further verified to be closely related to the bolting trait by combining the bolting period phenotype in many years. The primer of the molecular marker is used to realize early and rapid molecular marker identification of late and early bolting cabbage at the cabbage seedling stage, and the breeding efficiency of cabbage bolting-resistant varieties is improved.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and particularly relates to a molecular marker related to the bolting time of cabbage and an application thereof. Background Art

[0002] Cabbage is one of the main vegetable crops widely grown in the world. It has a long history of cultivation and rich variety resources. At present, the annual planting area of ​​cabbage in my country is more than 400,000 hectares, accounting for 25% to 30% of the country's vegetable planting area. It is the main vegetable cultivated in spring, summer and autumn in Northeast, Northwest, North China and other regions, and is also cultivated on a large scale in the south.

[0003] Bolting and flowering are important agronomic traits in cabbage production. Premature bolting, which reduces yield and quality, is a major problem in spring cabbage production, resulting in significant production losses. Therefore, it is crucial to develop molecular markers that correlate with bolting timing in cabbage and apply them to screen and identify cabbage varieties with early bolting. Summary of the Invention

[0004] One of the objectives of the present invention is to provide an InDel molecular marker for use in identifying or screening the early or late bolting time of cabbage. The nucleotide sequence of the InDel molecular marker is TCAATCAACTAGTGGAGACAAAAACAAA, which is present in the non-coding region of chromosome 3 of the DNA genome of early-bolting cabbage, but not in the non-coding region of chromosome 3 of the DNA genome of late-bolting cabbage.

[0005] A second object of the present invention is to provide a primer pair Bb3 for use in identifying or screening the early or late bolting time of cabbage. The sequence of the primer pair Bb3 is as follows:

[0006] Bb3F: GTCAATCAACTAGTGGAGAC;

[0007] Bb3R: AGGTCGCTACTTTCTGCCAA.

[0008] A third object of the present invention is to provide a method for identifying early-bolting cabbage varieties or materials, comprising the following steps:

[0009] Step 1, extracting genomic DNA of the species or material to be identified;

[0010] Step 2: Using the DNA extracted in step 1 as a template, perform PCR amplification using primer pair Bb3. The sequence of primer pair Bb3 is as follows:

[0011] Bb3F:GTCAATCAACTAGTGGAGAC

[0012] Bb3R: AGGTCGCTACTTTCTGCCAA;

[0013] Step 3: Perform electrophoresis separation on the PCR amplification products of step 2 to obtain the banding pattern of each sample. If a 448 bp fragment is obtained, it indicates that the variety or material to be identified is early bolting.

[0014] Furthermore, the reaction system for PCR amplification in step 2 was 20 µL, which contained 1 µL of genomic DNA, 1 µL of upstream and downstream primers, and 10 µL of 2xEasyTaq PCR SuperMix for PAGE.

[0015] Furthermore, the reaction conditions for PCR amplification in step 2 are: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 50 s, 56°C for 50 s, and extension at 72°C for 60 s, for 35 cycles; and extension at 72°C for 10 min.

[0016] The present invention is based on preserved early and late bolting materials, performs differential sequence analysis based on genome resequencing results combined with multi-year phenotypic identification results, performs functional annotation analysis of differential target segments, screens out molecular markers closely related to the bolting trait, performs PCR amplification on DNA of early and late bolting cabbages, and combines the bolting period phenotypes of the cabbages for many consecutive years to further verify that the molecular marker is closely related to the bolting trait. Primers for the molecular marker are used to achieve early and rapid molecular marker identification of early and late bolting cabbages at the cabbage seedling stage, thereby improving the breeding efficiency of cabbage varieties with bolting resistance.

[0017] The molecular markers and primer pairs provided by this invention for identifying the early or late bolting of cabbage can be used to rapidly identify early bolting-tolerant cabbage breeding materials, overcoming the drawbacks of traditional methods, such as the long time required and high inaccuracy. They also facilitate the establishment of a molecular marker-assisted breeding system for bolting-tolerant cabbage. Therefore, this invention is of great significance both in cabbage vegetable breeding practice and in theoretical research on bolting resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 The statistical results of bolting time of early-bolting cabbage and late-bolting cabbage are shown in Figure 2, where the upper short line represents the maximum value, the lower short line represents the minimum value, the inner horizontal line represents the median, the inner box represents the mean value, and “*” represents the P value.

[0019] Figure 2 This is the alignment of the differential Indel nucleotide sequences between early and late bolting.

[0020] Figure 3Figure 2 is the agarose gel electrophoresis result of PCR amplification of primer pair Bb3 in different varieties of cabbage, where: M is DL2000 Marker, lanes 4, 5, 6, 8, 10, 11, 12, 14, 15, 16, 18, 20, 21, 22, 25, 27, 29, 30, 36, 37 are early-bolting varieties, and lanes 1, 2, 3, 7, 9, 13, 17, 19, 23, 24, 26, 28, 32, 33, 34, 37, 38, 39, 40 are late-bolting varieties. DETAILED DESCRIPTION

[0021] The preferred embodiments of the present invention will be described in detail below with reference to the examples. It should be understood that the following examples are provided for illustrative purposes only and are not intended to limit the scope of the present invention. Those skilled in the art may make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention.

[0022] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0023] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources. Example 1

[0024] Statistics of early-bolting and late-bolting cabbages

[0025] The bolting time of different cabbages was investigated in the field, and 32 early-bolting cabbages and 28 late-bolting cabbages were screened. The bolting time of early-bolting and late-bolting cabbages was counted for three consecutive years, and the results were as follows: in 2018, the average bolting time of early-bolting cabbage was 188.71±9.12 days, and the average bolting time of late-bolting cabbage was 199.25±8.71 days. The bolting time of late-bolting cabbage was about 11 days later than that of early-bolting cabbage; in 2019, the average bolting time of early-bolting cabbage was 193.31±8.15 days, and the average bolting time of late-bolting cabbage was 20 The bolting time of late-bolting cabbage was 8.22±6.92 days, and the bolting time of late-bolting cabbage was about 15 days later than that of early-bolting cabbage; in 2020, the average bolting time of early-bolting cabbage was 191.26±10.58 days, and the average bolting time of late-bolting cabbage was 208.05±9.75 days, and the bolting time of late-bolting cabbage was about 17 days later than that of early-bolting cabbage; the bolting time of late-bolting cabbage was significantly later than that of early-bolting cabbage (P<0.01).

[0026] According to the genome resequencing results of early- and late-bolting cabbage materials, the genome sequence differences of materials with different bolting characteristics were analyzed, and the differential sequences were functionally analyzed to screen target differential segments. Primer pairs were designed, and early- and late-bolting cabbage with a sample number greater than 25 were selected for PCR amplification, and statistically different segments in the genomes of early- and late-bolting cabbage were compared and screened. Further sequencing verification was performed to obtain the differential segment gene sequences of early- and late-bolting cabbage, and the nucleotide sequence information of the differential segments was obtained by combining the anchored segments with statistical differences. Based on the nucleotide sequence information of the differential segments obtained in the steps, primer pairs were designed to amplify and verify the cabbage genomic DNA. Combined with the bolting period phenotypic data of early- and late-bolting cabbage, a molecular marker was identified, and the sequence was: TCAATCAACTAGTGGAGACAAAAACAAA. The molecular marker is located at position 61,4018-61,4045 of the non-coding region of chromosome 3 of the genome, has a length of 28 bp, is absent in the non-coding region of the genome of late-bolting cabbage, and contains the molecular marker in the non-coding region of the genome of early-bolting cabbage. Example 2

[0027] This embodiment provides a method for identifying early bolting of cabbage, comprising the following steps:

[0028] Step 1: Extraction of genomic DNA from cabbage leaves

[0029] 0.1 g of young cabbage leaves were ground with liquid nitrogen, added with 500 µL of CTAB lysis buffer, and transferred to a 1.5 mL centrifuge tube. The tube was incubated in a 65°C water bath for 0.5–1 h, then cooled. An equal volume of chloroform / isoamyl alcohol mixture was added, gently shaken, and centrifuged at 12,000 rpm for 8–10 min. The supernatant was extracted once or twice with the chloroform / isoamyl alcohol mixture, pre-cooled isopropanol was added, and the tube was allowed to stand at 4°C for at least 3 h. Flocculent DNA was collected, washed with 70% ethanol, dried, and stored in TE buffer. The DNA was tested for purity and concentration, diluted to 50 ng / µL, and stored in a -20°C refrigerator until use.

[0030] The CTAB lysis buffer is composed of 2% CTAB, 2 mol / L NaCl2, 20 mmol / L EDTA, 100 mmol / L Tris-HCl, pH=8.0, and 0.2% β-mercaptoethanol by volume; the volume ratio of chloroform to isoamyl alcohol in the chloroform / isoamyl alcohol mixture is 24:1.

[0031] Step 2, amplification of primer pair Bb3 in the cabbage genome

[0032] PCR reaction system was 20 μL, containing 1 μL of genomic DNA template, 1 μL of upstream and downstream primers, 10 μL of 2xEasyTaq PCR SuperMix for PAGE.

[0033] The sequence of primer pair Bb3 is as follows:

[0034] Bb3F: GTCAATCAACTAGTGGAGAC;

[0035] Bb3R: AGGTCGCTACTTTCTGCCAA.

[0036] The PCR reaction conditions were as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 50 s, 56℃ for 50 s, 72℃ extension for 60 s, 35 cycles; 72℃ extension for 10 min, and then stored at 4℃.

[0037] Step 3, agarose gel electrophoresis detection

[0038] After the end of PCR amplification, 1.2% agarose gel electrophoresis was used, the electrophoresis buffer was 1×TAE buffer, 10 μL was loaded, 150 V electrophoresis for 20 min, and then observed and photographed in the gel imaging instrument.

[0039] The electrophoresis results are as follows: Figure 3 It can be seen that the early bolting varieties in lanes 4, 5, 6, 8, 10, 11, 12, 14, 15, 16, 18, 20, 21, 22, 25, 27, 29, 30, 36, 37 can all amplify a 448 bp fragment, and the late bolting varieties in lanes 1, 2, 3, 7, 9, 13, 17, 19, 23, 24, 26, 28, 32, 33, 34, 37, 38, 39, 40 do not have a 448 bp fragment.

[0040] From the above results, it can be seen that if the early bolting varieties or materials of Brassica oleracea are amplified by using the marker primer Bb3, and a 448 bp fragment can be amplified, it indicates that the Brassica oleracea has the early bolting trait.

Claims

1. Use of primer pair Bb3 in identifying or screening early or late bolting time of cabbage, characterized in that: The sequence of the primer pair Bb3 is as follows: Bb3F: GTCAATCAACTAGTGGAGAC; Bb3R: AGGTCGCTACTTTCTGCCAA.

2. A method for identifying early-bolting cabbage varieties or materials, characterized in that: The following steps are involved: Step 1, extracting genomic DNA of the species or material to be identified; Step 2: Using the DNA extracted in step 1 as a template, perform PCR amplification using primer pair Bb3. The sequence of primer pair Bb3 is as follows: Bb3F:GTCAATCAACTAGTGGAGAC Bb3R: AGGTCGCTACTTTCTGCCAA; Step 3: Perform electrophoresis separation on the PCR amplification products of step 2 to obtain the banding pattern of each sample. If a 448 bp fragment is obtained, it indicates that the variety or material to be identified is early bolting.

3. The method according to claim 2, wherein The PCR amplification reaction system in step 2 is 20 µL, which contains 1 µL of genomic DNA, 1 µL of upstream and downstream primers, and 10 µL of 2xEasyTaq PCR SuperMix for PAGE.

4. The method according to claim 2, wherein The reaction conditions for PCR amplification in step 2 were as follows: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 50 s, 56°C for 50 s, and extension at 72°C for 60 s, for 35 cycles; and extension at 72°C for 10 min.

Images