Substance for detecting or assisting in detecting wheat plant height and its application

Abstract

The present invention discloses a substance for detecting or assisting in detecting wheat plant height and its application. The problem to be solved by the present invention is how to quickly and accurately identify or assist in identifying wheat plant height. The application is the use of a substance for detecting the polymorphism or genotype of a SNP site in the wheat genome in identifying or assisting in identifying wheat plant height. The SNP site is located on wheat chromosome 7A. TaFT‑A1 The gene has a single nucleotide polymorphism (SNP) at position +314bp in its coding region, resulting in an amino acid change in the coding region, thus affecting the function of the TaFT-A1 protein. The nucleotide is either T or G and is located at position 366 of sequence 3 in the sequence listing. This marker has good reproducibility, is easy to detect, and is low-cost, showing promising application prospects in assisted selection and molecular design breeding for improving wheat plant height.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, in particular to fields related to substances for detecting or assisting in detecting wheat plant height and applications thereof. Background Art

[0002] Plant height is a key trait affecting wheat growth, development, and yield. In recent years, in-depth research into the regulatory mechanisms of wheat plant height has gradually revealed the key roles of various genes and hormonal signals in this process. These studies not only provide a theoretical basis for wheat breeding but also open up new avenues for improving crop stress resistance and yield.

[0003] In wheat, the number and length of internodes are directly related to the formation of the overall height of the plant. The important factors affecting plant height include Rht Genes and hormone signaling pathways. For example, by introducing gibberellin (GA)-insensitive dwarfing genes Rht- B1b and Rht-D1b , significantly reducing wheat plant height and enhancing lodging resistance, a key factor in the success of the Green Revolution (Peng et al., 1999). These dwarfing genes inhibit the gibberellin signaling pathway, reducing plant height and optimizing resource utilization.

[0004] Recent studies have found that GSK3 GSK3 plays a crucial role in regulating wheat plant height. It can phosphorylate the Rht-B1b protein, which regulates its function and, in turn, affects plant height (Dong et al., 2023). Furthermore, GSK3, along with TaARF12 and other genes, regulates the interactions between auxin, gibberellins, and other hormone signals, forming a complex regulatory network (Li et al., 2022).

[0005] In addition to the Rht gene, other genes such as DENSE AND ERECT PANICLE 1 ( TaDEP1 ) also plays an important role in plant height regulation. Through functional studies of these genes, scientists have found that the interactions between different genes can jointly affect the growth and development of wheat. In addition, recent studies have also found that Rht8 Related allelic variants (e.g. Rht8-2 and Rht8-3 ) can effectively reduce wheat plant height (Xiong et al., 2022), providing a new option for breeding.

[0006] In addition to genetic factors, plant hormones such as auxin and brassinosteroids also play an important role in regulating plant height. DWARF AND LOW‐TILLERING (DLT )and ORYZA SATIVA HOMEOBOX 15 ( OSH15 ) interact with the brassinosteroids to regulate internode elongation by coordinating brassinosteroid signaling and metabolism. This mechanism also applies to wheat, revealing the importance of hormones in regulating plant height (Niu et al., 2022).

[0007] In recent years, more research has focused on other genes that control wheat plant height, such as TaCRY1a Studies have found that its overexpression can reduce coleoptile growth and inhibit plant height by competitively inhibiting the interaction between GA-INSENSITIVE DWARF 1 (GID1) and DELLA (Yan et al., 2021).

[0008] Despite significant progress in wheat plant height regulation, the available dwarfing gene resources for wheat breeding remain relatively limited. Future advances in genomics and molecular biology technologies will hopefully identify more genes affecting plant height and understand their roles in complex genetic backgrounds. This will provide new insights and approaches for wheat breeding for lodging tolerance, stress resistance, and high yield. Summary of the Invention

[0009] The technical problem to be solved by the present invention is how to quickly and accurately identify and screen wheat plant height traits.

[0010] In order to solve the above problems, the present invention first provides an application of a substance for detecting the polymorphism or genotype of a SNP site in the wheat genome, wherein the SNP site is a site in the wheat genome, the nucleotide type of which is T or G, and is the 366th nucleotide of sequence 3 in the sequence list; the application is any of the following:

[0011] A1) Use of the substance in identifying or assisting in identifying wheat strains,

[0012] A2) Application of the substance in wheat breeding,

[0013] A3) Use of the substance in the preparation of a product for identifying or assisting in identifying wheat plant height,

[0014] A4) Use of the substance in preparing wheat breeding products.

[0015] The substance may be the following B1), B2) or B3):

[0016] B1) The substance is a primer composition for amplifying a wheat genomic DNA fragment including the SNP site,

[0017] B2) The substance is a PCR reagent containing the primer combination described in B1),

[0018] B3) The substance is a kit containing the primer composition described in B1) or the PCR reagent described in B2).

[0019] The SNP single nucleotide polymorphism site is a SNP in the wheat genome, which is the 366th nucleotide of SEQ ID No: 3 in the sequence list, which is T or G; TaFT-A1 In genes, TaFT-A1 Genes associated with wheat plant height.

[0020] The wheat plant height refers to the distance between the root neck and the top of the plant, where the top refers to the top of the main stem.

[0021] In the above applications, the primer composition may or may not be labeled with a label. A label refers to any atom or molecule that can be used to provide a detectable effect and that can be attached to a nucleic acid. Labels include, but are not limited to, dyes; radioactive labels such as 32P; binding moieties such as biotin; haptens such as digoxigenin (DIG); luminescent, phosphorescent, or fluorescent moieties; and fluorescent dyes, alone or in combination with moieties that can inhibit or shift the emission spectrum via fluorescence resonance energy transfer (FRET). The label can provide a signal detectable by fluorescence, radioactivity, colorimetry, gravimetry, X-ray diffraction or absorption, magnetism, enzymatic activity, and the like. The label can be a charged moiety (positive or negative) or, alternatively, charge-neutral. The label can comprise a nucleic acid sequence or a protein sequence, or a combination thereof, as long as the sequence comprising the label is detectable. In some embodiments, the nucleic acid is directly detected (e.g., by direct sequence read) without a label.

[0022] The present invention also provides a method for identifying or assisting in identifying wheat plant height, which comprises detecting the genotype of the above-mentioned SNP site in the wheat genome to be tested, and identifying or assisting in identifying the wheat plant height based on the genotype.

[0023] In the above-mentioned method for identifying or assisting in identifying wheat plant height, the genotype is TT or GG, the TT is the homozygous type when the SNP site is T, and the GG is the homozygous type when the SNP site is G. According to the genotype identification or assisting in identifying wheat plant height, the average plant height of the wheat to be tested with the genotype of TT is lower than that of the wheat to be tested with the genotype of GG.

[0024] The present invention also provides a method for wheat breeding, which includes detecting the genotype of the above-mentioned SNP site in the wheat genome, and selecting wheat with a genotype of TT or GG at the SNP site as a parent for breeding, wherein the TT is a homozygous type when the SNP site is T, and the GG is a homozygous type when the SNP site is G.

[0025] In the above-mentioned wheat breeding method, the wheat breeding index includes wheat plant height.

[0026] Furthermore, the purpose of wheat breeding includes cultivating wheat with low plant height. The low plant height of wheat refers to wheat with an average plant height lower than that of its parents.

[0027] In the above-mentioned method for identifying or assisting in identifying wheat plant height and the above-mentioned method for wheat breeding, the wheat may be an inbred line or a pure line.

[0028] The present invention also provides application of the method in wheat breeding.

[0029] The present invention also provides a product for detecting the polymorphism or genotype of a SNP site in the wheat genome, wherein the SNP site is the above-mentioned SNP site, and the product contains the substance described above. The product can be any of the following:

[0030] C1) Products for detecting or assisting in detecting single nucleotide polymorphisms or genotypes related to wheat plant height,

[0031] C2) Products that identify or assist in identifying wheat plant height,

[0032] C3) Products used in wheat breeding.

[0033] Specifically, the product may be as follows: D1), D2) or D3):

[0034] D1) The product is a primer combination for amplifying a wheat genomic DNA fragment including the SNP site,

[0035] D2) The product is a PCR reagent containing the primer combination described in D1),

[0036] D3) The product is a kit containing the primer composition described in D1) or the PCR reagent described in D2).

[0037] In the above, the primer composition may be as follows (E1), (E2) or (E3):

[0038] E1) The primer combination is a first-round PCR primer,

[0039] E2) The primer combination is a second-round PCR primer,

[0040] E3) the primer combination comprises a first-round PCR primer and a second-round PCR primer;

[0041] The first round of PCR primers consists of a forward primer FT-A1-F1 and a reverse primer FT-A1-R1. The forward primer FT-A1-F1 is a single-stranded DNA molecule of sequence 1 in the sequence list, and the reverse primer FT-A1-R1 is a single-stranded DNA molecule of sequence 2 in the sequence list. The specific sequences are:

[0042] FT-A1-F1: 5'-CGATGCTTCTGTTGACATGTTTT-3';

[0043] FT-A1-R1: 5'-ACGTGGGCCATGGGTAGG-3'.

[0044] The second-round PCR primers consist of a forward primer FT-A1-F2 and a reverse primer FT-A1-R2. The forward primer FT-A1-F2 is a single-stranded DNA molecule of sequence 4 in the sequence list, and the reverse primer FT-A1-R2 is a single-stranded DNA molecule of sequence 5 in the sequence list. The specific sequences are:

[0045] FT-A1-F2: 5'-GGTGCCTCGTTCGGGCAGGAAGGGA-3';

[0046] FT-A1-R2: 5'-CGAAGTCCTGGTGTTGA-3'.

[0047] In the above applications and methods, the substance for detecting SNP polymorphism or genotype can be a nucleotide species for determining the SNP site in the wheat genome by at least one of the following methods: DNA sequencing, restriction fragment length polymorphism, single-strand conformation polymorphism, denaturing high-performance liquid chromatography, and SNP chip. Among them, SNP chips include chips based on nucleic acid hybridization reactions, chips based on single-base extension reactions, chips based on allele-specific primer extension reactions, chips based on "one-step" reactions, chips based on primer ligation reactions, chips based on restriction endonuclease reactions, chips based on protein-DNA binding reactions, and chips based on fluorescent molecule DNA binding reactions.

[0048] The present invention also provides a DNA molecule, the nucleotide sequence of which is sequence 3 in the sequence list.

[0049] The application of the above DNA molecules is also within the scope of protection of the present invention, and the application may be any of the following:

[0050] F1) Use of the DNA molecule in identifying or assisting in identifying wheat plant height,

[0051] F2) application of the DNA molecule in wheat breeding,

[0052] F3) Use of the DNA molecule in preparing a product for identifying or assisting in identifying wheat plant height,

[0053] F4) Use of the DNA molecule in preparing wheat breeding products.

[0054] The present invention is based on population genetics and association analysis, and is obtained by cloning Chinese Spring cDNA. TaFT-A1 By comparing different wheat materials TaFT-A1 Sequence polymorphism analysis of the coding region revealed that TaFT-A1 A single nucleotide polymorphism (SNP) site (T / G) exists at the +314 bp position downstream of the ATG in the coding region, resulting in amino acid changes in the coding region, thus affecting the function of the TaFT-A1 protein. Using this SNP site, a dCAPS marker was developed to generate two alleles, and 348 wheat accessions were simultaneously scanned. Association analysis was performed between genotypes and multi-year, multi-point plant height data, and it was found that TaFT-A1 The _SNP+314-dCAPS marker was significantly correlated with wheat plant height, indicating that this marker can assist in molecular design breeding of wheat plant height. BRIEF DESCRIPTION OF THE DRAWINGS

[0055] Figure 1 for TaFT-A1 The mutation site and two alleles in the coding region. The numbers indicate the position of the mutation in the gene coding region (bp), and the red base represents the T / G change at that position.

[0056] Figure 2 for TaFT-A1 _SNP+314 marker dCAPS detection.

[0057] Figure 3 for TaFT-A1 _SNP+314 marker association analysis. DETAILED DESCRIPTION

[0058] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0059] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0060] The data in the following examples were processed using SPSS 25 statistical software. The experimental results were expressed as mean ± standard deviation and tested using one-way ANOVA. P <0.001 (***) indicates a very significant difference.

[0061] The wheat varieties in the following examples are commercial varieties, which can be found on the China Crop Germplasm Information Network (http: / / www.cgris.net / ).

[0062] Example 1 TaFT-A The role of cDNA SNP sites in identifying wheat plant height

[0063] 1. ​ Discovery and genotyping

[0064] 1.1 ​ SNP discovery and primer design in cDNA

[0065] Using the wheat Chinese spring reference genome to obtain wheat ​ Sequence information shows that the gene is located on chromosome 7A of wheat. ​ Coding region variation analysis revealed ​ There is a single nucleotide polymorphism (SNP) site at the +314bp position in the coding region, which leads to amino acid changes in the coding region, thereby affecting the function of TaFT-A1 protein. This site has a G / T polymorphism. ​ _SNP+314 is at position 366 of sequence 3, and its nucleotide type is G or T. ​ _SNP+314 dCAPS marker. This marker was used to scan the natural wheat population. Agarose gel electrophoresis showed that the population can be basically divided into two types. ​ The PCR product of the material cannot be cut and is 151 bp; ​ The material was cut to form a lower band of 115bp. The association analysis combined with the genotype data and plant height phenotypic data showed that ​ _SNP+314 allele variation is significantly associated with wheat plant height, carrying ​ ( G ) The average plant height of the materials was significantly higher than that of the ​ The average plant height of the material. ​ Materials ​ _SNP+314 is a homozygous type of G, which can also be named as genotype GG; ​ Materials ​ _SNP+314 is the homozygous type of T, which can also be named as genotype TT.

[0066] 1.2 ​ Genotyping of SNP+314

[0067] Specific dCAPS primers were designed using the dCAPS Finder 2.0 website based on the variation of the site.

[0068] 1) One round of PCR amplification:

[0069] Extract genomic DNA from wheat leaves and dissolve it in 200 μL of TE. Check DNA quality using 1% agarose gel electrophoresis. The extracted DNA must be free of obvious impurities, exhibit clear bands, and be undegraded for use as template DNA for amplification.

[0070] The first round of PCR primers included forward primer FT-A1-F1 and reverse primer FT-A1-R1.

[0071] FT-A1-F1: 5'-CGATGCTTCTGTTGACATGTTTT-3' (SEQ ID NO: 1);

[0072] FT-A1-R1: 5'-ACGTGGGCCATGGGTAGG-3' (SEQ ID NO: 2).

[0073] The experiment used 2×Mix enzyme. After measuring the DNA concentration, the template DNA concentration was uniformly adjusted to 50 ng / μL. The PCR amplification system was as follows:

[0074]

[0075] The PCR amplification program was as follows: denaturation at 95°C for 3 min; 30 cycles of denaturation at 95°C for 30 sec, annealing at 58°C for 30 sec, and extension at 72°C (1 kb·min-1); extension at 72°C for 10 min, and termination of the reaction at 12°C.

[0076] A 601bp PCR product was obtained, which is sequence 3 (SEQ ID NO: 3) in the sequence list. The 366th base of sequence 3 is the mutation site. ​ _SNP+314, as follows:

[0077] Sequence 3 (SEQ ID NO: 3):

[0078] 5'--3'.

[0079] 2) Second round of PCR amplification

[0080] During the second round of PCR, a single base G mutation was introduced 3 bp upstream of the SNP site using dCAPS-labeled primers. The dCAPS-labeled primers (second round PCR primers) contain specific forward and reverse primers FT-A1-F2 and FT-A1-R2. The guanine base G at position 23 of FT-A1-F2 is the introduced mismatch site and forms an endonuclease ​ The recognition site of Ⅰ is "5'-GGATG-3'".

[0081] FT-A1-F2: 5'-GGTGCCTCGTTCGGGCAGGAAGGGA-3' (SEQ ID NO: 4);

[0082] FT-A1-R2: 5'-CGAAGTCCCTGGGTGTTGA-3' (SEQ ID NO: 5).

[0083] The first-round PCR product was diluted 200-fold, and the primers were FT-A1-F2 and FT-A1-R2. Then, a second-round PCR amplification was performed using 2× Mix. The system was as follows:

[0084]

[0085] The PCR amplification program was as follows: denaturation at 95°C for 3 min; 35 cycles of denaturation at 95°C for 30 sec, annealing at 56°C for 30 sec, and extension at 72°C for 10 sec; extension at 72°C for 10 min, and termination of the reaction at 12°C.

[0086] The second-round PCR amplification products were recovered by 4% agarose gel electrophoresis and sequenced to obtain ​ The material is sequence 6 (SEQ ID NO: 6, 151 bp) and ​ The material is sequence 7 (SEQ ID NO: 7, 151 bp), specifically as follows:

[0087] ​ (SEQ ID NO: 6):

[0088] 5'-GGTGCCTCGTTCGGGCAGGAAGGGAGGTGCTATGAGAGCCCTCGTCCGACCATGGGGATCCACCGCTTCGTGCTCGTGCTCTTCCAGCAGCTCGGCCGGCAGACGGTGTACGCCCCCGGGTGGCGCCAGAACTTCAACACCAGGGACTTCG-3';

[0089] ​ (SEQ ID NO: 7):

[0090] 5'-GGTGCCTCGTTCGGGCAGGAAGGGATGTGCTATGAGAGCCCTCGTCCGACCATGGGGATCCACCGCTTCGTGCTCGTGCTCTTCCAGCAGCTCGGCCGGCAGACGGTGTACGCCCCCGGGTGGCGCCAGAACTTCAACACCAGGGACTTCG-3'.

[0091] Note: The 23rd position of sequence 6 and sequence 7 is the introduced mismatch base, the 26th position is the mutation site, and the 23rd to 27th positions are the endonuclease ​ Ⅰ recognition site.

[0092] 3) Enzyme digestion reaction

[0093] use ​Ⅰ Single enzyme digestion of the second-round PCR amplification product, the reaction system is as follows:

[0094]

[0095] Reaction procedure: 37℃ constant temperature water bath, enzyme digestion for 4 h.

[0096] 4) Agarose gel electrophoresis ​ Genotyping of SNP+314

[0097] The enzyme digestion products were subjected to electrophoresis on 4% agarose gel, and then photographed and the genotype of the material was determined based on the band type. The electrophoresis results showed that the second round PCR amplification products were digested by endonuclease ​ The genotype of the material cut by Ⅰ is TT (also known as ​ ), the second-round PCR amplification products cannot be ​ The genotype of the material cut by Ⅰ is GG (also known as ​ (G) ). ​ The genotypes of 4 wheat varieties among the 348 wheat varieties in step 2 are ​ The genotypes of the four samples were ​ (T) The electrophoresis results of the material, carrying ​ The PCR product of the material cannot be cut and is 151 bp; ​ (T) The material was cut to form a lower band of 115 bp, with 100 bp and 200 bp on the left as markers.

[0098] 2. ​ Functional validation of SNP+314

[0099] 348 wheat materials were used for ​ These materials were planted in Luoyang, Henan in 2002 and 2005, and in Shunyi, Beijing in 2005 and 2010.

[0100] A completely randomized block design was used with three replicates, 4 rows, 2 m long and 0.25 m wide. 40 seeds were evenly sown in each row. After the wheat plants matured, their heights were counted. The 348 wheat samples were analyzed according to the method in 1.2. ​ ​ Genotyping of .

[0101] The genotyping data were associated with plant height (PH) data from multiple years (Luoyang, Henan in 2002, Luoyang, Henan in 2005 and Shunyi, Beijing in 2010). ​ The average plant height of the materials was significantly higher than that of the ​The average plant height of the materials ( ​ The above results show the effectiveness of this marker and it can be used as a functional marker for wheat plant height screening.

[0102] 2002LY means planted in Luoyang, Henan in 2002; 2005LY means planted in Luoyang, Henan in 2005; and 2010SY means planted in Shunyi, Beijing in 2010. Table 1 shows some wheat genotypes and average plant heights planted in Luoyang, Henan in 2005.

[0103] Table 1 Partial genotype and plant height information of 348 wheat accessions

[0104]

[0105]

[0106] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that further improvements can be made to the present invention. In short, according to the principles of the present invention, this application is intended to include any changes, uses or improvements to the present invention, including changes that depart from the disclosed scope in this application and are made using conventional techniques known in the art.

[0107] This application is funded by the National Key Research and Development Program of Agricultural Biobreeding (2022ZD04017).

Claims

1. Application of a substance for detecting the genotype of a SNP site in a wheat genome, characterized by: The SNP site is a site in the wheat genome, which is the 366th nucleotide of sequence 3 in the sequence list, and its base is T or G; the application is any of the following: A1) Application of the substance in assisting identification of wheat strains, A2) Use of the substance in wheat breeding, wherein the breeding objective is to cultivate wheat with low plant height, wherein the low plant height refers to wheat with an average plant height lower than that of the parent, A3) Use of the substance in the preparation of a product for assisting in identifying wheat plant height, A4) Use of the substance in preparing a product for wheat breeding, wherein the breeding objective is to cultivate wheat with low plant height, wherein the low plant height refers to wheat with an average plant height lower than that of the parent.

2. The use according to claim 1, characterized in that: The substance is the following B1), B2) or B3): B1) The substance is a primer composition for amplifying a wheat genomic DNA fragment including the SNP site, B2) The substance is a PCR reagent containing the primer combination described in B1), B3) The substance is a kit containing the primer composition described in B1) or the PCR reagent described in B2).

3. A method for assisting in identifying wheat plant height, characterized in that: The method comprises detecting the genotype of a SNP site in the wheat genome to be tested, and assisting in identifying the wheat plant height according to the genotype, wherein the SNP site is the SNP site described in claim 1.

4. Application of the method according to claim 3 in wheat breeding, characterized in that: The breeding purpose is to cultivate wheat with low plant height, and the low plant height of wheat refers to the average plant height of wheat being lower than that of the parent.

5. The use according to claim 2, characterized in that: The primer composition is as follows: E1), E2) or E3): E1) The primer combination is a first-round PCR primer, E2) The primer combination is a second-round PCR primer, E3) the primer combination comprises a first-round PCR primer and a second-round PCR primer; The first round of PCR primers consists of a forward primer FT-A1-F1 and a reverse primer FT-A1-R1, wherein the forward primer FT-A1-F1 is a single-stranded DNA molecule of sequence 1 in the sequence list, and the reverse primer FT-A1-R1 is a single-stranded DNA molecule of sequence 2 in the sequence list; The second-round PCR primers consist of a forward primer FT-A1-F2 and a reverse primer FT-A1-R2. The forward primer FT-A1-F2 is a single-stranded DNA molecule with sequence 4 in the sequence list, and the reverse primer FT-A1-R2 is a single-stranded DNA molecule with sequence 5 in the sequence list.

Images