A molecular marker linked to luffa fruit browning tolerance and application thereof
By locating molecular markers on chromosome 3 of the loofah genome and using PCR amplification technology to identify genotypes, the problem of easy browning of loofah fruits was solved, enabling rapid screening of browning-resistant plants and improving breeding efficiency and accuracy.
Patent Information
- Application Number
- CN202411684683.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2024-05-15
- Filing Date
- 2024-11-22
- Publication Date
- 2025-11-21
- Estimated Expiration
- 2044-11-22
AI Technical Summary
The fruit of the loofah is prone to browning during transportation, processing, steaming, and stir-frying, which affects its nutritional value and marketability. Existing technologies make it difficult to quickly screen for browning-resistant traits, resulting in a long breeding cycle and susceptibility to environmental influences.
A molecular marker located on chromosome 3 of the loofah genome is provided. The genotype of loofah fruit can be identified by primer PCR amplification technology, and browning resistant plants can be screened out. Molecular marker-assisted selection breeding can be used to accelerate the breeding process.
It enables rapid early screening of browning-resistant plants, reduces the scale of planting and the workload of later identification, and improves selection efficiency and accuracy. It is applicable to the breeding and research of various loofah varieties.
Smart Images

Figure CN119265351B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of plant breeding, in particular to a molecular marker linked to the fruit browning resistance of Luffa aegyptiaca and application thereof. BACKGROUND
[0002] Most ordinary meat loofahs are prone to browning of the peel, pulp and soup during transportation, processing and steaming and frying, which not only affects the nutritional value and edible value, but also seriously affects its commodity nature. Since the browning of loofah needs to be measured by steaming and cooking, which is time-consuming and laborious, it is not conducive to field selection of traits, and the use of molecular markers can effectively improve the selection efficiency of browning resistance traits.
[0003] Luffa (Luffa, 2n = 2x = 26) is an annual climbing herbaceous plant of the Cucurbitaceae family (Cucurbitaceae) and is widely cultivated in China, mainly including ordinary loofah
Luffa cylindrica (L.) Roem.
Luffa acutangula (L.) Roxb.
[0004] CONTENT
[0005] The present application is carried out in view of the above-mentioned problems, and aims to provide a molecular marker; the molecular marker is used for screening the browning traits of the fruit of Luffa.
[0006] Specifically, the present application provides, in a first aspect, the application of a molecular marker in the following aspects,
[0007] (I) predicting, screening and / or identifying the browning of the fruit of Luffa;
[0008] and / or, (II) improving Luffa;
[0009] The molecular marker is located at the 43044275th base of chromosome 3 of the Luffa genome;
[0010] The improvement includes accelerating the selection of fruit browning-resistant plants in the offspring of Luffa through molecular marker-assisted selection breeding.
[0011] The present application provides, in a second aspect, a primer set, which comprises:
[0012] (I) a first forward primer set:
[0013] The first forward primer set comprises a nucleotide sequence as shown in SEQ ID NO. 1 and a linker sequence;
[0014] SEQ ID NO. 1: TTTTTGGCAAATAAAAATTTTCTCAGAAC.
[0015] and / or, (II) a second forward primer group:
[0016] the first forward primer group comprises a nucleotide sequence as shown in SEQ ID NO. 2 and a linker sequence;
[0017] SEQ ID NO. 2:
[0018] TTTTTGGCAAATAAAAATTTTCTCAGAAT.
[0019] and / or, (III) a reverse primer group,
[0020] the reverse primer group has a nucleotide sequence as shown in SEQ ID NO. 3;
[0021] SEQ ID NO. 3:
[0022] TGTGGTACTGCTGAAAATCAGGTA.
[0023] and / or, (IV) a nucleotide sequence encoding the same protein as the nucleotide sequence shown in any one of (I) to (III), but different from the nucleotide sequence shown in any one of (I) to (III) due to the degeneracy of the genetic code;
[0024] and / or, (V) a nucleotide sequence obtained by substitution, deletion or addition of one or more nucleotides to the nucleotide sequence shown in any one of (I) to (IV), and a nucleotide sequence functionally identical or similar to the nucleotide sequence shown in any one of (I) to (IV);
[0025] and / or, (VI) a nucleotide sequence having at least 90% sequence homology with the nucleotide sequence shown in any one of (I) to (V),
[0026] and / or, the linker sequence comprises a nucleotide sequence as shown in SEQ ID NO. 4 or SEQ ID NO. 5.
[0027] SEQ ID NO. 4:
[0028] GAAGGTGACCAAGTTCATGC.
[0029] SEQ ID NO. 5:
[0030] GAAGGTCGGAGTCAACGGAT.
[0031] The third aspect of the present application provides application of the primer group as described in the second aspect in the following aspects:
[0032] (I) predicting, screening and / or identifying the fruit browning of Lagenaria siceraria;
[0033] and / or, (II) improving Lagenaria siceraria;
[0034] and / or, (III) a kit for predicting, screening and / or identifying the fruit browning of Lagenaria siceraria;
[0035] The improvement comprises accelerating the selection of fruit browning-resistant plants in the offspring of Lagenaria siceraria through marker-assisted selection breeding.
[0036] The fourth aspect of the present application provides a kit comprising the primer set according to the second aspect.
[0037] The fifth aspect of the present application provides the use of the kit according to the fourth aspect in the following aspects:
[0038] (I) predicting, screening and / or identifying the fruit browning of Lagenaria siceraria;
[0039] and / or, (II) improving Lagenaria siceraria;
[0040] The improvement comprises accelerating the selection of fruit browning-resistant plants in the offspring of Lagenaria siceraria through marker-assisted selection breeding.
[0041] The sixth aspect of the present application provides a screening method for the fruit browning of Lagenaria siceraria, comprising the following steps: extracting the genomic DNA of Lagenaria siceraria, identifying the genotype of Lagenaria siceraria using the primer set according to the second aspect and / or the kit according to the fourth aspect, and screening the browning-resistant Lagenaria siceraria.
[0042] Optionally, the standard for screening the browning-resistant Lagenaria siceraria according to the genotype is as follows:
[0043] (I) If the base at position 43044275 of chromosome 3 of the genome of the Lagenaria siceraria is CC, the Lagenaria siceraria has higher browning resistance than when the site is TT, that is, the proportion of browning-resistant fruit of the CC plant is significantly higher than that of the TT plant;
[0044] (II) If the base at position 43044275 of chromosome 3 of the genome of the Lagenaria siceraria is CT, the Lagenaria siceraria has higher browning resistance than when the site is TT, that is, the proportion of browning-resistant fruit of the CT plant is significantly higher than that of the TT plant.
[0045] The seventh aspect of the present application provides a method for breeding Lagenaria siceraria, comprising the following steps: extracting the genomic DNA of Lagenaria siceraria, PCR amplifying using the primer set according to the second aspect and / or the kit according to the fourth aspect, and obtaining the corresponding variety according to the fluorescence signal of the PCR product.
[0046] Optionally, the standard for evaluating the resistance to browning of the lagenaria leucantha according to the fluorescence signal is as follows:
[0047] (I) If only the fluorescence signal corresponding to the first primer group is detected, when the base at position 43044275 of chromosome 3 of the lagenaria leucantha genome is CC, the lagenaria leucantha has higher resistance to browning than when the site is TT, that is, the proportion of CC type plants resistant to browning fruit is significantly higher than that of TT type plants;
[0048] (II) If the fluorescence signals corresponding to the first primer group and the second primer group are detected at the same time, when the base at position 43044275 of chromosome 3 of the lagenaria leucantha genome is CT, the lagenaria leucantha has higher resistance to browning than when the site is TT, that is, the proportion of CT type plants resistant to browning fruit is significantly higher than that of TT type plants.
[0049] Optionally, the reaction procedure of the PCR amplification comprises:
[0050] (I) 94-95℃ pre-denaturation for 14-15min, 94-95℃ denaturation for 20-30s, 65-56℃ annealing and extension for 60-70s, 10-15 cycles, and each cycle is reduced by 0.6-0.8℃;
[0051] and / or (II) 94-95℃ denaturation for 20-30s, 55-57℃ annealing and extension for 60-70s, 26-30 cycles.
[0052] The present application has at least the following beneficial effects:
[0053] The molecular marker of the present application is directly used for identification of lagenaria leucantha browning and corresponding genotypes, and then assisted breeding is carried out by relying on the molecular marker, which can effectively solve the problems of long breeding cycle and being easily affected by the environment. By using the molecular marker early, satisfactory plants can be quickly screened, the planting scale is effectively reduced, and the workload of later identification is reduced. The selection efficiency and accuracy are improved. It can be used for identification of various lagenaria leucantha, and has great significance for studying the molecular mechanism of lagenaria leucantha fruit. Therefore, the present application has important significance in lagenaria leucantha fruit browning breeding practice and research. BRIEF DESCRIPTION OF DRAWINGS
[0054] In order to more clearly illustrate the technical solutions in the embodiments or the prior art, the drawings needed in the following embodiment or prior art description will be briefly introduced. Obviously, the drawings in the following description are only some embodiments of the drawings, and other drawings can be obtained according to the structures shown in the drawings without creative labor for those skilled in the art.
[0055] Figure 1 Phenotype map of two parents for BSA-seq population: S273 (A, B), S370 (C, D).
[0056] Figure 2 BSA mapping results for S273 and S370.
[0057] Figure 3 Brown gene mutation genetic map of the present application.
[0058] Figure 4 LOD map of the gene of the present application.
[0059] Figure 5 Part of the results of genotyping of Brow275 molecular marker of the present application in the backbone of the brown parent ‘S273’ and the brown-resistant parent ‘S370’ and the constructed F2 population of luffa;
[0060] A indicates that the PCR product is the fluorescence signal corresponding to the forward primer Brow275-F, and is a non-brown homozygous single plant;
[0061] B indicates that the PCR product has two fluorescence signals of primers Brow275-F / R, and is a non-brown heterozygous single plant;
[0062] C indicates that the PCR product is the fluorescence signal corresponding to the forward primer Brow275-R, and is a brown homozygous single plant.
[0063] The purposes, functional features and advantages of the present drawings will be further described with reference to the drawings in conjunction with the embodiments. DETAILED DESCRIPTION
[0064] Hereinafter, specific embodiments of the reference electrode, lithium ion battery and the preparation method and application thereof of the present application are specifically disclosed with appropriate reference to the drawings. However, there will be cases where unnecessary detailed description is omitted. For example, there will be cases where detailed description of matters that are well known, repeated description of substantially the same structure are omitted. This is to avoid the following description from becoming unnecessarily lengthy and to facilitate understanding by those skilled in the art. In addition, the drawings and the following description are provided so that those skilled in the art can fully understand the present application, and are not intended to limit the subject matter recited in the claims.
[0065] The "range" disclosed in this application is defined by a lower limit and an upper limit. A given range is defined by selecting a lower limit and an upper limit, which define the boundaries of a particular range. Ranges defined in this way can include or exclude endpoints and can be arbitrarily combined; that is, any lower limit can be combined with any upper limit to form a range. For example, if ranges of 60-120 and 80-110 are listed for a specific parameter, it is expected that ranges of 60-110 and 80-120 are also included. Furthermore, if minimum range values of 1 and 2 are listed, and if maximum range values of 3, 4, and 5 are listed, then the following ranges are all expected: 1-3, 1-4, 1-5, 2-3, 2-4, and 2-5. In this application, unless otherwise stated, the numerical range "ab" represents a shortened representation of any combination of real numbers between a and b, where a and b are real numbers. For example, the numerical range "0-5" indicates that all real numbers between "0-5" have been listed in this article; "0-5" is simply a shortened representation of these numerical combinations. Furthermore, when a parameter is stated as an integer ≥2, it is equivalent to disclosing that the parameter is, for example, an integer such as 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, etc.
[0066] Unless otherwise specified, all embodiments and optional embodiments of this application can be combined to form new technical solutions.
[0067] Unless otherwise specified, all technical features and optional technical features of this application may be combined to form new technical solutions.
[0068] Unless otherwise specified, all steps in this application may be performed sequentially or randomly, preferably sequentially. For example, the method includes steps (a) and (b), indicating that the method may include steps (a) and (b) performed sequentially, or it may include steps (b) and (a) performed sequentially. For example, the mention that the method may also include step (c) indicates that step (c) may be added to the method in any order. For example, the method may include steps (a), (b), and (c), or it may include steps (a), (c), and (b), or it may include steps (c), (a), and (b), etc.
[0069] Unless otherwise specified, the terms "comprising" and "including" as used in this application can be open-ended or closed-ended. For example, "comprising" and "including" can mean that other components not listed may also be included, or that only the listed components may be included.
[0070] The term "or" is inclusive in this application, unless otherwise indicated. So, for example, a phrase A or B means A, B, or both A and B. More specifically, any of the following satisfy the condition A or B: A is true (or present) and B is false (or not present); A is false (or not present) and B is true (or present); or both A and B are true (or present).
[0071] Before describing the present application in detail, it is to be understood that the application is not limited in its application to the specific details thereof as, of course, many embodiments can be made without departing from the scope of the present application. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting. As used in this specification and the appended claims, the singular forms "a," "an" and "the" include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to "a plant," "the plant," or "one plant" also includes a plurality of plants; and reference to "a nucleic acid" is taken to optionally mean a plurality of copies of the nucleic acid molecule; similarly, reference to "a probe" optionally (and typically) encompasses a plurality of similar or identical probe molecules.
[0072] Unless otherwise indicated, nucleic acids are written left to right in 5' to 3' orientation. Numerical ranges recited within the specification are inclusive of the numbers within the range and include each integer or non-integer fraction of the range limits. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice of the present application, the preferred methods and materials are described herein. In describing and claiming the present application, the following terminology will be used in accordance with the definitions set out below.
[0073] Certain definitions are provided below. In order to provide a clear and consistent understanding of the specification and claims, including the scope of the disclosure to be given to such terms, the following definitions are provided:
[0074] "Agronomic," "agronomic trait," and "agronomic performance" refer to a trait (and the underlying genetic factors) of a given plant variety that contributes to yield over the course of a growing season. Individual agronomic traits include emergence vigor, nutrient use efficiency, stress tolerance, disease resistance or tolerance, insect resistance or tolerance, herbicide resistance, branching, flowering, seed set, seed size, seed density, lodging resistance, thresh rate, fruit browning, and the like.
[0075] The term "allele" refers to any one of one or more alternative forms of a gene sequence. For example, in a diploid cell or organism, two alleles of a given sequence typically occupy corresponding loci on a pair of homologous chromosomes. With respect to a SNP marker, an allele refers to the particular nucleotide base at the SNP locus present in the individual plant.
[0076] An allele is "associated" with a trait when the allele is a DNA sequence or portion of or linked to an allele that affects the expression of the trait. The presence of the allele is an indication of how the trait will be expressed.
[0077] The term "amplification" in the context of nucleic acid amplification is any process by which additional copies of a selected nucleic acid (or transcribed therefrom) are thereby produced. Typical amplification methods include various polymerase-based replication methods, including polymerase chain reaction (PCR), ligase-mediated methods such as ligase chain reaction (LCR), and RNA polymerase-based amplification (e.g., transcription) methods. An "amplicon" is an amplified nucleic acid, e.g., a nucleic acid produced by amplification of a template nucleic acid by any available amplification method (e.g., PCR, LCR, transcription, etc.).
[0078] The term "chromosomal segment" refers to a contiguous linear segment of genomic DNA that is present on a single chromosome in a plant.
[0079] The term "complement" refers to a nucleotide sequence that is complementary to a given nucleotide sequence, i.e., the sequences are associated by Watson-Crick base pairing rules.
[0080] "Cultivar" and "variety" are used synonymously to refer to a population of plants within a species (e.g., Luffa cylindrica) that share certain genetic traits that distinguish them from other possible varieties within that species.
[0081] An "elite line" is an agronomically elite line that results from many rounds of breeding and selection for superior agronomic performance. Many elite lines are available and are known to those skilled in the art of Luffa cylindrica breeding.
[0082] An "elite population" refers to a mixed population of elite individuals or lines that can be used to represent the state of the art in agronomically elite genotypes of a given crop species, such as Luffa cylindrica.
[0083] A "favorable allele" is an allele at a particular locus that confers or contributes to an agronomically desirable phenotype (e.g., a resistance to browning trait), as well as allows for the identification of plants having that agronomically desirable phenotype. A favorable allele of a marker is a marker allele that segregates with the favorable phenotype.
[0084] A "gene map" is a description of the genetic linkage relationships between loci on one or more chromosomes (or linkage groups) within a given species, usually presented in the form of a diagram or table. For each gene map, the distance between loci is measured by how often their alleles occur together in a population (their recombination frequency). Alleles can be detected using DNA or protein markers, or observable phenotypes. A gene map is a product of the mapping population, the type of markers used, and the likelihood of polymorphism for each marker between different populations. The genetic distance between loci can be different from one map to another. However, using common markers, information can be related from one map to another. One of ordinary skill in the art can use the location of common markers to identify the location of markers and other loci of interest on various gene maps. The order of loci should be invariant between maps, however, there are often small variations in marker order due to, for example, detection of alternative repeat loci for a marker in different populations, differences in statistical methods used to order markers, new mutations, or experimental error.
[0085] "Genetic recombination frequency" is the frequency of exchange events (recombination) between two loci. Recombination frequency can be observed by tracking the segregation of markers and / or traits after meiosis.
[0086] "Genome" refers to the complete set of DNA or genes carried by a chromosome or set of chromosomes.
[0087] "Genotype" refers to the genetic makeup of a cell or organism.
[0088] "Genetic stock" refers to the genetic material that constitutes the physical basis of the genetic qualities of an organism. As used herein, genetic stock includes seeds and living tissue from which new plants can grow; or other plant parts, such as leaves, stems, pollen, or cells, that can be cultured into whole plants. Genetic stock provides a source for plant breeders to improve the genetic traits of commercial cultivars.
[0089] "Haplotype" is the genotype of an individual at a plurality of loci, i.e., the combination of alleles. Typically, the loci described by a haplotype are physically and genetically linked, i.e., located on the same chromosomal segment. The term "haplotype" can refer to the alleles at a particular locus, or to the alleles at a plurality of loci along a chromosomal segment.
[0090] An individual is "homozygous" at a given locus if it has only one type of allele at that locus (e.g., a diploid individual has one copy of the same allele at each of the two homologous chromosomes at a locus). An individual is "heterozygous" at a given locus if there is more than one type of allele present at that locus (e.g., a diploid individual has one copy of each of two different alleles). The term "homogeneity" indicates that members of a population have the same genotype at one or more particular loci. In contrast, the term "heterogeneity" is used to indicate that individuals within a population differ in genotype at one or more particular loci.
[0091] The term "insertion-deletion" refers to an insertion or deletion, where one line can be said to have a fragment of nucleotides or DNA inserted relative to a second line, or the second line can be said to have a fragment of nucleotides or DNA deleted relative to the first line.
[0092] "Introgression" refers to the infusion or introduction of a gene, quantitative trait locus (QTL), marker locus, haplotype, marker profile, trait, or trait locus from the genome of one plant into the genome of another plant.
[0093] A "line" or "strain" is a group of individuals of the same genetic origin, which are typically inbred to some degree and are generally homozygous and homogeneous (isogenic or near-isogenic) at most loci. A "subline" refers to an inbred subset of offspring that is genetically distinct from other similar inbred subsets that originated from the same ancestor. Conventionally, a subline is obtained by inbreeding seeds from a single individual muskmelon plant selected at the F3 to F5 generation until the residual segregating loci are "fixed" or homozygous at most or all loci. A commercial muskmelon variety (or line) is typically produced by pooling ("converging") the self-pollinated progeny of individual F3 to F5 plants from a controlled cross between two genetically distinct parents. While the above-described variety typically appears to be uniform, the self-pollinated variety derived from the selected plants will eventually (e.g., F8) become a mixture of homozygous plants that are genetically different at any locus that was heterozygous in the initially selected F3 to F5 plants. Marker-based sublines that differ from one another at one or more particular marker loci based on qualitative polymorphisms at the DNA level are obtained by genotyping seed samples derived from individual self-pollinated progeny from the selected F3-F5 plants. The seed samples can be genotyped directly as seeds or as plant tissue grown from such seed samples. Optionally, seeds that share a common genotype at a particular locus (or loci) are pooled, providing sublines that are genetically identical at the identified loci important for traits of interest (e.g., anther extrusion, flowering time, heading date, and / or scab resistance, etc.).
[0094] "Linked" refers to the phenomenon that alleles on the same chromosome tend to be coinherited more often than would be expected by chance if their transmission were independent. Genetic recombination occurs throughout the genome at a presumed random frequency. A genetic map is constructed by measuring the frequency of recombination between pairs of traits or markers. The closer together traits or markers are on a chromosome, the lower the frequency of recombination and the higher the degree of linkage. Traits or markers are considered linked herein if they segregate substantially together. A recombination probability of 1 / 100 per generation is defined as a map distance of 1.0 centiMorgan (1.0 cM).
[0095] Genetic elements or genes located in a single chromosomal segment are physically linked. Advantageously, the two locus positions are in close proximity such that recombination between the homologous chromosome pair during meiosis does not occur with high frequency between the two loci, e.g., such that the linked loci segregate together at least about 90% of the time, e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.75%, or more of the time. Genetic elements located within a chromosomal segment are also genetically linked, typically within a genetic recombination distance of less than or equal to 50 centiMorgans (cM), e.g., about 49, 40, 30, 20, 10, 5, 4, 3, 2, 1, 0.75, 0.5, or 0.25 cM or less. That is, two genetic elements within a single chromosomal segment recombine with each other during meiosis less than or equal to about 50% of the time, e.g., about 49%, 40%, 30%, 20%, 10%, 5%, 4%, 3%, 2%, 1%, 0.75%, 0.5%, or 0.25% or less of the time.
[0096] In the present application, the phrase "closely linked" with respect to a locus means that recombination between two linked loci occurs at a frequency of equal to or less than 10% (i.e., separated by no more than 10 cM on a genetic map). In other words, closely linked loci are co-inherited at least 90% of the time. Markers loci are particularly useful in the present application when they exhibit a significant likelihood of co-segregation (linkage) with a desired trait (e.g., resistance to browning). Closely linked loci, such as a marker locus and a second locus, can exhibit an interlocus recombination frequency of 10% or less, preferably about 9% or less, more preferably about 8% or less, more preferably about 7% or less, still more preferably about 6% or less, more preferably about 5% or less, still more preferably about 4% or less, more preferably about 3% or less, and still more preferably about 2% or less. In highly preferred embodiments, the relevant loci exhibit a recombination frequency of about 1% or less, e.g., about 0.75% or less, more preferably about 0.5% or less, or more preferably about 0.25% or less. Two loci located on the same chromosome are also said to be "adjacent" to each other at a distance such that recombination between the two loci occurs at a frequency of less than 10% (e.g., about 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.75%, 0.5%, 0.25%, or less). In some cases, two different markers can have the same genetic map coordinates. In such cases, the two markers are so proximal to each other that recombination between them occurs at a frequency as low as undetectable.
[0097] "coupled" state linkage refers to a state in which the "favorable" allele at the locus of interest is physically associated on the same chromosome strand with the "favorable" allele of the corresponding linked marker locus. In the coupled state, both favorable alleles are inherited together by the offspring that inherit the chromosome strand. In the "repelled" state linkage, the "favorable" allele at the locus of interest is physically linked with the "unfavorable" allele at the proximal marker locus, and the two "favorable" alleles are not inherited together (i.e., the two loci are "antiphasic" to each other).
[0098] "Linkage disequilibrium" refers to the phenomenon that alleles tend to remain together in linkage groups at a higher frequency than expected from their respective frequencies when segregating from parents to offspring. Being in a state of linkage disequilibrium implies that the associated loci are in a physically sufficient degree of proximity along the length of the chromosome such that they segregate together at a higher than random (i.e., nonrandom) frequency. Markers that exhibit linkage disequilibrium are considered to be linked. Linked loci co-segregate more than 50% of the time, e.g., from about 51% to about 100% of the time. In other words, two markers that co-segregate have a recombination frequency of less than 50% (and are by definition separated by less than 50 cM on the same linkage group). As used herein, linkage can be between two markers, or between a marker and a locus affecting a phenotype. A marker locus can be "associated" (linked) with a trait. The degree of linkage of a marker locus to a locus affecting a phenotypic trait is measured as, e.g., the statistical probability of co-segregation of the molecular marker with the phenotype (e.g., F-statistic or LOD score).
[0099] "Linkage group" (LG) refers to traits or markers that segregate substantially together. A linkage group corresponds substantially to a region of a chromosome that contains genetic material encoding the trait or marker. Thus, a linkage group can be substantially attributed to a particular chromosome.
[0100] "Locus" is a defined segment of DNA. For example, it can refer to the position on a chromosome at which a nucleotide, gene, sequence, or marker is located.
[0101] "Map position" is the assigned position on a genetic map of linked genetic markers at which a particular marker can be found within a given species.
[0102] "Mapping" is the process of defining linkage relationships of loci by the use of standard genetic principles of genetic markers, population segregation of markers, and recombination frequencies.
[0103] "Marker" or "molecular marker" or "marker locus" is a term used to denote a nucleic acid or amino acid sequence that is sufficiently unique to characterize a particular locus on a genome. Examples include restriction fragment length polymorphisms (RFLPs), simple sequence repeats (SSRs), target region amplified polymorphisms (TRAPs), isozyme electrophoresis, random amplified polymorphic DNA (RAPD), arbitrarily primed polymerase chain reaction (AP-PCR), DNA amplification fingerprinting (DAF), sequence-specific amplified region (SCAR), amplified fragment length polymorphism (AFLP), and single nucleotide polymorphism (SNP). In addition, other types of molecular markers are known in the art, and phenotypic traits can also be used as markers in the methods. All markers are used to define a particular locus on the luffa genome. Thus each marker is an indication of a particular segment of DNA, with a unique nucleotide sequence. Map positions provide a measure of the relative positions of particular markers with respect to one another. When a trait is stated to be linked to a given marker, it is understood that the sequence affecting the trait actually co-segregates with the marker. If markers are identified on both sides of a trait, a more precise and definitive localization of the trait can be obtained. By measuring the occurrence of markers in hybrid offspring, the presence of a trait can be detected by a relatively simple molecular test, without the need to actually assess the presence of the trait itself, which can be difficult and time-consuming, as actual assessment of the trait requires growing the plants to a stage at which the trait can be expressed.
[0104] "Marker assisted selection" refers to the process of selecting one or more desirable traits in one or more plants by detecting one or more nucleic acids from the plant that are associated with the desired trait(s), and then selecting plants or germplasm that have the nucleic acid(s).
[0105] In certain examples, a plurality of marker loci or haplotypes are used to define a "marker profile." As used herein, "marker profile" refers to a combination of two or more marker loci or haplotypes within the genome of a particular plant. For example, in one example, a particular combination of marker loci or a particular combination of haplotypes defines the marker profile of a particular plant.
[0106] The terms "phenotype," "phenotypic trait," or "trait" can refer to the observable expression of a gene or series of genes. The phenotype can be observable by the naked eye, or by any other means of assessment known in the art, e.g., weighing, counting, measuring (length, width, angle, etc.), microscopy, biochemical analysis, or electromechanical determination. In some cases, the phenotype is directly controlled by a single gene or locus, i.e., a "monogenic trait" or "simple genetic trait." In the absence of large environmental variation, monogenic traits can segregate in a population to produce a "qualitative" or "discrete" distribution, i.e., phenotypes segregate into discrete classes. In other cases, the phenotype is the result of multiple genes and can be considered a "polygenic trait" or "complex trait." Polygenic traits segregate in a population to produce a "quantitative" or "continuous" distribution, i.e., phenotypes cannot be segregated into discrete classes. Both monogenic and polygenic traits can be influenced by the environment in which they are expressed, but polygenic traits tend to have greater environmental composition.
[0107] A "favorable trait" or "favorable phenotype," such as, for example, a fruit brown spot resistance, is a phenotype that is desirable in an agronomic context.
[0108] The term "plant" includes immature or mature whole plants, including plants from which seeds or grain or anthers have been removed. Seeds or embryos that will give rise to plants are also considered plants.
[0109] A "plant part" refers to any portion or piece of a plant, including leaves, stems, shoots, roots, root tips, anthers, seeds, grain, embryos, pollen, ovules, flowers, cotyledons, hypocotyls, pods, flowers, shoots, stems, tissues, tissue cultures, cells, and the like.
[0110] A "polymorphism" refers to a change or difference between two related nucleic acids. A "nucleotide polymorphism" refers to a nucleotide that is different in one sequence compared to the related sequence when the two nucleic acids are aligned for maximum identity.
[0111] "Polynucleotide," "polynucleotide sequence," "nucleic acid sequence," "nucleic acid fragment," and "oligonucleotide" are used interchangeably herein. These terms encompass nucleotide sequences and the like. A polynucleotide can be a polymer of RNA or DNA, which can be single-stranded or double-stranded, optionally containing synthetic, non-natural, or modified nucleotide bases. A polynucleotide in the form of a DNA polymer can be comprised of one or more strands of cDNA, genomic DNA, synthetic DNA or mixtures thereof.
[0112] "Primer" refers to an (synthetic or naturally occurring) oligonucleotide, which when placed in conditions where synthesis of a complementary strand is catalyzed by a polymerase, is capable of acting as a point of initiation for nucleic acid synthesis or replication along the complementary strand. Typically, a primer is an oligonucleotide of 10 to 30 nucleic acids in length, although longer or shorter sequences can be used. A primer can be provided in double-stranded form, although single-stranded form is preferred. A primer can also comprise a detectable label, such as a 5' end label.
[0113] "Probe" refers to an (synthetic or naturally occurring) oligonucleotide that is complementary (but not necessarily perfectly complementary) to a polynucleotide of interest and forms a double-stranded structure by hybridizing to at least one strand of the polynucleotide of interest. Typically, a probe is an oligonucleotide of 10 to 50 nucleic acids in length, although longer or shorter sequences can be used. A probe can also comprise a detectable label. The terms "label" and "detectable label" refer to a molecule capable of detection, including, but not limited to, radioisotopes, fluorescent agents, chemiluminescent agents, enzymes, enzyme substrates, enzyme cofactors, enzyme inhibitors, chromophores, dyes, metal ions, metal sols, semiconductor nanocrystals, ligands (e.g., biotin, avidin, streptavidin, or hapten), and the like. Detectable labels can also include combinations of reporter genes and quenchers, such as employed in FRET probes or TaqMan probes.
[0114] The term "reporter gene" refers to a substance or a portion thereof that is capable of exhibiting a detectable signal that can be inhibited by a quencher. The detectable signal of the reporter gene is, for example, fluorescence in a detectable range.
[0115] The term "quencher" refers to a substance or a portion thereof that is capable of inhibiting, reducing, suppressing, etc. the detectable signal produced by the reporter gene.
[0116] As used herein, the terms "quenching" and "fluorescence energy transfer" refer to the process in which, when a reporter gene and a quencher are in close proximity, and the reporter gene is excited by an energy source, a major portion of the energy of the excited state is transferred non-radiatively to the quencher, where it is either non-radiatively dissipated or emitted at a different wavelength than the reporter gene.
[0117] The term "quantitative trait locus" or "QTL" refers to a region of DNA that is associated with differential expression of a quantitative phenotypic trait in at least one genetic background (e.g., in at least one breeding population). The region of a QTL encompasses one or more genes that affect the trait under consideration or are in close linkage therewith.
[0118] A "reference sequence" or "consensus sequence" is a defined sequence used as a basis for sequence comparison. The reference sequence for the PHM marker is obtained by sequencing multiple lines at the locus, aligning the nucleotide sequences in a sequence alignment program (e.g., Sequencher), and then taking the most prevalent nucleotide sequence in the alignment. Polymorphisms that exist between individual sequences are annotated in the consensus sequence. The reference sequence is typically not an exact copy of any individual DNA sequence, but rather represents a mixture of the available sequences and is used to design primers and probes for polymorphisms within the sequence.
[0119] "Recombination frequency" is the frequency of exchange events (recombination) between two loci. Recombination frequency can be observed by tracking the segregation of markers and / or traits during meiosis.
[0120] "Selfing," "self-pollination," or "selfing" is the process by which a breeder mates a plant with itself; for example, a second generation hybrid, F2, with itself to produce offspring designated F2:3.
[0121] "SNP" or "single nucleotide polymorphism" refers to sequence variation that occurs when a single nucleotide (A, T, C, or G) in the genome sequence is altered or changed. A "SNP marker" exists when a SNP is mapped to a location on the luffa genome. Numerous techniques for detecting SNPs are known in the art, including allele-specific hybridization, primer extension, direct sequencing, TM, and real-time PCR such as TaqMan assays.
[0122] A "transgenic plant" refers to a plant that comprises within its cells a foreign polynucleotide. Generally, the foreign polynucleotide is stably integrated into the genome such that the polynucleotide is passed on to successive generations. The foreign polynucleotide can be integrated into the genome alone or as part of a recombinant expression cassette. As used herein, "transgenic" refers to any cell, cell line, callus, tissue, plant part or plant that contains a foreign nucleic acid and has been altered by the hand of man to have a genotype that it would not otherwise have. The term "transgenic" as used herein does not encompass the alteration of the genome (chromosomal or extra-chromosomal) by naturally occurring events such as random cross-fertilization, non-recombinant viral infection, non-recombinant bacterial transformation, non-recombinant transposition or spontaneous mutation.
[0123] An "unfavorable allele" of a marker is one that segregates with an unfavorable plant phenotype, thereby providing a useful effect in identifying plants that can be removed from a breeding program or germplasm.
[0124] The term "vector" is used to refer to a polynucleotide or other molecule that transfers a nucleic acid fragment into a cell. Vectors optionally comprise parts that mediate maintenance of the vector, as well as permit its intended use (e.g., sequences necessary for replication, genes that confer drug or antibiotic resistance, multiple cloning sites, operably linked promoter / enhancer elements that enable expression of cloned genes, etc.). Vectors are often derived from plasmids, bacteriophage, or plant or animal viruses.
[0125] Turning now to the Examples:
[0126] Identification of markers. Haplotypes and / or marker profiles associated with traits of interest.
[0127] A variety of methods well known in the art are available for detecting a molecular marker or set of molecular markers that co-segregate with a trait of interest, such as resistance to browning. The basic idea behind these methods is the selection of markers for which the alternative genotypes (or alleles) have significantly different average phenotypes. Thus, one compares the magnitude of the difference between alternative genotypes (or alleles) or the level of significance of such a difference between marker loci. The trait gene is presumed to be located closest to the marker with the greatest associated genotypic difference.
[0128] Two such methods for detecting a trait locus of interest are: 1) population-based association analysis and 2) conventional linkage analysis. In population-based association analysis, lines are obtained from an existing population with multiple founders, such as an elite breeding program. Population-based association analysis relies on decay of linkage disequilibrium (LD) and the idea that, after so many generations of random mating, only the correlation between genes controlling the trait of interest and markers in close linkage to these genes will remain in an unstructured population. In practice, most existing populations have population substructure.
[0129] Thus, by using data obtained from markers randomly distributed throughout the genome, individuals are assigned to populations, thereby minimizing the imbalance caused by population structure in each population (also referred to as subpopulation). For each line in a subpopulation, the phenotypic value is compared to the genotype (allele) at each marker locus. Significant marker-trait correlations indicate close proximity between the marker locus and one or more loci involved in expression of the trait.
[0130] The same principles underlie conventional linkage analysis; however, LD is generated by constructing a population from a small number of founders. The founders are selected to maximize the level of polymorphism within the constructed population, and to assess the level of co-segregation of polymorphic sites with a given phenotype. A variety of statistical methods have been used to identify significant marker-trait associations. One such method is the interval mapping method, in which the likelihood that a gene controlling a trait of interest is located at each of a number of positions along a genetic map (e.g., at 1 cM intervals) is tested. Genotype / phenotype data are used to calculate a LOD score (log of the likelihood ratio) for each test position. When the LOD score exceeds a threshold value, there is significant evidence that a gene controlling the trait of interest is located at that position on the genetic map (which will fall between two specific marker loci).
[0131] The present disclosure provides marker loci that exhibit statistically significant co-segregation with at least one of the following traits: fruit browning resistance, as determined by population-based association analysis.
[0132] Detection of these loci or additional linked loci can be used in a marker-assisted luffa breeding program to produce plants with advantageous characteristics.
[0133] The present application was made in view of the above-described problems, and an object thereof is to provide a molecular marker for screening a browning trait of a luffa fruit.
[0134] In detail, the present application provides, in a first aspect, use of a molecular marker in
[0135] (I) predicting, screening and / or identifying a luffa fruit browning;
[0136] and / or, (II) improving a luffa;
[0137] The molecular marker is located at base position 43044275 of chromosome 3 of a luffa genome;
[0138] The improvement includes accelerating selection of a fruit browning-resistant plant in a progeny luffa by marker-assisted selection breeding.
[0139] The reference version of the sequence in the present application is as follows:
[0140] https: / / ftp.cngb.org / pub / CNSA / data2 / CNP0000780 / CNS0139036 / CNA0007250 / .
[0141] The genome is a high-quality genome version of the third generation assembly, which contains 74 Gb of high-quality sequence, anchors 99.5% of the sequence to 13 chromosomes, the Contig N50 and Scaffold N50 lengths are 5 Mb and 53 Mb respectively, the GC content is about 35.9%, the size of the final assembled luffa genome is 669 Mb, and the repeat sequence content is 62.18%.
[0142] BLAST analysis was performed using the genome to locate the sequence to chromosome 3.
[0143] The second aspect of the application provides a kit, and the primer set comprises:
[0144] (I) a first forward primer set:
[0145] The first forward primer set comprises a nucleotide sequence as shown in SEQ ID NO. 1 and a linker sequence;
[0146] SEQ ID NO. 1: TTTTTGGCAAATAAAAATTTTCTCAGAAC.
[0147] and / or, (II) a second forward primer set:
[0148] The first forward primer set comprises a nucleotide sequence as shown in SEQ ID NO. 2 and a linker sequence;
[0149] SEQ ID NO. 2:
[0150] TTTTTGGCAAATAAAAATTTTCTCAGAAT.
[0151] and / or, (III) a reverse primer set,
[0152] The reverse primer set has a nucleotide sequence as shown in SEQ ID NO. 3;
[0153] SEQ ID NO. 3:
[0154] TGTGGTACTGCTGAAAATCAGGTA.
[0155] and / or, (IV) a nucleotide sequence that encodes the same protein as the nucleotide sequence shown in any one of (I) to (III), but is different from the nucleotide sequence shown in any one of (I) to (III) due to the degeneracy of the genetic code;
[0156] and / or, (V) a nucleotide sequence obtained by substituting, deleting or adding one or more nucleotides to the nucleotide sequence shown in any one of (I) to (IV), and a nucleotide sequence having the same or similar function to the nucleotide sequence shown in any one of (I) to (IV);
[0157] and / or, (VI) a nucleotide sequence having at least 90% sequence homology to the nucleotide sequence described in any one of (I) to (V),
[0158] and / or, the linker sequence comprises a nucleotide sequence shown in SEQ ID NO. 4 or SEQ ID NO. 5.
[0159] SEQ ID NO. 4:
[0160] GAAGGTGACCAAGTTCATGC.
[0161] SEQ ID NO. 5:
[0162] GAAGGTCGGAGTCAACGGAT.
[0163] Optionally, the primer set comprises:
[0164] Brow275-F:
[0165] GAAGGTGACCAAGTTCATGCTTTTTGGCAAATAAAAATTTTCTCAGAAC.
[0166] Brow275-R:
[0167] GAAGGTCGGAGTCAACGGATTTTTTGGCAAATAAAAATTTTCTCAGAAT.
[0168] Brow275-C:
[0169] TGTGGTACTGCTGAAAATCAGGTA.
[0170] Optionally, the 5' ends of the two forward primers Brow275-F and Brow275-R are respectively connected with different fluorescent linker sequences.
[0171] Optionally, the fluorescent linker sequence is a FAM linker sequence or a HEX linker sequence of LGC company.
[0172] Optionally, the FAM linker sequence is GAAGGTGACCAAGTTCATGC (SEQ ID NO. 4).
[0173] Optionally, the HEX adaptor sequence is GAAGGTCGGAGTCAACGGAT (SEQ ID NO. 5).
[0174] The third aspect of the present application provides use of the primer set of the second aspect in:
[0175] (I) predicting, screening and / or identifying fruit browning of Luffa cylindrica;
[0176] and / or, (II) improvement of Luffa cylindrica;
[0177] and / or, (III) a kit for predicting, screening and / or identifying fruit browning of Luffa cylindrica;
[0178] The improvement comprises reducing the proportion of fruit browning in the offspring of Luffa cylindrica by marker-assisted selection breeding.
[0179] The fourth aspect of the present application provides a kit comprising the primer set of the second aspect.
[0180] The fifth aspect of the present application provides use of the kit of the fourth aspect in:
[0181] (I) predicting, screening and / or identifying fruit browning of Luffa cylindrica;
[0182] and / or, (II) improvement of Luffa cylindrica;
[0183] The improvement comprises accelerating the selection of fruit browning-resistant plants in the offspring of Luffa cylindrica by marker-assisted selection breeding.
[0184] The sixth aspect of the present application provides a screening method for fruit browning of Luffa cylindrica, comprising the following steps: extracting genomic DNA of Luffa cylindrica, identifying the genotype of Luffa cylindrica using the primer set of the second aspect and / or the kit of the fourth aspect, and screening to obtain browning-resistant Luffa cylindrica.
[0185] Optionally, the standard for screening browning-resistant Luffa cylindrica according to the genotype is as follows:
[0186] (I) If the base at position 43044275 of chromosome 3 of the Luffa cylindrica genome is CC, the Luffa cylindrica has higher browning resistance than when the site is TT, i.e., the proportion of browning-resistant fruit of CC-type plants is significantly higher than that of TT-type plants;
[0187] (II) If the base at position 43044275 of chromosome 3 of the Luffa cylindrica genome is CT, the Luffa cylindrica has higher browning resistance than when the site is TT, i.e., the proportion of browning-resistant fruit of CT-type plants is significantly higher than that of TT-type plants.
[0188] The seventh aspect of the present application provides a method for breeding Lagenaria siceraria fruits, comprising the following steps: extracting Lagenaria siceraria genomic DNA, PCR amplifying using the primer set according to the second aspect and / or the kit according to the fourth aspect, and obtaining corresponding varieties according to the fluorescence signal of the PCR product.
[0189] Optionally, the standard for evaluating the resistance to browning of Lagenaria siceraria according to the fluorescence signal is as follows:
[0190] (I) if only the fluorescence signal corresponding to the first primer set is detected, the base at position 43044275 of chromosome 3 of the Lagenaria siceraria genome is CC, and compared with the case where the base at this position is TT, the Lagenaria siceraria has higher resistance to browning, that is, the proportion of browning-resistant fruits of the CC type plant is significantly higher than that of the TT type plant;
[0191] (II) if the fluorescence signals corresponding to the first primer set and the second primer set are detected at the same time, the base at position 43044275 of chromosome 3 of the Lagenaria siceraria genome is CT, and compared with the case where the base at this position is TT, the Lagenaria siceraria has higher resistance to browning, that is, the proportion of browning-resistant fruits of the CT type plant is significantly higher than that of the TT type plant.
[0192] Optionally, the reaction procedure of the PCR amplification comprises:
[0193] (I) 94-95℃ pre-denaturation for 14-15min, 94-95℃ denaturation for 20-30s, 65-56℃ annealing and extension for 60-70s, 10-15 cycles, and decreasing 0.6-0.8℃ for each cycle;
[0194] and / or (II) 94-95℃ denaturation for 20-30s, 55-57℃ annealing and extension for 60-70s, 26-30 cycles.
[0195] The present application has at least the following beneficial effects:
[0196] The present application uses the BSA positioning method to locate a gene controlling the browning of Lagenaria siceraria fruits, and develops a KASP molecular marker associated with the Lagenaria siceraria browning gene according to the mutation site of the gene. The KASP molecular marker can be directly used for the identification of Lagenaria siceraria browning and the corresponding genotype, and then used for assisted breeding, which can effectively solve the problems of long breeding period and being easily affected by the environment. By using the KASP molecular marker early, satisfactory plants can be quickly screened, the planting scale is effectively reduced, and the workload of later identification is reduced. The selection efficiency and accuracy are improved. The KASP molecular marker can be used for the identification of various varieties of Lagenaria siceraria, and has great significance for the study of the molecular mechanism of Lagenaria siceraria fruits. Therefore, the present application has important significance in the breeding and research of Lagenaria siceraria fruit browning.
[0197] Example 1 Molecular marker linked to luffa browning gene Acquisition of BSA molecular marker
[0198] This example adopts the BSA positioning method, which includes the following steps:
[0199] Step 1. Construction of population
[0200] The core luffa browning parent 'S273' (as shown in A) and the browning-resistant material 'S370' parent (as shown in C) were obtained by multiple generations of self-crossing breeding. Figure 1 Figure 1 The browning-resistant 'S370' parent was crossed with the browning-resistant 'S370' parent to obtain the F1 generation, and the F2 population was obtained after self-crossing of the F1 generation.
[0201] Step 2. Fruit browning identification
[0202] The F2 population was observed and identified for fruit browning during the marketable fruit stage, and was divided into 0, 1, 3, 5, and 7 levels according to the degree of fruit browning.
[0203] The specific level judgment criteria are as follows:
[0204] 0 level: no obvious browning (white or green);
[0205] 1 level: fruit core and middle pulp; slight browning, browning area ratio less than 30%;
[0206] 3 level: fruit core is brown, middle pulp is slightly brown, browning area ratio is 30% to 50%;
[0207] 5 level: fruit core and middle pulp are brown, browning area ratio is more than 50%;
[0208] 7 level: pulp color is black-brown, browning area ratio is more than 50%.
[0209] Step 3. Preliminary positioning of browning gene
[0210] In order to locate the gene controlling fruit browning, the QTL-SEQ method was used to select 14 single plants with extreme browning and 14 individuals without browning from the F2 separation population, two DNA pools (Browning and Nobrown pools) were constructed, and whole genome resequencing was performed on the two parents (S273 and S370) and the two DNA pools, producing a total of 62.9 Gb of sequence data.
[0211] The reads were aligned to the Luffa aegyptiaca reference genome by BWA software, and the whole genome SNP sites were found by SAM tools software. Analysis found that the sequencing depth of S273, S370, Browning pool, Nobrown pool was 9.6x, 10.8x, 19.8x, 20.3x, respectively, all covering more than 96% of the whole genome.
[0212] Screening the base quality value greater than or equal to 30, the mapping quality value greater than or equal to 30, the base depth greater than or equal to 2 and less than or equal to 60 in the parent, and greater than or equal to 2 and less than or equal to 100 in the two F2 mixed pools, a total of 448493 differential SNPs were obtained. In a 1Mb window, 100kb step, the plot is as follows (see Figure 2 ).
[0213] Since the SNPs associated with the target traits are linked to their surrounding SNPs on the chromosome, the deltaSNP index should be above 0.5 or close to 1, while the delta SNP index in the genomic region without trait association shows random distribution on 0.0. According to the distribution of SNP-Index in the two progeny pools on the genome, we selected a region where the SNP-index in one progeny pool is close to 1, and the SNP-index in the other progeny pool is close to 0, and the difference between the two is above the 99% confidence line. We found that the interval (35.3M-45.7M) on chromosome 3 is a candidate region.
[0214] Step 4. Fine mapping of browning gene
[0215] Through step 3, the chromosomal region controlling Luffa aegyptiaca browning was obtained. In order to further narrow down the candidate region of the browning gene, DNA sequence variation within the segment was analyzed, and KASP markers were developed. The F2 population was genotyped using the developed KSAP molecular markers, and the JoinMap4.0 software was used for linkage analysis of the genotyping results, and a genetic linkage map was obtained. Using MapQTL6.0 software, combined with the browning phenotype data of F2, QTL linkage analysis was performed on the browning phenotype, and the marker with the largest LOD was found from the developed markers, with LOD being 18.24 (see Figure 4 ), which can explain 32% of the variation (see Figures 3-4 ). The marker is Chr03-43044275, named Brow275.
[0216] The sequence of Chr03-43044275 and its related region is as follows:
[0217] ATGCATCTCATCGAGAAGGTCATGTGCTTGATCTAACCACCCAAGTGAAATGCATGCATTTATGACATGAACTAACAAAGAATCGTCATTAGATACAGGTGACTCTTCCCTCTCTGCCTTGATAAGAAACTGAGCTAAATCCTTGGTCTTACCAGCTTCCAGAAAAGCCCTAACTAATTTCACAAGAATAGCTTCAGTTGGCTGGAGAACACCACGTTCAGTTGTAACTAATTCAACTTGCAATTGCAGCTTCATAAGCAAGGTGCGAAGAATTTCCTTGGCTTCAATATCAAGGTTCGGAAAATTTCGATCCATAACAAAATCTTCATAAGAAATGGACTTCCCATTTAATATCTTATCTTTTAATCCATCATTTTGGCAAATAAAAATTTTCTCAGAA[C / T]CTAGTCCAGATGATGGTCTTACCTGATTTTCAGCAGTACCACATACTAAGGTAGTTGTAGCGATTGCATTTTTAGCTATCTTTGCTTTCCTCAGCATGTCCAAAACCATGTTAGATGCAGATTCTAGATCTCCAAATTTCAGGTGACATGTGAGTAAACAACTATAAAACTGCCGATACTGAACATCACTTAGATTATAGGCTTCATCTATGTGTCTCTGTAATTTCTTCAATTCTTCTCTCCGCCCGTTTCTTTCATGTATATGAACCATTACCATCAATAAGTTGGCATCTACTTTGACACCAATTCTGGGCATCATATCAAGGAGTTCTTCTGCCTTTCTAGTTGTCCCAAACAAGACACATCCCGCCAGAGCAATGTTAAAAGCTGTAGAATTAGG.
[0218] Example 2
[0219] The application of the molecular marker specifically comprises the following steps:
[0220] (1) Using the genomic DNA of the sample to be tested as a template, amplification primers of the molecular marker are used for amplification to obtain an amplification product;
[0221] The primers designed for the mutation site are as follows:
[0222] Normal primer Brow275-F:
[0223] GAAGGTGACCAAGTTCATGCTTTTTGGCAAATAAAAATTTTCTCAGAAC.
[0224] Forward primer Brow275-R:
[0225] GAAGGTCGGAGTCAACGGATTTTTTGGCAAATAAAAATTTTCTCAGAAT.
[0226] Reverse primer Brow275-C:
[0227] TGTGGTACTGCTGAAAATCAGGTA.
[0228] Two forward primers are respectively connected with different fluorescent linker sequences; the fluorescent linker sequences are FAM or HEX.
[0229] Touchdown PCR is used for amplification, and the amplification procedure is as follows: 94℃ pre-denaturation for 15 min; 95℃ denaturation for 20 s; 65℃-56℃ annealing and extension for 60 s, 10 cycles, and the annealing and extension temperature is reduced by 0.8℃ for each cycle;
[0230] 94℃ denaturation for 20 s; 57℃ annealing and extension for 60 s, 26 cycles.
[0231] (2) The amplification products are detected and analyzed.
[0232] When the sample PCR product is detected only with the fluorescent signal corresponding to primer Brow275-F, the detection site is C:C genotype, and the single plant is determined as the luffa brown phenotype;
[0233] If the sample PCR product is detected only with the fluorescent signal corresponding to primer Brow275-R, the detection site is T:T genotype, and the single plant is determined as the luffa brown phenotype;
[0234] If the sample PCR product is detected with the fluorescent signals corresponding to primers Brow275-F and Brow275-R, the detection site is C:T genotype, and the single plant is determined as the luffa brown phenotype.
[0235] The detection sample in the embodiment is a leaf.
[0236] The leaves of 96 single plants selected from the F2 population constructed by S273 and S370 were genotyped by using Brow275 marker, and three fluorescence signals appeared, wherein the fluorescence signal of C:C was 8 single plants, the fluorescence signal of C:T was 56 single plants, and the fluorescence signal of T:T was 32 single plants. It was found that the genotype was highly consistent with the pollen fertility phenotype by combining the phenotype investigation data (see Table 1). The above results fully show that the Brow275 marker has universality and accuracy, and can be applied to the prediction, identification and screening of luffa fruit browning.
[0237] Table 1 is the fruit browning type and genotype of some single plants in the F2 population constructed by S273 and S370 by using Brow275 marker
[0238]
[0239] The above identification results show that, in breeding, by molecular marker identification and screening, the material detected to have HEX fluorescence signal corresponding to primer Brow275 can be selected to breed luffa browning-resistant material. The material detected to have FAM fluorescence signal corresponding to primer Brow275 can be selected to breed browning homozygous material. The material detected to have FAMHEX fluorescence signal (including the fluorescence signals corresponding to the above two primers) can be selected to breed hybrid material resistant to browning, and the results are shown in Figure 5 By the previous molecular marker screening, the workload of later screening and identification can be reduced, and the breeding process can be accelerated.
[0240] In summary, by locating and developing the common luffa browning-resistant major gene, the application realizes the molecular marker-assisted selection of browning-resistant breeding, and effectively improves the selection efficiency of browning-resistant traits. The application has important significance for establishing an efficient luffa quality breeding molecular system and improving the level of luffa quality breeding.
[0241] It should be noted that the application is not limited to the above embodiments. The above embodiments are only examples, and embodiments having the same technical idea and playing the same role and effect within the scope of the technical solutions of the application are all included in the technical scope of the application. In addition, within the scope of the main idea of the application, various modifications that can be thought of by those skilled in the art, and other ways constructed by combining part of the constituent elements in the embodiments are also included in the scope of the application.
Claims
1. Applications of primer sets in the following aspects: (I) Predicting, screening and / or identifying browning in loofah fruits; Or, (II) Improvements to loofah; or, (III) Preparation of a kit for predicting, screening and / or identifying browning in loofah fruits; The improvement involves accelerating the selection of fruit-resistant plants in offspring loofah through molecular marker-assisted selection breeding. The primer set is as follows: (1) First set of forward primers: The first forward primer set consists of a nucleotide sequence and a fluorescent adapter sequence as shown in SEQ ID NO.1; And, (2) the second forward primer set: The second forward primer set consists of a nucleotide sequence and a fluorescent adapter sequence as shown in SEQ ID NO.2; and, (3) reverse primer set, The reverse primer set is a nucleotide sequence as shown in SEQ ID NO.3; The fluorescent adapter sequence is a nucleotide sequence as shown in SEQ ID NO.4 or SEQ ID NO.5; First forward primer set and second forward primer set 5 , Each end is connected to a different fluorescent connector sequence; (a) If only the fluorescence signal corresponding to the first primer set is detected, the detection site is the CC genotype; compared with the TT site, the loofah has a higher browning resistance, that is, the proportion of browning resistant fruits of CC type plants is significantly higher than that of TT type plants. (b) If the fluorescence signals corresponding to the first primer set and the second primer set are detected at the same time, the detection site is the CT genotype. Compared with the site being TT, the loofah has a higher browning resistance, that is, the proportion of browning resistant fruits of CT type plants is significantly higher than that of TT type plants.
2. The use of a kit including the primer set as described in claim 1 in the following aspects: (I) Predicting, screening and / or identifying browning in loofah fruits; Or, (II) Improvements to loofah; The improvement involves accelerating the selection of fruit-resistant plants in offspring loofah through molecular marker-assisted selection breeding. (a) If only the fluorescence signal corresponding to the first primer set is detected, the detection site is the CC genotype; compared with the TT site, the loofah has a higher browning resistance, that is, the proportion of browning resistant fruits of CC type plants is significantly higher than that of TT type plants. (b) If the fluorescence signals corresponding to the first primer set and the second primer set are detected at the same time, the detection site is the CT genotype. Compared with the site being TT, the loofah has a higher browning resistance, that is, the proportion of browning resistant fruits of CT type plants is significantly higher than that of TT type plants.
3. A method for selecting and breeding loofah fruits, characterized in that, The process includes the following steps: extracting genomic DNA from the loofah, amplifying it by PCR using the primer set as described in claim 1 or the kit as described in claim 2, and determining the corresponding variety based on the fluorescence signal of the PCR product; (I) If only the fluorescence signal corresponding to the first primer set is detected, the detection site is the CC genotype; compared with the TT site, the loofah has a higher browning resistance, that is, the proportion of browning resistant fruits of CC type plants is significantly higher than that of TT type plants. (II) If the fluorescence signals corresponding to the first primer set and the second primer set are detected at the same time, the detection site is the CT genotype. Compared with the site being TT, the loofah has a higher browning resistance, that is, the proportion of browning resistant fruits of CT type plants is significantly higher than that of TT type plants.
4. The method as described in claim 3, characterized in that, The reaction procedure for the PCR amplification is as follows: (I) Pre-denaturation at 94℃~95℃ for 14min~15min, denaturation at 94℃~95℃ for 20s~30s, annealing and extension at 65℃~56℃ for 60s~70s, 10~15 cycles, each cycle decreasing by 0.6℃~0.8℃; (II) 94℃~95℃ denaturation for 20s~30s, 55℃~57℃ annealing and extension for 60s~70s, 26~30 cycles.
Citation Information
Patent Citations
SSR primer and method for identifying purity of hybrid seeds of Zaojia Luffa cylindrica
CN111961740A
Crossbreeding and breeding method of low-browning towel gourds
CN115812590A